ID: 1011640446

View in Genome Browser
Species Human (GRCh38)
Location 6:89412200-89412222
Sequence TCCTCCGCCGGCGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011640446_1011640457 9 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640446_1011640458 12 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640458 6:89412235-89412257 GCGGCAGTTCCTCCCGGAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 109
1011640446_1011640454 -7 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640446_1011640456 6 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640456 6:89412229-89412251 CGGAGCGCGGCAGTTCCTCCCGG 0: 1
1: 0
2: 0
3: 9
4: 74
1011640446_1011640459 13 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640459 6:89412236-89412258 CGGCAGTTCCTCCCGGAGGAGGG 0: 1
1: 1
2: 0
3: 3
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011640446 Original CRISPR TCCTCCGCCGGCGGGCGGGG CGG (reversed) Exonic