ID: 1011640454

View in Genome Browser
Species Human (GRCh38)
Location 6:89412216-89412238
Sequence CGGAGGAGTCAGCCGGAGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011640440_1011640454 -1 Left 1011640440 6:89412194-89412216 CCTCCCCCGCCCCGCCCGCCGGC 0: 2
1: 10
2: 62
3: 597
4: 3353
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640443_1011640454 -5 Left 1011640443 6:89412198-89412220 CCCCGCCCCGCCCGCCGGCGGAG 0: 1
1: 1
2: 14
3: 70
4: 484
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640434_1011640454 9 Left 1011640434 6:89412184-89412206 CCCGAAGCCCCCTCCCCCGCCCC 0: 1
1: 1
2: 24
3: 189
4: 1560
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640437_1011640454 1 Left 1011640437 6:89412192-89412214 CCCCTCCCCCGCCCCGCCCGCCG 0: 2
1: 2
2: 57
3: 392
4: 2863
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640430_1011640454 27 Left 1011640430 6:89412166-89412188 CCCGCGGTTCCCAGCGCGCCCGA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640442_1011640454 -4 Left 1011640442 6:89412197-89412219 CCCCCGCCCCGCCCGCCGGCGGA 0: 1
1: 0
2: 3
3: 53
4: 533
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640433_1011640454 17 Left 1011640433 6:89412176-89412198 CCAGCGCGCCCGAAGCCCCCTCC 0: 1
1: 1
2: 1
3: 25
4: 290
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640435_1011640454 8 Left 1011640435 6:89412185-89412207 CCGAAGCCCCCTCCCCCGCCCCG 0: 1
1: 0
2: 15
3: 191
4: 1554
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640431_1011640454 26 Left 1011640431 6:89412167-89412189 CCGCGGTTCCCAGCGCGCCCGAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640444_1011640454 -6 Left 1011640444 6:89412199-89412221 CCCGCCCCGCCCGCCGGCGGAGG 0: 1
1: 2
2: 5
3: 61
4: 421
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640447_1011640454 -10 Left 1011640447 6:89412203-89412225 CCCCGCCCGCCGGCGGAGGAGTC 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640432_1011640454 18 Left 1011640432 6:89412175-89412197 CCCAGCGCGCCCGAAGCCCCCTC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640446_1011640454 -7 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640436_1011640454 2 Left 1011640436 6:89412191-89412213 CCCCCTCCCCCGCCCCGCCCGCC 0: 1
1: 7
2: 83
3: 867
4: 6165
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107
1011640438_1011640454 0 Left 1011640438 6:89412193-89412215 CCCTCCCCCGCCCCGCCCGCCGG 0: 1
1: 3
2: 30
3: 219
4: 1588
Right 1011640454 6:89412216-89412238 CGGAGGAGTCAGCCGGAGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011640454 Original CRISPR CGGAGGAGTCAGCCGGAGCG CGG Exonic