ID: 1011640457

View in Genome Browser
Species Human (GRCh38)
Location 6:89412232-89412254
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011640444_1011640457 10 Left 1011640444 6:89412199-89412221 CCCGCCCCGCCCGCCGGCGGAGG 0: 1
1: 2
2: 5
3: 61
4: 421
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640446_1011640457 9 Left 1011640446 6:89412200-89412222 CCGCCCCGCCCGCCGGCGGAGGA 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640449_1011640457 4 Left 1011640449 6:89412205-89412227 CCGCCCGCCGGCGGAGGAGTCAG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640443_1011640457 11 Left 1011640443 6:89412198-89412220 CCCCGCCCCGCCCGCCGGCGGAG 0: 1
1: 1
2: 14
3: 70
4: 484
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640442_1011640457 12 Left 1011640442 6:89412197-89412219 CCCCCGCCCCGCCCGCCGGCGGA 0: 1
1: 0
2: 3
3: 53
4: 533
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640440_1011640457 15 Left 1011640440 6:89412194-89412216 CCTCCCCCGCCCCGCCCGCCGGC 0: 2
1: 10
2: 62
3: 597
4: 3353
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640450_1011640457 1 Left 1011640450 6:89412208-89412230 CCCGCCGGCGGAGGAGTCAGCCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640437_1011640457 17 Left 1011640437 6:89412192-89412214 CCCCTCCCCCGCCCCGCCCGCCG 0: 2
1: 2
2: 57
3: 392
4: 2863
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640438_1011640457 16 Left 1011640438 6:89412193-89412215 CCCTCCCCCGCCCCGCCCGCCGG 0: 1
1: 3
2: 30
3: 219
4: 1588
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640436_1011640457 18 Left 1011640436 6:89412191-89412213 CCCCCTCCCCCGCCCCGCCCGCC 0: 1
1: 7
2: 83
3: 867
4: 6165
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640453_1011640457 -3 Left 1011640453 6:89412212-89412234 CCGGCGGAGGAGTCAGCCGGAGC 0: 1
1: 0
2: 1
3: 11
4: 82
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640448_1011640457 5 Left 1011640448 6:89412204-89412226 CCCGCCCGCCGGCGGAGGAGTCA 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640435_1011640457 24 Left 1011640435 6:89412185-89412207 CCGAAGCCCCCTCCCCCGCCCCG 0: 1
1: 0
2: 15
3: 191
4: 1554
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640451_1011640457 0 Left 1011640451 6:89412209-89412231 CCGCCGGCGGAGGAGTCAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640447_1011640457 6 Left 1011640447 6:89412203-89412225 CCCCGCCCGCCGGCGGAGGAGTC 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1011640434_1011640457 25 Left 1011640434 6:89412184-89412206 CCCGAAGCCCCCTCCCCCGCCCC 0: 1
1: 1
2: 24
3: 189
4: 1560
Right 1011640457 6:89412232-89412254 AGCGCGGCAGTTCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type