ID: 1011643185

View in Genome Browser
Species Human (GRCh38)
Location 6:89433574-89433596
Sequence GAAGAGGGAGGCGCCCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 308}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011643185_1011643203 23 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643203 6:89433620-89433642 GAATATGGAACTTCGGGCGAGGG No data
1011643185_1011643205 29 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643205 6:89433626-89433648 GGAACTTCGGGCGAGGGAGGTGG No data
1011643185_1011643195 1 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643195 6:89433598-89433620 CCTGGCATCAGTTGCCTCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 305
1011643185_1011643198 16 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643198 6:89433613-89433635 CTCCCTGGAATATGGAACTTCGG 0: 1
1: 0
2: 1
3: 19
4: 162
1011643185_1011643204 26 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643204 6:89433623-89433645 TATGGAACTTCGGGCGAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 42
1011643185_1011643202 22 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643202 6:89433619-89433641 GGAATATGGAACTTCGGGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1011643185_1011643196 8 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643196 6:89433605-89433627 TCAGTTGCCTCCCTGGAATATGG 0: 1
1: 0
2: 2
3: 19
4: 211
1011643185_1011643199 17 Left 1011643185 6:89433574-89433596 CCCCCCGGGGCGCCTCCCTCTTC 0: 1
1: 0
2: 0
3: 21
4: 308
Right 1011643199 6:89433614-89433636 TCCCTGGAATATGGAACTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011643185 Original CRISPR GAAGAGGGAGGCGCCCCGGG GGG (reversed) Intronic
900487627 1:2930971-2930993 GAACAGAAATGCGCCCCGGGTGG - Intergenic
900969356 1:5980887-5980909 GAAGAGGGAGGAGGACAGGGAGG - Intronic
901038883 1:6352334-6352356 GAAGAGGGAGGGGCCAGGTGTGG - Intronic
901410401 1:9079030-9079052 GAAGAGGGAGACACCGCGCGTGG - Intronic
901660767 1:10796484-10796506 AGACGGGGAGGCGCCCCGGGAGG + Intronic
901825680 1:11859360-11859382 GAGGGGAGAGGCGCCGCGGGTGG - Intergenic
903190948 1:21655743-21655765 GAAGAGAGAAGAGCACCGGGTGG + Intronic
907160545 1:52365996-52366018 GTAGATGGAGGCGGCGCGGGCGG - Intronic
907872357 1:58454651-58454673 GAGGAGGGAGGGTCCCCAGGTGG - Intronic
912853009 1:113143341-113143363 GAATAGGGAGTAGCCCCAGGAGG + Intergenic
913680911 1:121186518-121186540 GTACAGGGAGGTGCCCCGGCCGG + Intronic
914032741 1:143974157-143974179 GTACAGGGAGGTGCCCCGGCCGG + Intergenic
914156703 1:145093808-145093830 GTACAGGGAGGTGCCCCGGCCGG - Intronic
914803053 1:150974460-150974482 GAGGAGGGAGGCGGCGCTGGCGG - Intronic
915937323 1:160097237-160097259 GAGCAGGGAGGAGCCCAGGGAGG - Intronic
916511322 1:165474573-165474595 GAAGAGGGAGGAGGCCAGTGTGG + Intergenic
916588978 1:166172004-166172026 GAAGAGGGAGGAGCCCAAGATGG - Intergenic
917975220 1:180233751-180233773 GGAGAAGGAGGAGCCCCGCGGGG + Intronic
919705268 1:200669801-200669823 GAAGGGGGAGACGGCCCGAGCGG - Exonic
919922657 1:202175707-202175729 GGAGAGGGATGCGCTCAGGGTGG - Intergenic
920468224 1:206205042-206205064 GTACAGGGAGGTGCCCCGGCCGG + Intronic
920887030 1:209938636-209938658 GAGGAGCGAGGGGCCACGGGGGG + Intronic
922504568 1:226119062-226119084 CAACAGGGAGGAGCCCCAGGTGG + Intergenic
922597508 1:226825259-226825281 CAAGAGGAAGGGGCCCCAGGTGG - Intergenic
922804665 1:228379049-228379071 GAGGACGGAGACGCCCCGAGGGG - Intergenic
923596163 1:235362104-235362126 GAAGAGGTAGGGGCCCTGGGAGG - Intergenic
924527152 1:244863313-244863335 GTAGGGGGAGGAGCCGCGGGCGG - Intronic
1062857780 10:788040-788062 GATGTGGGAGCCGCCCTGGGAGG + Intergenic
1062976250 10:1685680-1685702 GAAAAGGGAGGCGACGCAGGAGG + Intronic
1063454279 10:6172281-6172303 GGAGAGGGAGGCGCACAGGCGGG + Intronic
1067434198 10:46265768-46265790 GAACAGGGAGCGGCCCCTGGAGG + Intergenic
1068247774 10:54394781-54394803 TAAGAGGCAGGCGCACCTGGGGG + Intronic
1069832595 10:71290327-71290349 GAAGAAGGATGGGCCCAGGGAGG - Intronic
1070664945 10:78336278-78336300 GAAGATGCAGGGGCCCTGGGAGG + Intergenic
1071601647 10:86961487-86961509 GAGGAGGGAGGAGCCCCCTGGGG - Intronic
1072591812 10:96833323-96833345 GCGGACGGGGGCGCCCCGGGAGG + Intronic
1073323353 10:102628740-102628762 GAAGAGGGAGGCAGCCAGGAAGG + Intronic
1074494701 10:113969522-113969544 TAAGAGGCAGGCGCACCTGGGGG + Intergenic
1074691398 10:116007813-116007835 GAAGAGGGAGGAGCTCGGTGTGG + Intergenic
1075372583 10:121950418-121950440 GAGGAGGGAGGAGCTCCGGAGGG + Intergenic
1076564194 10:131386935-131386957 GCAGAGGGAGGCGCAGAGGGAGG + Intergenic
1076755233 10:132567091-132567113 GAGGAGGGAGGCTCCCGGGTGGG + Intronic
1076909164 10:133378951-133378973 TCAGAGGGAAGCGCCCCGCGTGG - Intergenic
1077059363 11:611025-611047 GAAGAGGGAGGTGACCAAGGAGG + Exonic
1077162845 11:1121492-1121514 AAAGAGGGCGGGGCCCCAGGAGG + Intergenic
1077554447 11:3219183-3219205 GAAGAGGAAGGCGCCACACGTGG - Intergenic
1078541694 11:12218257-12218279 GCAGAGGCAGGGGCCCAGGGAGG - Intronic
1078922633 11:15844840-15844862 AAAGAGGGCGGGGGCCCGGGTGG - Intergenic
1083296658 11:61718803-61718825 GGATAGGGAGGCGGGCCGGGCGG + Intronic
1083412536 11:62504348-62504370 CAGGAGGGAGGAGCCCCAGGTGG - Intronic
1083751975 11:64765984-64766006 GGAGGGGGAGGGGCCCCAGGCGG + Intronic
1083987881 11:66228743-66228765 GGAGAGGGAGGGGCATCGGGAGG + Intronic
1084365022 11:68692281-68692303 GGAGAGGGAGGCAGCCAGGGTGG - Intergenic
1084444696 11:69196835-69196857 GCAGAGGGACGGGCCCAGGGTGG + Intergenic
1084646675 11:70463209-70463231 GACGAGGCAGGTGCCCTGGGAGG - Intergenic
1085561014 11:77473379-77473401 GAGGCGGGCGGCGCCCCGCGAGG - Intronic
1089262540 11:117232642-117232664 GAAGTGGGAGGTGCCGCGCGCGG + Exonic
1091108353 11:132943352-132943374 GAGGAGGGAGGCGGCCAGGAGGG + Exonic
1094564914 12:31590770-31590792 GAAGCGGCAGGCGGCCGGGGAGG + Exonic
1095773761 12:45990614-45990636 GAGGAGGGAGACGCGCAGGGAGG - Intronic
1096230115 12:49892094-49892116 GAAGAGTGAGGGGGCCTGGGAGG - Intronic
1096769971 12:53928795-53928817 GGAGAGGGAGGTGCGGCGGGTGG + Intergenic
1100434642 12:94560672-94560694 GAAGAGGCAGGAGGCCCAGGTGG + Intergenic
1101611629 12:106297974-106297996 TAAGAGGAAGGGGCCCAGGGTGG + Intronic
1102592343 12:113966295-113966317 AAAGATGGCGGCGCCCAGGGCGG - Exonic
1102861137 12:116337571-116337593 GAAGGGGGAGGCACCCTGGACGG - Intergenic
1103239046 12:119398067-119398089 GGAGAGGAAGGGGCCGCGGGGGG + Intronic
1103348161 12:120265108-120265130 GAAGTGGGGGGCGGCCCTGGAGG + Intronic
1103509989 12:121467445-121467467 GAAGGGGCTGGCCCCCCGGGCGG + Intronic
1104410503 12:128553888-128553910 GGAGAGGGAGGGACCCCGCGTGG + Intronic
1105413901 13:20193013-20193035 GGAGGGGGCGGCGCCGCGGGCGG + Intergenic
1105464392 13:20624333-20624355 CTAGAGGGTGGCGCCCAGGGAGG - Intronic
1113134468 13:107074180-107074202 GGACAGGGAGGCGCCCCTTGGGG + Intergenic
1113655619 13:112066709-112066731 GAGGGGGGAGGAGGCCCGGGAGG - Intergenic
1113843109 13:113371470-113371492 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843209 13:113371709-113371731 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843247 13:113371806-113371828 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843279 13:113371886-113371908 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1114062224 14:19028081-19028103 GGAGATGGAGGAGCCCCTGGGGG - Intergenic
1114100036 14:19371912-19371934 GGAGATGGAGGAGCCCCTGGGGG + Intergenic
1114473622 14:22980076-22980098 GAAGAGGAACGCGGCCAGGGAGG - Intronic
1118797067 14:69153171-69153193 GCAGAGGGAGGAGCCTCGGGGGG - Intergenic
1121104412 14:91271141-91271163 GCAGAGGGAGGGGCACAGGGAGG + Intergenic
1121249622 14:92489848-92489870 GAAGAGGCAGGCACTCCGGCAGG - Intronic
1121279407 14:92688256-92688278 GTGAGGGGAGGCGCCCCGGGAGG - Exonic
1121308762 14:92923615-92923637 CAAGGGGGAGTTGCCCCGGGGGG - Intronic
1122149218 14:99715821-99715843 GAAGAGGAAGCAGCTCCGGGAGG + Exonic
1122647857 14:103207152-103207174 GGAGTTGGAGCCGCCCCGGGCGG + Intergenic
1123049390 14:105533383-105533405 GGAGAGGGAGGCACCCAAGGAGG - Intergenic
1124619417 15:31265387-31265409 CAGGAGGGAGGCCCCCCGGAAGG - Intergenic
1124922286 15:34038826-34038848 GGAGGAGGAGGCGCCCCGCGAGG - Exonic
1125575276 15:40751048-40751070 GAAGAGGGTGACTCCCAGGGAGG + Intronic
1125852724 15:42920397-42920419 GGGGAGGGCGGCGCCCTGGGGGG + Intronic
1128347144 15:66861485-66861507 CAAGAGGGAAGAGCCCCGGAAGG + Intergenic
1129440826 15:75579523-75579545 GGAGGGGGAGGGGACCCGGGCGG + Intergenic
1130270154 15:82441939-82441961 GAAGAGGGAGACTCCACGGCAGG + Intergenic
1130490182 15:84425533-84425555 GAAGAGGGAGACTCCGCGGCAGG - Intergenic
1130650714 15:85760654-85760676 GGGCAGGGAGGCGCCCCGGGTGG - Exonic
1131075184 15:89490987-89491009 GAGGTGGGAGGAGCCCCTGGGGG + Intronic
1132163943 15:99566388-99566410 GAGGAGCTAGGCGCCCGGGGAGG + Intronic
1132415392 15:101615373-101615395 GAAGAGGGAGGCTGGCCTGGAGG + Intergenic
1132563676 16:610714-610736 GTAGAGGGAGGAGCTCCTGGAGG - Intronic
1132941621 16:2511388-2511410 GAAGCGGGAGGGGACCAGGGAGG + Intronic
1133113114 16:3561484-3561506 GAAGAGGGAGGTGACCTGGCGGG - Intronic
1135047805 16:19168813-19168835 CAACAGGGGTGCGCCCCGGGAGG + Intronic
1135992859 16:27228470-27228492 GAAGAGGGCGGTGGCCAGGGAGG - Intronic
1135993008 16:27228918-27228940 GAAGAGGGTGGAGGCCGGGGAGG - Intronic
1136107458 16:28040327-28040349 GAAGAGGGAGGCCTCTGGGGAGG - Intronic
1136392426 16:29974031-29974053 GGAGAGGGAGGAGGCCGGGGCGG + Exonic
1137708230 16:50549333-50549355 GAAGAAGGAGGCGCGGTGGGAGG - Intronic
1138252179 16:55509537-55509559 GAGGAGGGAGGTGGCCCGAGGGG + Intronic
1139442782 16:66977181-66977203 GAACAGGGAGGGGACCAGGGTGG + Intergenic
1139553644 16:67691653-67691675 GCAGAGGGAGGAGCTCCTGGGGG - Intronic
1140985321 16:80153070-80153092 TAAGAGGGAGGTGACCCAGGTGG - Intergenic
1141527165 16:84618648-84618670 GAAGAGGGAGGCGAAGCCGGGGG - Intergenic
1142009085 16:87704591-87704613 GGAGAAGGAGGCGCCTGGGGAGG + Intronic
1142403603 16:89873862-89873884 GAGGAGCGCGGCGGCCCGGGTGG + Intronic
1142764025 17:2055966-2055988 GGAGGGGGCAGCGCCCCGGGCGG - Intronic
1142866832 17:2796396-2796418 GAAGAGGGAGGTGCCACGCTGGG + Intronic
1142986359 17:3697331-3697353 GATGAGGGAGGGCCTCCGGGGGG + Intergenic
1143015277 17:3888308-3888330 GTAGAGGGAGGCCCAGCGGGTGG + Intronic
1143096347 17:4480516-4480538 GAAGAGGGAGCTGCGCCGTGGGG - Intronic
1143168461 17:4911374-4911396 GGAGAGGGAGGCCACCAGGGCGG + Intergenic
1143389584 17:6552364-6552386 GCAGAGGGAGGGGCACAGGGAGG + Intronic
1144941855 17:18947647-18947669 GAAGAGGGAGGAGCCAAGGAAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147604919 17:41769144-41769166 GAAGAAGGAGGCGTCGCGGCGGG - Exonic
1147614936 17:41822151-41822173 GGAGGGGCAGGGGCCCCGGGTGG - Intronic
1147948277 17:44092735-44092757 TAGGAGGGAGGCGTCCCAGGGGG + Exonic
1148018673 17:44539714-44539736 AAAGAGGGAGGCACCCAGAGGGG - Intergenic
1148342923 17:46884141-46884163 GAAGAGGTGGGGGTCCCGGGGGG - Intronic
1148852343 17:50561229-50561251 GAAGCGGGACTCGCGCCGGGCGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150314110 17:64154507-64154529 GGGGAGGGAGGCTCTCCGGGGGG + Intronic
1150723966 17:67636635-67636657 TACGAGGGAGTCGCCCCTGGGGG - Intronic
1151670798 17:75570782-75570804 CAAGAGGGAGGTGCCCTTGGGGG - Intronic
1151749703 17:76029506-76029528 GCAGGGGGAGGTGCCCTGGGCGG + Intergenic
1152742165 17:82023129-82023151 CATGAGGGTGGGGCCCCGGGAGG - Intronic
1152923977 17:83079391-83079413 GAGGAGGGGGCCGCGCCGGGCGG - Intergenic
1153030890 18:712242-712264 AAAGTGGGAGGCGCGCCTGGGGG - Intronic
1153285772 18:3452652-3452674 GGAGAGGGAGGGGCCCAAGGAGG - Intronic
1154231384 18:12559126-12559148 GCAGGGGGAGGCGCCCCCTGGGG + Intronic
1154309175 18:13254269-13254291 GAGGAGTGAGGGGCCCCAGGTGG + Intronic
1155519841 18:26656891-26656913 GAGGAGGGAGGGGCTCGGGGAGG + Intronic
1156264426 18:35473481-35473503 GAAGAGGGAGCTGCCCTGGAAGG + Intronic
1156270298 18:35524345-35524367 GAAGAGGGAAGCGGCTCGGGCGG + Intergenic
1156310739 18:35919406-35919428 GAACAGGGAGGAGGCCAGGGTGG + Intergenic
1157386134 18:47261146-47261168 GAGGCGGCAGGCGCCGCGGGAGG - Intergenic
1158864067 18:61620236-61620258 GAAGAGGGAGAGACCCAGGGAGG - Intergenic
1159920327 18:74221698-74221720 GAAGAGGGGAGAGCCCCGGGAGG - Intergenic
1160163624 18:76492810-76492832 GGAGGGGGAGGCGCTCCGTGGGG + Intronic
1160286303 18:77546855-77546877 GAAGAGGGAGGGGCGGCGAGTGG - Intergenic
1160499658 18:79395636-79395658 GGGGAGGGGGGCGCCCGGGGAGG - Intergenic
1160540375 18:79617443-79617465 GGGGAGGGCGGCGTCCCGGGGGG - Intergenic
1160613968 18:80109731-80109753 GGAGCGGGGGCCGCCCCGGGAGG + Intronic
1160758802 19:772156-772178 GAACAGGGAGGAGGCCCGTGTGG - Intergenic
1160780886 19:877612-877634 CCAGAGGGAGGCGCCCCCGGGGG - Intronic
1160848919 19:1180426-1180448 GCCGAGGGAGGTGCCCAGGGAGG + Intronic
1160895754 19:1401183-1401205 GGAGACAGAGGCGCCCCGGCGGG + Intronic
1161112873 19:2479481-2479503 GAAGAGGCGGGAGCCCCGAGGGG + Intergenic
1161165739 19:2786177-2786199 GGGGAAGGAGGCGTCCCGGGAGG + Intronic
1161232021 19:3179172-3179194 GAAGGTGGAGGCGGCCAGGGCGG - Exonic
1161245852 19:3251436-3251458 GAACAGGGAGGAGGCCCGTGTGG + Intronic
1161400790 19:4065696-4065718 GGGGAGGGCGGCGGCCCGGGCGG - Intronic
1161426325 19:4205486-4205508 AAACAGGGAGGCTCCCCAGGAGG - Intronic
1162049021 19:8020972-8020994 GAAGGGGGAGGCCTCCAGGGAGG + Intronic
1163241670 19:16067482-16067504 GAGGGCGGAGGCACCCCGGGAGG + Intronic
1163334344 19:16661168-16661190 GACGAGGCCGGGGCCCCGGGTGG + Exonic
1163446941 19:17352495-17352517 GAAGAAGTAGGGGCCCAGGGTGG - Intronic
1163455467 19:17403651-17403673 GAGGAGGGGGCGGCCCCGGGAGG - Intronic
1163513548 19:17749570-17749592 GAAGAGGGAGGGGACCCATGGGG + Intronic
1164977072 19:32581358-32581380 GGCGAGGGCGGCGCCCCGCGAGG - Intronic
1165445961 19:35856841-35856863 GAAGAGGGCGGAGCTCCCGGGGG + Intronic
1167094657 19:47368208-47368230 GAACAGTGAGGAGCCCCGTGTGG + Intronic
1167181370 19:47906672-47906694 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167182034 19:47912048-47912070 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167182687 19:47917421-47917443 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167183356 19:47922772-47922794 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167184000 19:47927816-47927838 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167184652 19:47933174-47933196 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167185323 19:47938529-47938551 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167185977 19:47943915-47943937 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167186641 19:47949286-47949308 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167187292 19:47954674-47954696 GAACAGTGAGGAGCCCCGTGTGG - Intergenic
1167216569 19:48169756-48169778 GAAGGGGGAGGTGCCAAGGGTGG - Intronic
1167249999 19:48394554-48394576 GCAGAGGGGGGCACCCCGGGTGG + Intergenic
1167541897 19:50093590-50093612 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1167543877 19:50108125-50108147 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1167544551 19:50113479-50113501 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1167545226 19:50118829-50118851 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1167545903 19:50124181-50124203 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1167546580 19:50129516-50129538 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1167547240 19:50134850-50134872 GAACAGTGAGGAGCCCCGTGTGG + Intergenic
1168408179 19:56121350-56121372 GGACAGGGTGGCGGCCCGGGGGG - Intergenic
926195772 2:10762846-10762868 GGAGTGGGAGGAGCCCTGGGAGG - Intronic
927528942 2:23775731-23775753 GAAGAGAGAGGAGCCCAGGAGGG - Intronic
927868573 2:26608850-26608872 GAAGAGGGTGGGCCCCGGGGTGG - Intronic
929133685 2:38602803-38602825 ACTGAGGGGGGCGCCCCGGGAGG + Exonic
929877200 2:45806758-45806780 GATGAGGGAGGACCCCGGGGTGG + Intronic
931256903 2:60581878-60581900 GAGGCGGCGGGCGCCCCGGGTGG - Intergenic
934574477 2:95391513-95391535 GAAGAGGGAGGAGGCTGGGGAGG - Intergenic
936091897 2:109506964-109506986 GAAGAGGAAAGGGCCCAGGGAGG + Intergenic
936329784 2:111537623-111537645 GCAGAGGGAGGCTCCCTGGTGGG + Intergenic
937097340 2:119243913-119243935 GAAGAGGCAGACGCCCATGGAGG + Intronic
937252392 2:120533236-120533258 CAAGAGGGAGGTGCCCTGGGTGG + Intergenic
938095231 2:128457120-128457142 CAAGAGGGAGGCACCCTGGAGGG - Intergenic
938317788 2:130341998-130342020 GAGGAGGTAGGCGCCTGGGGCGG - Exonic
942116738 2:172735786-172735808 GGAGAGGGAGGGGACCCGGGGGG - Intronic
942591566 2:177552449-177552471 GAGAAGGAAGGCGACCCGGGTGG + Exonic
942967632 2:181916079-181916101 CCAGAGTGAGGCGCCGCGGGTGG + Exonic
946416816 2:219543917-219543939 GGAGAGGGAGACGCCGGGGGCGG + Exonic
946420058 2:219559739-219559761 GAAGGGGGAGGCTCCCGTGGGGG - Intronic
947418581 2:229922030-229922052 GGGGAGGGAGGCGGCACGGGCGG - Intronic
947669731 2:231928639-231928661 GCAGAGGGAGGCTTCCCGGGGGG + Intergenic
948288720 2:236808371-236808393 GGAGAGGGAGGGACCACGGGTGG - Intergenic
948303912 2:236932578-236932600 GAAGAGAGAGTAGCCTCGGGTGG + Intergenic
948511172 2:238466275-238466297 GAGGACCGAGGGGCCCCGGGCGG + Intergenic
948768021 2:240233426-240233448 GAGAAGGGAGGCGCCGTGGGTGG - Intergenic
948788348 2:240364711-240364733 CAAGCGGGAGGCGCCCAGAGGGG - Intergenic
948983836 2:241508375-241508397 GCAGAGGGAGGGGCCCGGGGCGG - Intronic
1171365241 20:24618235-24618257 GGAGAGGGGAGAGCCCCGGGAGG + Intronic
1172600504 20:36179653-36179675 CAAGGGGGAGGGGCCCTGGGTGG - Intronic
1173495467 20:43514725-43514747 GAAGATGGCGGGGCCCCGGCGGG + Exonic
1173622364 20:44446229-44446251 GAACAGGGAGGAGCCCAAGGGGG - Intergenic
1177156928 21:17510324-17510346 GAGGAGGGAGGAGGACCGGGAGG - Intergenic
1179030959 21:37719087-37719109 GATGAAGGAGGAGCCCCGAGGGG + Intronic
1180480715 22:15750707-15750729 GGAGATGGAGGAGCCCCTGGGGG - Intergenic
1182524215 22:30905727-30905749 GGAGGGTGAGGCGACCCGGGAGG + Intronic
1182575008 22:31267075-31267097 GAAGATGGAGGGGGCCCGGGAGG + Intronic
1183096027 22:35552838-35552860 GAGGAGGAAGGCGTCCCGGGTGG - Exonic
1183338807 22:37266880-37266902 GAAGAGGGAAGGGCACCGGGTGG - Intergenic
1183524921 22:38317253-38317275 GGAGAGGCTGGCGCGCCGGGCGG - Exonic
1183705295 22:39471954-39471976 GAAGAGGGAGGAGTCCCTAGAGG + Intronic
1183929941 22:41230114-41230136 GAAGAGGGAGGGGAGGCGGGTGG - Intronic
1184228271 22:43143192-43143214 GGAGGAGGAGGCGCCCTGGGCGG - Exonic
1184256200 22:43288486-43288508 GAAGCGGGAGGAGCCCGAGGCGG - Intronic
1184470347 22:44692373-44692395 TAAGGTGGAGGAGCCCCGGGAGG - Intronic
1185281531 22:49971969-49971991 CAGGAGGGAGGAGACCCGGGGGG - Intergenic
1185332851 22:50259388-50259410 GGAGAGGGAGGCGGCCTGGCAGG + Intronic
1185366359 22:50438725-50438747 GAAGAAGGAAGCGCCCCCTGTGG + Exonic
950419825 3:12892381-12892403 GAGGAGGGAGCCGCCCTGAGAGG - Intergenic
950642676 3:14358671-14358693 CCAGAGGGAGGCGCCCTGGCAGG + Intergenic
951624578 3:24645393-24645415 GGAGAGGGAGGAGACCCAGGTGG + Intergenic
952901895 3:38116381-38116403 GAGGAGGAGGGGGCCCCGGGGGG + Intronic
953246668 3:41199695-41199717 GAAGCGGGAGCAGCCCCGGAAGG - Intronic
954202567 3:49032797-49032819 GCAGAGGGAGGGGTGCCGGGAGG + Intronic
954339336 3:49940389-49940411 GATGAGGGAGGCGCCGCCCGTGG + Intronic
957822942 3:85401483-85401505 GAAGATGGAGGGGCCACAGGAGG + Intronic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
959571873 3:107893392-107893414 GAAGTGGCAGGCTCCCAGGGAGG + Intergenic
960588480 3:119343464-119343486 GAAAAGGGAGGAGCCAGGGGAGG + Intronic
960714179 3:120559536-120559558 AAAGAGGGAGGCGCGCCAGCTGG - Intergenic
961326350 3:126111668-126111690 GGTGAGGGAGGGGCCCCTGGAGG - Intronic
962316830 3:134364349-134364371 GAAGAGGGGGGCCGGCCGGGAGG - Intronic
962807973 3:138940106-138940128 GAGGTTGGAGGAGCCCCGGGCGG + Intergenic
966727570 3:183121014-183121036 GGAGAGGGAGGAACCCCTGGAGG - Intergenic
967361145 3:188633256-188633278 GACGTGGGAGGTGACCCGGGTGG - Intronic
969196606 4:5568400-5568422 GGACAGGGACGTGCCCCGGGAGG + Intronic
969305152 4:6322033-6322055 GCAGAGCGAGGAGCTCCGGGGGG + Exonic
970967935 4:21949033-21949055 GGAGAGGAAAGCGCCGCGGGTGG + Intergenic
975991911 4:80266662-80266684 GAAGAGAGAGGCCACCCGAGCGG - Exonic
982702433 4:158671746-158671768 GAAGAGGGAGGCGGCGGGGGCGG + Exonic
984593727 4:181644304-181644326 GAGGAGGGAGGCGGACAGGGAGG + Intergenic
985641081 5:1063774-1063796 GAGGTGGGGGGCGGCCCGGGAGG - Intronic
985950373 5:3218099-3218121 GGAGGGGGCGGCTCCCCGGGAGG + Intergenic
990128353 5:52548014-52548036 GAAGAGGGTGGCTCCCAGTGAGG + Intergenic
997398106 5:133580724-133580746 GAAGAGAGAGGCTCCCCTGGTGG - Intronic
997899712 5:137753808-137753830 GAAGCGGGCGGTGTCCCGGGAGG - Exonic
998566097 5:143217182-143217204 GAAAAGGGAGGGGCCCGTGGAGG + Intronic
999321831 5:150619923-150619945 GAAGAAGGAGGACCCCAGGGAGG + Intronic
1001441839 5:171749631-171749653 GAAGAGGGAGGAGCTGAGGGTGG - Intergenic
1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG + Intronic
1002101668 5:176860937-176860959 GGAGGGGCAGGCGCCCAGGGAGG + Intronic
1003536794 6:6982329-6982351 GCAGAGAGAGGCGAGCCGGGTGG + Intergenic
1004203967 6:13574560-13574582 TGGGAGGGAGGCACCCCGGGGGG + Intronic
1005824029 6:29621715-29621737 GAAGAGGGAGGGGCACTGGGTGG - Intronic
1005847563 6:29793109-29793131 CAAGTGGGAGGCGGCCCGGGGGG + Intergenic
1006052661 6:31356257-31356279 CAAGTGGGAGGCGGCCCGTGAGG - Exonic
1006152977 6:31999126-31999148 CAGGAGGGAGGCGCCCAAGGTGG + Exonic
1006159285 6:32031863-32031885 CAGGAGGGAGGCGCCCAAGGTGG + Exonic
1006317326 6:33298504-33298526 GAAGAGGGTGGGGGCCCAGGTGG - Exonic
1006682212 6:35805371-35805393 GAAGAGGGAGACGGGCAGGGCGG + Exonic
1008092833 6:47309661-47309683 GAGGAGGGAGGCGGCAAGGGAGG + Exonic
1011643185 6:89433574-89433596 GAAGAGGGAGGCGCCCCGGGGGG - Intronic
1013273156 6:108560778-108560800 GAAGGGGGAGGGGCGCCCGGGGG - Intronic
1015076099 6:129159441-129159463 GGTGATGGAGGCGCCCCGGCCGG + Intronic
1017088485 6:150736986-150737008 GAAGAGGGAGGGACCCAGGCAGG + Intronic
1018949846 6:168372039-168372061 GAGGAGGGAGGAGCACTGGGGGG - Intergenic
1019294211 7:265461-265483 GAAGAGGGCGGCTGTCCGGGCGG - Intergenic
1019499467 7:1357840-1357862 GAAGAGGTTGGAGCCCAGGGAGG + Intergenic
1019640385 7:2100500-2100522 GACGAGGCAGACGCGCCGGGTGG - Intronic
1019812543 7:3175205-3175227 GAGGAGGCAGGGGCCCCGGGAGG - Intergenic
1020261240 7:6531742-6531764 GAAGAGGAAGGAGCCGTGGGAGG + Intronic
1021958556 7:25851357-25851379 GAAGTGGGAGGTAGCCCGGGAGG - Intergenic
1024554605 7:50592742-50592764 GCAGAGGGAGGCGACCCTGCTGG + Exonic
1030282326 7:107789846-107789868 GGAGAGAGAGGAGCCCTGGGTGG - Intronic
1035263716 7:157677019-157677041 GAAGAGGGCTGGGCCCCGGGAGG - Intronic
1041903993 8:63012071-63012093 GTAGAGTGATGCGCCCAGGGAGG - Intergenic
1044803855 8:95984472-95984494 GAGGTGGGAGGCTCCCCTGGAGG - Intergenic
1049218295 8:141417671-141417693 GAGGAAGGAGGGGTCCCGGGCGG + Intronic
1049447987 8:142640338-142640360 TAAGAGGGAGGAGCCCCAGCTGG - Intergenic
1049728992 8:144166371-144166393 GGAGCGGGAGGCTCCCTGGGTGG + Intronic
1049815169 8:144595851-144595873 GAAGATGGCGGCGCGGCGGGAGG - Intronic
1050356970 9:4792841-4792863 GAAGCGGGGGCCGCCCCGGTCGG + Intronic
1053009180 9:34623786-34623808 GAGGGGGGAGGGTCCCCGGGCGG - Intronic
1057099146 9:92341063-92341085 TAAGAGACAGGCGCCCCTGGGGG - Intronic
1059419364 9:114181409-114181431 GAAGAGGGAGGTGCCTTGGTTGG + Intronic
1061413634 9:130433879-130433901 ACAGAGGGAGGCGTCCAGGGCGG + Exonic
1061584054 9:131555001-131555023 GAAGGGGAAGGCGGCCCCGGCGG - Intergenic
1061802661 9:133120849-133120871 GAGGAGGGAGGCGGCCCGCTGGG + Intronic
1062016875 9:134295525-134295547 GAGGAGGGAGGTTCCTCGGGAGG + Intergenic
1062629887 9:137458885-137458907 GAAGAGGGAGGCGCGGGGCGCGG + Intronic
1062638735 9:137505933-137505955 GGAGAGGGTGGGGCCCCAGGCGG + Intronic
1186898622 X:14030082-14030104 GGAGAGGGAGCTGCACCGGGCGG + Intergenic
1190302979 X:49067250-49067272 GAAGAGGGAGGCGCGATCGGAGG - Exonic
1196782825 X:119398984-119399006 GAGGAGGGAAGCGCCAGGGGAGG + Intergenic
1197754110 X:129983030-129983052 GAAGAGGACGGCGCCCCCGGGGG - Intronic