ID: 1011643730

View in Genome Browser
Species Human (GRCh38)
Location 6:89437992-89438014
Sequence CAGTGTGAGCCTGGGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2632
Summary {0: 1, 1: 4, 2: 28, 3: 276, 4: 2323}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011643730_1011643739 20 Left 1011643730 6:89437992-89438014 CCTTGTTGCCCAGGCTCACACTG 0: 1
1: 4
2: 28
3: 276
4: 2323
Right 1011643739 6:89438035-89438057 GGGTAGGTAAGTGGCAAAAATGG No data
1011643730_1011643735 -1 Left 1011643730 6:89437992-89438014 CCTTGTTGCCCAGGCTCACACTG 0: 1
1: 4
2: 28
3: 276
4: 2323
Right 1011643735 6:89438014-89438036 GGTTTTAAACTCAGATGAATGGG No data
1011643730_1011643738 11 Left 1011643730 6:89437992-89438014 CCTTGTTGCCCAGGCTCACACTG 0: 1
1: 4
2: 28
3: 276
4: 2323
Right 1011643738 6:89438026-89438048 AGATGAATGGGGTAGGTAAGTGG 0: 1
1: 0
2: 3
3: 22
4: 237
1011643730_1011643736 0 Left 1011643730 6:89437992-89438014 CCTTGTTGCCCAGGCTCACACTG 0: 1
1: 4
2: 28
3: 276
4: 2323
Right 1011643736 6:89438015-89438037 GTTTTAAACTCAGATGAATGGGG 0: 1
1: 0
2: 1
3: 19
4: 218
1011643730_1011643734 -2 Left 1011643730 6:89437992-89438014 CCTTGTTGCCCAGGCTCACACTG 0: 1
1: 4
2: 28
3: 276
4: 2323
Right 1011643734 6:89438013-89438035 TGGTTTTAAACTCAGATGAATGG No data
1011643730_1011643737 4 Left 1011643730 6:89437992-89438014 CCTTGTTGCCCAGGCTCACACTG 0: 1
1: 4
2: 28
3: 276
4: 2323
Right 1011643737 6:89438019-89438041 TAAACTCAGATGAATGGGGTAGG 0: 1
1: 0
2: 2
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011643730 Original CRISPR CAGTGTGAGCCTGGGCAACA AGG (reversed) Intronic
Too many off-targets to display for this crispr