ID: 1011649186

View in Genome Browser
Species Human (GRCh38)
Location 6:89490283-89490305
Sequence TTTTATGGGTGCAACTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011649182_1011649186 0 Left 1011649182 6:89490260-89490282 CCATTACTGGGTCTTCAAATCAG 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1011649186 6:89490283-89490305 TTTTATGGGTGCAACTGACAGGG 0: 1
1: 0
2: 0
3: 15
4: 134
1011649181_1011649186 1 Left 1011649181 6:89490259-89490281 CCCATTACTGGGTCTTCAAATCA 0: 1
1: 0
2: 5
3: 38
4: 196
Right 1011649186 6:89490283-89490305 TTTTATGGGTGCAACTGACAGGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011649186 Original CRISPR TTTTATGGGTGCAACTGACA GGG Intronic
900700359 1:4044757-4044779 TAGTATGGGTACAACTGAAAGGG + Intergenic
905249170 1:36636934-36636956 TTTTTTGGTTGCAACAGAAATGG + Intergenic
909688521 1:78378263-78378285 TCTTATGTGTGCAAATCACATGG + Intronic
910328692 1:86042594-86042616 TTTTATGAATGCAATTGAAATGG - Intronic
910686552 1:89923183-89923205 TTTCATGTGTGCCATTGACAAGG + Intronic
911474432 1:98358432-98358454 TAGTATGGGTACAACTGAAAGGG + Intergenic
912218029 1:107638652-107638674 TTTTATTGGTGAAGTTGACAAGG + Intronic
913504718 1:119506319-119506341 TTTTTGGGGTGCTACTTACATGG + Intergenic
913515243 1:119599870-119599892 TTTTTTGGGTGCTACTTACATGG + Intergenic
917531218 1:175836836-175836858 TATTGTGGGTGCAACTGGCTGGG - Intergenic
919637868 1:200020976-200020998 TCATATGGGTGAAACTTACATGG - Intergenic
920048540 1:203149447-203149469 TTTTACCCGTGCAAATGACAGGG + Intronic
920865922 1:209753565-209753587 TTTTGTGTGTGCATCTGGCAGGG - Intergenic
922165721 1:223114209-223114231 TTTCATGGGTGCAGCAGAAATGG + Intronic
1066340888 10:34532179-34532201 TTTTATGGTTGTAAATGACAGGG + Intronic
1067227084 10:44383394-44383416 AGTTATGGGTGCAACTGACCTGG - Intronic
1071230744 10:83581813-83581835 TTTTATGGATGCAAAGTACAGGG - Intergenic
1073718229 10:106134055-106134077 TTTGATGGGAGAAAGTGACAGGG + Intergenic
1076730884 10:132438348-132438370 TCTCATGGGTGCACCTGGCAGGG - Intergenic
1078559199 11:12356185-12356207 TTTTTTGGATACATCTGACAGGG - Intronic
1078999997 11:16744488-16744510 GTTTATAGTTACAACTGACAGGG + Intronic
1079705925 11:23618021-23618043 TTTTATGGGTGCCATTGATATGG - Intergenic
1079734530 11:23979424-23979446 TTTTATGCGTCAATCTGACAAGG + Intergenic
1084990954 11:72925164-72925186 CTGTATGGGTGCAAGTGAGAGGG + Intronic
1090262801 11:125333657-125333679 TTGGATGGGTGCAACTGGCAAGG + Intronic
1092960503 12:13592555-13592577 TGTCATGGGTGCAACTGGCTAGG - Intronic
1094620840 12:32078872-32078894 TTTGCTGGGTGCAGCTGTCATGG + Intergenic
1095420035 12:42015877-42015899 TTTTATGGGTTATAATGACATGG - Intergenic
1095974117 12:47927636-47927658 TTTTTTGGGTGCCACTGGCAAGG - Intronic
1098006737 12:66005199-66005221 TTTTATGTGTCAAACTGACTGGG + Intergenic
1098916645 12:76263773-76263795 TTTTATGGGTCAAACTGACTAGG + Intergenic
1100297062 12:93273030-93273052 TTTTATGTGTGAGACAGACAGGG + Intergenic
1104430646 12:128713344-128713366 TTATAAGGCTGCAACTCACATGG - Intergenic
1106551472 13:30775049-30775071 TTTTATGTGTCAACCTGACAAGG - Intergenic
1107277036 13:38689090-38689112 TTCCCTGAGTGCAACTGACATGG + Exonic
1108905771 13:55470176-55470198 TTTTATAGGTTCAATTGAAATGG + Intergenic
1110972424 13:81781868-81781890 TTTTAGGAGTTCAGCTGACACGG - Intergenic
1111836429 13:93394203-93394225 TTTTATGCTTGTAACTGTCATGG + Intronic
1114051236 14:18920934-18920956 TTATATGCCTGCAACTGGCACGG + Intergenic
1114111326 14:19480991-19481013 TTATATGCCTGCAACTGGCACGG - Intergenic
1116344952 14:43781613-43781635 TTTTATGAGTGCTAGTGACAAGG - Intergenic
1118286532 14:64479443-64479465 TTTTATGTGTCCAAATGACTGGG + Exonic
1118969124 14:70617684-70617706 TTTTAAGGAGGCAAGTGACAAGG + Intergenic
1119102404 14:71892188-71892210 TTTTTTGGAAGCAACTGTCATGG + Intergenic
1121016370 14:90551823-90551845 TTTTGTGGGTGCAGCTGAGGGGG + Intronic
1121956817 14:98221150-98221172 TTTAATTGCTGCCACTGACAGGG - Intergenic
1123738260 15:23207465-23207487 TTTTATGTGTTCAACAGAGAGGG + Intergenic
1124289468 15:28436129-28436151 TTTTATGTGTTCAACAGAGAGGG + Intergenic
1124293754 15:28481179-28481201 TTTTATGTGTTCAACAGAGAGGG - Intergenic
1125287528 15:38110042-38110064 TTTTATGGGTTCATCTGATCAGG - Intergenic
1133985145 16:10662702-10662724 TGTCATGGGTGCAACTGGCTGGG - Intronic
1137412183 16:48238277-48238299 TTATATGTGTGCAACAGATAAGG - Intronic
1141728546 16:85807085-85807107 TATTTTGGGTGCAAATGAAATGG + Intergenic
1143341932 17:6218393-6218415 TTTGGTAGGTGCAACTGACCAGG - Intergenic
1149480709 17:57001027-57001049 TTTTATGGGTTCAACTGGAAGGG + Intronic
1158061650 18:53349884-53349906 TTCTATTTTTGCAACTGACATGG - Intronic
1158129043 18:54132527-54132549 TTCTGTGGGTGCAAATAACATGG + Intergenic
1158927136 18:62278697-62278719 TTTTATGAGTTCAACCGAGAAGG - Intronic
1159053770 18:63445381-63445403 TTTTATGGGAGCAGCAGAGAGGG + Intergenic
1160655105 19:262388-262410 TTTTATGGGTGCATTTGTGAAGG - Intergenic
1163887497 19:19979679-19979701 TTTTATGGTGGCAACTAAAATGG + Intergenic
1163967264 19:20758346-20758368 TTTTATTGTGGCAACTGAAATGG - Intronic
1165315952 19:35055583-35055605 TTCTGTAGGTGCAGCTGACAGGG - Intronic
928316143 2:30248213-30248235 TTTTATGGGAGCTACTATCAAGG + Intronic
933326098 2:80839427-80839449 TTACATGGCTGCAACTAACATGG + Intergenic
933496071 2:83052236-83052258 TTTTATACATGCATCTGACAGGG - Intergenic
935345982 2:102108801-102108823 CTTTATAGGTGCAAGTGTCATGG + Intronic
938873446 2:135507036-135507058 TTTTCAGGTTGCAACAGACAAGG + Intronic
941035414 2:160563079-160563101 ATTTTTGGGTGCTATTGACAGGG + Intergenic
941231360 2:162915853-162915875 TGTCATGGGTGCAACTGGCTGGG - Intergenic
943463028 2:188193338-188193360 TTTGGTGGGTGGAACTGAAAGGG + Intergenic
944108139 2:196101694-196101716 TCTTATTGGTGCAACTCAAAAGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
948274328 2:236696583-236696605 AGATATGGGAGCAACTGACATGG - Intergenic
948355398 2:237373508-237373530 TTATTTGGGTGCAACTGAGAGGG - Intronic
1169964279 20:11197516-11197538 TGTCATGGCTGCAACTTACAGGG - Intergenic
1175085475 20:56454985-56455007 TGTTGTGGGTGGTACTGACAGGG + Intronic
1177420093 21:20845149-20845171 TTTCATCTGTGCAACAGACATGG + Intergenic
1180469711 22:15643309-15643331 TTATATGCCTGCAACTGGCACGG + Intergenic
949090729 3:25780-25802 TTTTAAGTGTGCAACTGCCATGG - Intergenic
951056089 3:18148018-18148040 TTTTCTGGCTGCAACTAAAAGGG - Intronic
952904179 3:38128904-38128926 TTTTCTTGTTGCACCTGACAGGG + Intronic
954820372 3:53321268-53321290 TTTTATAGTTGCAAGTGGCAGGG + Intronic
955252683 3:57300244-57300266 TGTCTTGGGTGCAACTGACTGGG - Intronic
955595413 3:60584657-60584679 TTTTATGTGTTCATCTAACATGG + Intronic
957031053 3:75241992-75242014 TTTTAAGTGTGCAACTGTCATGG - Intergenic
957131249 3:76224631-76224653 TTTTATGGGTCAACTTGACAGGG - Intronic
957246155 3:77719472-77719494 TTATATGTATGCAACTGATATGG + Intergenic
957503988 3:81096190-81096212 TTTTTTGGGTTCTACTGACCCGG + Intergenic
963307449 3:143668886-143668908 TTGTCTGGGTGCTACAGACAAGG - Intronic
966089159 3:176109300-176109322 TCTGATGCTTGCAACTGACAAGG + Intergenic
966300984 3:178479863-178479885 GTTTTTGGCTGTAACTGACATGG - Intronic
967816912 3:193807308-193807330 TTTTACAGGTGCAACTGAAAAGG - Intergenic
968201538 3:196760120-196760142 TTGTATGGGTGAAAGAGACAGGG + Intronic
970341970 4:15116804-15116826 TTTTATGTGTCAACCTGACAAGG - Intergenic
973189811 4:47374068-47374090 TTTTCTGGGTGCAATTCTCAAGG - Intronic
980641115 4:135581518-135581540 ATTTATAAGAGCAACTGACAAGG + Intergenic
981904856 4:149911031-149911053 TATTATGTGTGTATCTGACATGG + Intergenic
982976746 4:162072707-162072729 TTTTATGTGTCTAACTGACTGGG + Intronic
985111592 4:186552555-186552577 TTTTCTGGGTACACCTAACAAGG - Intronic
987606417 5:20141689-20141711 TTTATTGGGTGCAAATTACATGG + Intronic
987944611 5:24588267-24588289 TTATATGGTTGCAATGGACATGG + Intronic
988353829 5:30146671-30146693 TTTTTTGGTTTCCACTGACATGG + Intergenic
989212950 5:38875066-38875088 TTTGAGGGGTTCAAATGACAAGG + Intronic
990282019 5:54261246-54261268 GTTAATGGGTGCAGCTGGCAAGG - Intronic
993318441 5:86441056-86441078 TTTTAAGGGCCCAACTGACTAGG + Intergenic
994584691 5:101691515-101691537 TTTTATGAGAGCAACCAACATGG - Intergenic
994988637 5:106969715-106969737 TTTCATTGGTTCAACTCACAGGG + Intergenic
996604024 5:125299488-125299510 TTTTATTGATGCAACTGCCTGGG - Intergenic
997178983 5:131808498-131808520 TTTTATTGGTATAATTGACAGGG - Intronic
997636540 5:135411193-135411215 TTTTTTGGGTGTAACTGGAAGGG + Intergenic
998580917 5:143374648-143374670 TTTTATGAGCCCAAATGACAAGG + Intronic
998925173 5:147115141-147115163 TTTTCTGGGTGTATCTGTCAGGG - Intergenic
1005790764 6:29297404-29297426 TTTTCTGGCTTCTACTGACATGG - Intergenic
1006000757 6:30963252-30963274 TTGTCTGGGTGGAAGTGACAAGG - Intergenic
1006126122 6:31839492-31839514 TTTTATTGGTGCATCTCATATGG + Intronic
1009494662 6:64332196-64332218 TAGTAGGGGTGCACCTGACATGG - Intronic
1010566991 6:77428306-77428328 TTTTATGGGTTCATTTGACTGGG + Intergenic
1011649186 6:89490283-89490305 TTTTATGGGTGCAACTGACAGGG + Intronic
1013888732 6:115000990-115001012 TGTTATCAGTGCAACTTACAGGG + Intergenic
1018637729 6:165879079-165879101 ATTTGGGGGTGCAACTGACCTGG + Intronic
1020696889 7:11423657-11423679 TTTCCTGGGTGCCACTGAGAAGG + Intronic
1023026658 7:36056741-36056763 TTTCATGGCTGCCACTGGCAGGG + Intergenic
1023595890 7:41829084-41829106 TCTTATCAGTGCAACTGATAAGG - Intergenic
1024828862 7:53424747-53424769 TTTTATAGGAACTACTGACAAGG + Intergenic
1028608980 7:92687257-92687279 TTTTATGGGGGTAACAGAGATGG - Intronic
1031226278 7:119041903-119041925 TTTACTGGGTGCAACTCATATGG - Intergenic
1032372410 7:131370665-131370687 TTAGATGGCTTCAACTGACAGGG + Intronic
1032812011 7:135429547-135429569 TTTGATGAGGGGAACTGACAGGG - Intronic
1035863305 8:3053804-3053826 TTTTATGAGTGCAGCTGAAGTGG - Intronic
1037184382 8:16044394-16044416 ATTTATGTGTGCAAGTGACGTGG + Intergenic
1041005398 8:53492885-53492907 GTTTATAGGTGCTACAGACATGG + Intergenic
1043307433 8:78813812-78813834 TTTTCTGTTTGCAAATGACACGG - Intergenic
1047368749 8:124237343-124237365 TTTTATGGGTGTTACTTGCATGG - Intergenic
1048108558 8:131440795-131440817 TTGTGTGAGTGCAGCTGACATGG + Intergenic
1048763391 8:137821645-137821667 TTTTATGTGTCAAACTGACTGGG + Intergenic
1049625181 8:143616709-143616731 CATTACAGGTGCAACTGACATGG - Exonic
1050021240 9:1286606-1286628 TTTTATGGGGGGAAATGAAAGGG + Intergenic
1051532584 9:18121309-18121331 TTTTGTCGGTGTAACTGTCATGG - Intergenic
1051904129 9:22075726-22075748 ATTTATGGGTGCAACAGCAAAGG + Intergenic
1055253591 9:74338468-74338490 TTTTTTGTTGGCAACTGACATGG - Intergenic
1061296855 9:129681598-129681620 TTTTCTGGGTGCCCCAGACACGG - Intronic
1185963971 X:4578574-4578596 TTTTATGGGTGCAGCAGCCAAGG + Intergenic
1187993345 X:24899393-24899415 TTTCATGGGTGCAATTGGCCAGG + Intronic
1189145889 X:38654518-38654540 TTATCTGAGTGCAACTGCCAGGG + Intronic
1192874287 X:75211531-75211553 TTTTCTGGGTGGCTCTGACAAGG - Intergenic
1193660627 X:84253150-84253172 TTTTATGAGTACAACTGATAAGG + Intergenic
1197873240 X:131079896-131079918 TCTCATGGATGGAACTGACAGGG - Intronic
1199054767 X:143280703-143280725 TTTTATGTGTCGAAGTGACAGGG + Intergenic
1201887977 Y:18907411-18907433 TTTTATGGGTGCTTCAGCCAAGG + Intergenic