ID: 1011649192

View in Genome Browser
Species Human (GRCh38)
Location 6:89490339-89490361
Sequence TGTACTACACAACACCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011649192 Original CRISPR TGTACTACACAACACCTGGT GGG (reversed) Intronic
909450290 1:75790816-75790838 TGTGCACCACAACACCTGGCTGG + Intronic
918280444 1:182999070-182999092 AGAAATACACAACACTTGGTGGG - Intergenic
918837435 1:189485528-189485550 TGTAATATAAAACACGTGGTTGG - Intergenic
1068627056 10:59260769-59260791 TCTACTTCACAACACATAGTTGG + Intronic
1070127631 10:73634859-73634881 TGTACTACCCATCAACTGGAGGG - Intronic
1074308644 10:112302005-112302027 TCTACAACACAAAACCTGGCTGG - Intronic
1074797538 10:116963944-116963966 TGTAGTACACATCACATTGTAGG + Intronic
1077427494 11:2490255-2490277 TGTAGTATACCACACCAGGTAGG + Intronic
1081822027 11:46008037-46008059 TGTTCTACCCACCAACTGGTAGG + Intronic
1088055865 11:105576400-105576422 CTTACTACAAAACACCTGGTAGG - Intergenic
1089048001 11:115520505-115520527 TGTGCAGCACAATACCTGGTGGG + Intergenic
1093430533 12:19080294-19080316 TGTGCTCCACCACACCTGGCTGG - Intergenic
1101521825 12:105490819-105490841 TGTTCTTCACAACACCTCCTAGG + Intergenic
1105393481 13:20005127-20005149 TGTACTACAGAATTCCTGGAAGG - Exonic
1111118283 13:83811178-83811200 TGAACTCCACAACACATGGTAGG - Intergenic
1118168539 14:63361824-63361846 TGTACTCAGCAACACCTGGGAGG - Intergenic
1119956680 14:78805781-78805803 TTTACTAAACAACACCTAATGGG - Intronic
1125023364 15:35006556-35006578 TATAGTACACAACACCTAGCAGG - Intergenic
1144523644 17:15971390-15971412 TATACTACAGAAGACCTGCTGGG - Intronic
1146065404 17:29631136-29631158 TGTTCTACAAAAGACTTGGTGGG + Exonic
1151594606 17:75069760-75069782 TGTAATACACAACACCTAGTTGG + Intergenic
1152731822 17:81976332-81976354 TGAGCCACACATCACCTGGTGGG - Intergenic
1153450681 18:5224783-5224805 TGTACTACTCAACACCTAATAGG + Intergenic
1156793730 18:41013710-41013732 TTTTCTACAAAACACCTGGCTGG - Intergenic
1165090205 19:33383102-33383124 TGTACTACAAAACTCCAGATGGG - Intergenic
1167078971 19:47266383-47266405 TTTTCTCCACAACACTTGGTAGG - Intronic
1168347351 19:55656936-55656958 TCTGCCACACAACACCTGGATGG + Intronic
926634515 2:15165637-15165659 TGCCCTACACACAACCTGGTTGG - Intergenic
930661388 2:54057903-54057925 TTTACTACACCACATCTGTTTGG - Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
1170027751 20:11908904-11908926 TGTACTTCACAACAGTTGATGGG + Intronic
1174035248 20:47664768-47664790 TGCACTACACCACACGTGGCTGG - Intronic
1175359381 20:58396287-58396309 TGCCCTACACAACACGAGGTGGG - Intronic
1175365484 20:58452003-58452025 TGTATTAGAAAACACATGGTTGG - Intergenic
1182652508 22:31863543-31863565 TTTTCAACAAAACACCTGGTGGG - Intronic
961369529 3:126420944-126420966 TGTACCACACCACACCGGGCTGG - Intronic
968128691 3:196179083-196179105 TGTTTTGCAAAACACCTGGTCGG + Intergenic
969071151 4:4540588-4540610 TGCCCTACACAACACCTGCAAGG + Intronic
972962543 4:44471879-44471901 TATTCTACAAAACAACTGGTGGG + Intergenic
974307944 4:60165502-60165524 TTTACTACAAAACCCCTAGTGGG - Intergenic
974854519 4:67443648-67443670 TCTAATAGACAACACATGGTTGG - Intergenic
979595774 4:122532514-122532536 TCTAAGACACAACACCTGGTGGG - Intergenic
980727306 4:136780259-136780281 TGTAATAGACAACATATGGTTGG + Intergenic
983891262 4:173032719-173032741 AGGACTACACAAGACCTTGTAGG + Intronic
984519812 4:180788162-180788184 TGTCCTACACCAAACCTGGAAGG - Intergenic
989243511 5:39227226-39227248 TGTAATACATAACTCTTGGTTGG + Intronic
992649006 5:78838888-78838910 GGTACTGCCCAACACCTGCTGGG - Intronic
1004054854 6:12125202-12125224 TGTACTACAGAGCCCCTGGACGG + Exonic
1007220452 6:40274873-40274895 TACACTACACAACTCCAGGTAGG - Intergenic
1008097846 6:47358211-47358233 TGTACTACTCAATAACTAGTAGG - Intergenic
1010581022 6:77596107-77596129 TGTAGTACACACCACCTCATGGG + Intergenic
1011649192 6:89490339-89490361 TGTACTACACAACACCTGGTGGG - Intronic
1016132026 6:140485784-140485806 TGTTATATACAAAACCTGGTCGG - Intergenic
1021360410 7:19706131-19706153 TTTACTAAACAACATCTGTTAGG - Intronic
1028235482 7:88356228-88356250 TGTTCTACTCAACACCTGGATGG + Intergenic
1029098967 7:98112414-98112436 TGTACTAGACAACACAGGTTTGG - Intronic
1035403144 7:158581223-158581245 TGTACCACAGGACACCTGGTGGG - Intronic
1038108990 8:24473275-24473297 TCAACTACTCAAAACCTGGTGGG + Intronic
1038706909 8:29902866-29902888 GGTTGTACCCAACACCTGGTGGG - Intergenic
1043698313 8:83250866-83250888 TGTACTACAAAACGCTTTGTTGG - Intergenic
1045054486 8:98357588-98357610 TGTAACACACAACATCTGGAGGG + Intergenic
1052159760 9:25242804-25242826 TGTACCACACAAAAGCTGGGAGG + Intergenic
1056221082 9:84451294-84451316 TGAACTGCAGGACACCTGGTTGG + Intergenic
1056233112 9:84566951-84566973 ACTACTACACACCCCCTGGTTGG - Intergenic
1059860146 9:118451037-118451059 TCTAATGCACAACATCTGGTTGG - Intergenic
1185724741 X:2410457-2410479 TGTACTACAGAACACCTCACTGG - Intronic
1196138546 X:112235540-112235562 TTGACTACACAGCATCTGGTGGG + Intergenic
1202330352 Y:23744947-23744969 TCTCATACACAACACATGGTTGG - Intergenic
1202540417 Y:25925114-25925136 TCTCATACACAACACATGGTTGG + Intergenic