ID: 1011649292

View in Genome Browser
Species Human (GRCh38)
Location 6:89491112-89491134
Sequence CGGCGGAGCTGTGTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011649292_1011649299 18 Left 1011649292 6:89491112-89491134 CCAGAGGGAACACAGCTCCGCCG No data
Right 1011649299 6:89491153-89491175 CCTGGCCTCCAAAACTGTGAGGG No data
1011649292_1011649293 -8 Left 1011649292 6:89491112-89491134 CCAGAGGGAACACAGCTCCGCCG No data
Right 1011649293 6:89491127-89491149 CTCCGCCGACAACTTCATTTTGG 0: 1
1: 0
2: 1
3: 10
4: 172
1011649292_1011649297 17 Left 1011649292 6:89491112-89491134 CCAGAGGGAACACAGCTCCGCCG No data
Right 1011649297 6:89491152-89491174 TCCTGGCCTCCAAAACTGTGAGG No data
1011649292_1011649296 0 Left 1011649292 6:89491112-89491134 CCAGAGGGAACACAGCTCCGCCG No data
Right 1011649296 6:89491135-89491157 ACAACTTCATTTTGGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011649292 Original CRISPR CGGCGGAGCTGTGTTCCCTC TGG (reversed) Intronic