ID: 1011650497

View in Genome Browser
Species Human (GRCh38)
Location 6:89502030-89502052
Sequence GTTAACAATAAGAATATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011650497_1011650501 26 Left 1011650497 6:89502030-89502052 CCTCCCATATTCTTATTGTTAAC 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1011650501 6:89502079-89502101 TTTTTATTCAGTTTCTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011650497 Original CRISPR GTTAACAATAAGAATATGGG AGG (reversed) Intronic
900804627 1:4759376-4759398 GTTCAAAATAAAAATATTGGAGG + Intronic
901899804 1:12350706-12350728 GGAAACAATAAAAATATGGATGG + Intronic
904985173 1:34540186-34540208 GTTACCAAAAAAAAAATGGGAGG + Intergenic
907218849 1:52890148-52890170 TTTAAGAGTAAGAATAGGGGTGG - Intronic
908766985 1:67563200-67563222 GTTAACAATAAGAGAAATGGCGG + Intergenic
909551781 1:76906080-76906102 GTTAAGAAAAAGAAAAAGGGAGG - Intronic
912229257 1:107773614-107773636 GTGAACACTGAGAATAAGGGAGG + Intronic
917308037 1:173647568-173647590 GTAAACAAGAAGAATATGGAAGG + Intronic
918548992 1:185718255-185718277 ACTAACAATAAGTATATGGATGG - Intergenic
918701245 1:187611045-187611067 ATTAACATCAAGAATATAGGAGG + Intergenic
922158286 1:223057658-223057680 TTTAAAAATAAAATTATGGGAGG - Intergenic
924047664 1:240048847-240048869 GTTAACTATAACAAGATTGGTGG + Intronic
1065684808 10:28273768-28273790 GATAAGAATAAAAATCTGGGAGG - Intronic
1068164415 10:53309847-53309869 TATAATAATAAGAATAGGGGAGG - Intergenic
1068246741 10:54381560-54381582 GTTAAAAATAAAAAGATGGGAGG + Intronic
1068607321 10:59020328-59020350 ACTAAAAATAAGATTATGGGTGG + Intergenic
1072402095 10:95113976-95113998 ATTAACAATGAGAATATGCAAGG - Intergenic
1073674406 10:105629199-105629221 GTAAACAACAAGACTGTGGGTGG - Intergenic
1073831802 10:107393190-107393212 TTTTTCAATAATAATATGGGTGG - Intergenic
1073898483 10:108190760-108190782 GTGAACAAAAAGAATAAAGGTGG + Intergenic
1074972803 10:118553856-118553878 ATTATCAATAAGAATAAGAGGGG - Intergenic
1078507191 11:11961052-11961074 TTTATCAATAATAATATCGGTGG + Intergenic
1078770155 11:14342136-14342158 GTTAACAATTTGAATCTGGGAGG - Intronic
1080134228 11:28835492-28835514 CTTAGCAAAAAGAATCTGGGTGG + Intergenic
1080150300 11:29044888-29044910 GTTAACAAAAAGAATAGGAAAGG + Intergenic
1080304015 11:30817399-30817421 GTTAAAAAAAAAATTATGGGAGG + Intergenic
1082065367 11:47894224-47894246 GTTAAGAATAAGAAAAGCGGCGG - Intergenic
1083085156 11:60135054-60135076 ATTAATAATAATAATATGTGGGG - Intergenic
1085089038 11:73693914-73693936 GTTAAAAATAAGGATGGGGGAGG - Intronic
1085448395 11:76616146-76616168 GTGAACAATAAGATTCTTGGAGG - Intergenic
1087247631 11:95858188-95858210 GTTAACACTAGCAATTTGGGAGG - Intronic
1087251895 11:95910753-95910775 GTTCACAATCAGAATATAGAAGG - Intronic
1089445866 11:118551691-118551713 GTTACCAATAATAATAATGGAGG + Intronic
1089746646 11:120622195-120622217 GTTAAAAATAATAATAAGGCCGG - Intronic
1089769431 11:120792725-120792747 GTTAACAGGAAGAATCTAGGAGG + Intronic
1092895670 12:13007941-13007963 GATATGAATAAGAACATGGGTGG + Intergenic
1094124647 12:27011094-27011116 GATAACAATGAGAAATTGGGAGG - Intronic
1095274534 12:40265205-40265227 GTTGAAAATAAGTATATGGAAGG + Intronic
1097672698 12:62559005-62559027 TTTAATAAAAAGAATATGGAGGG + Intronic
1098419125 12:70272806-70272828 GGTGAGCATAAGAATATGGGAGG - Intronic
1102293054 12:111716556-111716578 TTTAATAATAAGAATTTGGAAGG + Intronic
1103589483 12:121981104-121981126 ATTAAAAATAAGAAAATGAGGGG - Intronic
1106206768 13:27604421-27604443 GTAAAGAATAAGAATAAGGAGGG + Intronic
1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG + Intergenic
1108916301 13:55616905-55616927 TTTAACAATAAAAATATAGCAGG - Intergenic
1109603448 13:64662567-64662589 ATCAAAAATAAGAATATGGCTGG - Intergenic
1110900730 13:80820586-80820608 TTTAAAAATAAGAAGATGGTTGG + Intergenic
1111019046 13:82422038-82422060 ATTAATATTTAGAATATGGGAGG + Intergenic
1111433707 13:88179010-88179032 GTTAACAGTAGGATTATAGGAGG - Intergenic
1112991309 13:105516956-105516978 GTTAACACGAAGAAAATGGCAGG + Intergenic
1115668168 14:35577275-35577297 TTTCACAATATGAATTTGGGGGG - Intronic
1115687467 14:35811233-35811255 GTTAAAAATAATTATATGGCTGG + Intergenic
1116190846 14:41663545-41663567 GAAAAAAATAAGAATAAGGGAGG + Intronic
1116233761 14:42251983-42252005 TTTAACTATAAAAATATGAGTGG + Intergenic
1116728751 14:48595677-48595699 GTTAACAATATGATTTTTGGTGG - Intergenic
1118263668 14:64272278-64272300 ATTAACAATCAGAATATAGAAGG - Intronic
1118383120 14:65234144-65234166 ATTAACAATCAGAATATAGAAGG - Intergenic
1120400518 14:84025132-84025154 CTTAATAATCAGAACATGGGAGG - Intergenic
1120728645 14:87977016-87977038 TTTAACCATAGAAATATGGGGGG + Intronic
1125339392 15:38659899-38659921 ATTAACAATAAGAAAATGGCAGG - Intergenic
1125701112 15:41684967-41684989 GTTAACACTTAAAATGTGGGTGG + Intronic
1126628303 15:50707501-50707523 GTTAAAAAAAAGTATAGGGGTGG + Exonic
1126698412 15:51345134-51345156 GAGAACAAAAAGAATATGAGAGG - Intronic
1127567369 15:60204934-60204956 GTTAACAAAGAGAAGAGGGGTGG - Intergenic
1127669153 15:61178057-61178079 GCTAAGAATAAGAAAATGGAAGG - Intronic
1128122440 15:65162622-65162644 GTTAGAAATAAGAAGACGGGAGG - Exonic
1129806809 15:78468148-78468170 CTTAAAAATAAAAATATGGCTGG - Intronic
1131650886 15:94398302-94398324 GTTAAAAATAACATTTTGGGGGG + Intronic
1133948149 16:10366597-10366619 TTTAACAAATAGAATATGGCAGG - Intronic
1138760764 16:59540972-59540994 GATATCACTAAAAATATGGGCGG - Intergenic
1142843393 17:2652012-2652034 GTTAACAGTAAAAATATGAGGGG - Intronic
1143149351 17:4797896-4797918 GTTAATAGTAAGAATAAGTGAGG - Intronic
1146992057 17:37283391-37283413 GTTAGCAATAAGAACCTGGGAGG + Exonic
1150096585 17:62381559-62381581 GTTAACAGTAGGAATGGGGGTGG - Intronic
1153229897 18:2925526-2925548 GTTAACAATATGAATATTTCAGG - Intronic
1153725991 18:7955625-7955647 ATTAACAATAGGAAAAAGGGTGG - Intronic
1155918753 18:31581623-31581645 GTCAACAATAGTAATCTGGGTGG - Intergenic
1156375178 18:36508079-36508101 GTTTACAATAATCATATTGGTGG + Intronic
1157658810 18:49420516-49420538 GTTAAAAATTAAAATTTGGGGGG + Intronic
1158094246 18:53752972-53752994 GTTTATAACAAGAATATGAGAGG - Intergenic
1158309467 18:56143227-56143249 TTTAAAAATATGACTATGGGTGG + Intergenic
1158654816 18:59321222-59321244 GTGATCAATAAGAATCTTGGGGG + Intergenic
1158656842 18:59344888-59344910 GATAACAATAAGAATAGTGATGG + Intronic
1159169530 18:64747341-64747363 GTTAACAATGAAAATATATGAGG + Intergenic
1160253803 18:77229521-77229543 TTGACCAATAATAATATGGGTGG - Intergenic
1160331130 18:77992550-77992572 CCTAGCAATAAGAATATTGGTGG - Intergenic
1161343158 19:3753656-3753678 TTTAAAAATAAGCTTATGGGAGG + Intronic
1164199039 19:23001778-23001800 GTTGATAATATGAATAAGGGAGG + Intronic
1165564856 19:36715950-36715972 GTGAGAAATCAGAATATGGGAGG - Intronic
1167691669 19:50988458-50988480 GGTAACTAGAAGAAAATGGGAGG + Intergenic
927079671 2:19615092-19615114 TTTAACAATCAGATTATCGGGGG + Intergenic
929343384 2:40850391-40850413 GGGAACCATTAGAATATGGGAGG + Intergenic
931700756 2:64907134-64907156 TTTAAAAATAAGAATATAGCTGG - Intergenic
938915513 2:135935083-135935105 GTTAAAAATAACAAGATGGCCGG - Intronic
939895696 2:147788517-147788539 GTAATCTATAAGCATATGGGAGG - Intergenic
941087883 2:161139275-161139297 GTTAACATTAAGAATGAGGTTGG + Intronic
941649333 2:168076716-168076738 GTTAAAAAGAAAAATTTGGGGGG - Intronic
945052384 2:205836377-205836399 GCTAACAAAAAGAATAGGGGAGG + Intergenic
945539334 2:211064896-211064918 GAGAACAAAAAGAATATGGCAGG - Intergenic
1168758511 20:332509-332531 GTGGACAATAAGACTATGAGTGG - Intergenic
1169369641 20:5018833-5018855 GTTAAAAAAAAAAGTATGGGTGG + Intergenic
1173047467 20:39526209-39526231 GTTGACAATAAAAAGAGGGGAGG + Intergenic
1173071932 20:39776529-39776551 TTTAACAAAAAGGATATGGTGGG + Intergenic
1178375478 21:32064109-32064131 CAAAACAATAAGAAAATGGGGGG - Intergenic
1178564885 21:33674514-33674536 ATTAAAAATAATAATATGGAGGG + Intronic
1179930277 21:44566404-44566426 GTTAACAATATTAACATGAGTGG - Intronic
1183824905 22:40378430-40378452 ATTAAAAATAATAATATGGCCGG + Intronic
949191214 3:1251269-1251291 GTTGAAAATCAGATTATGGGTGG - Intronic
949806935 3:7965690-7965712 ATTAATAATAATAATATGGTAGG - Intergenic
951795696 3:26535832-26535854 ATTAAAAATTATAATATGGGAGG + Intergenic
951814494 3:26738723-26738745 GTTAACAAAAATAATCTGTGGGG - Intergenic
958605360 3:96351261-96351283 GTTCACAATAATTACATGGGGGG - Intergenic
961237165 3:125376691-125376713 ATTAACATTCAGAATATGTGCGG - Intergenic
962999276 3:140662318-140662340 CTTACCAATAAGAACATTGGCGG + Intergenic
964807657 3:160629312-160629334 GTTATCTATAACAATATTGGAGG - Intergenic
968246901 3:197159921-197159943 GATAACACTAAAAATATGGGCGG + Intronic
970246319 4:14067916-14067938 GTTAACAATAATAGCCTGGGAGG + Intergenic
971493975 4:27244517-27244539 CTTAACAACAACAAAATGGGGGG + Intergenic
972247094 4:37256724-37256746 AGTAACAATAAGAATATGTAGGG + Intronic
974578700 4:63765862-63765884 TTTAAAAATATGAACATGGGAGG + Intergenic
975827677 4:78336938-78336960 GTAAGCAATAAGGATAAGGGTGG - Intronic
978091666 4:104725154-104725176 GTTAAGAAAAAGAAAATGTGAGG + Intergenic
979091298 4:116486330-116486352 ATTAACAACAAATATATGGGAGG - Intergenic
980222777 4:129941517-129941539 GTTAACAATAATGATTTGGGTGG - Intergenic
980342824 4:131572557-131572579 CTTTACATTAAGAAAATGGGTGG + Intergenic
983369073 4:166836081-166836103 GTTAACAATATGAATCTTAGCGG + Intronic
984071585 4:175120669-175120691 GTCAACAGTAAGCATATGGGTGG - Intergenic
985189018 4:187351387-187351409 GTTAACTATAAAAATAATGGTGG - Intergenic
987291676 5:16514238-16514260 GTTAAAAATAAGAATGTGGGAGG - Intronic
988071653 5:26297268-26297290 GTTAAAAAAAAGAAGATGGAAGG - Intergenic
988303107 5:29459183-29459205 GTAAAAAATAAAAATATGGCCGG - Intergenic
988638818 5:33018177-33018199 GTTCAAAAGAAGAATATGGAAGG + Intergenic
988982148 5:36582156-36582178 GTTAACAATACAAATATGATTGG + Intergenic
989329036 5:40234141-40234163 GTTAAAAATACAAAGATGGGAGG - Intergenic
989544387 5:42655922-42655944 ATCAACAATAAGAAAATGGCTGG - Intronic
991083122 5:62622395-62622417 ACTAACAATAAGAATAAAGGAGG - Intronic
993048993 5:82903504-82903526 TTAAACAATAAAAATTTGGGTGG - Intergenic
994311394 5:98275611-98275633 TTTAAAAATAATAAAATGGGAGG + Intergenic
994946316 5:106396963-106396985 GATAATGAAAAGAATATGGGGGG - Intergenic
994979003 5:106848172-106848194 GTAAAAAATAAGAATAAGGCCGG - Intergenic
995548789 5:113259069-113259091 GTAAATTATAAAAATATGGGTGG - Intronic
996714692 5:126577864-126577886 GGTAACATAAAGAATATGTGAGG - Intronic
996970838 5:129366112-129366134 GTTAATAATCAGAATATATGAGG + Intergenic
997054406 5:130424124-130424146 GTAAACAAAAAGAACATTGGTGG + Intergenic
997184461 5:131867559-131867581 GTTGACAATAAAAAGATTGGTGG - Intronic
997768408 5:136528071-136528093 TTTAACCAAAAGAATATGGCAGG - Intergenic
998200916 5:140119525-140119547 GTTGATAATGAGAATCTGGGTGG + Exonic
999672489 5:153969861-153969883 GGTCACAATCAGAAAATGGGAGG + Intergenic
1000894951 5:166844479-166844501 TTTAAAAATATGGATATGGGAGG - Intergenic
1002331806 5:178448004-178448026 GGTAACAATATGAATTTTGGGGG - Intronic
1002961421 6:1918448-1918470 TTTAAAAATAAGAATAAGGCCGG + Intronic
1003084504 6:3050925-3050947 TATAACAATAAAAATATTGGGGG + Intergenic
1003786409 6:9491548-9491570 GTGAACTAAAAGGATATGGGTGG + Intergenic
1005687430 6:28268273-28268295 ATTAACAAGAAGAAAATTGGAGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1008747844 6:54694349-54694371 GTTAACATCAACAATGTGGGTGG - Intergenic
1008808011 6:55455167-55455189 ATTAACAATAAGAATGTGAATGG - Intronic
1008897951 6:56579556-56579578 GTTAACAGGAAAAAAATGGGAGG + Intronic
1010817153 6:80371783-80371805 GTTAACTGTAAGTATTTGGGTGG + Intergenic
1011563782 6:88651749-88651771 GTTTAAAATAAAAATTTGGGGGG - Intronic
1011650497 6:89502030-89502052 GTTAACAATAAGAATATGGGAGG - Intronic
1012952854 6:105537664-105537686 GTTCTCAATAAAAAAATGGGTGG + Intergenic
1014089469 6:117387347-117387369 GTTAACAATAGTAATATGAATGG + Intronic
1014929048 6:127311371-127311393 GTTAACCATAAGAAAACTGGGGG + Intronic
1015079822 6:129210111-129210133 TTTACCCATAAGAATTTGGGGGG + Intronic
1015140504 6:129925784-129925806 TTTAAAAATAAGCATATGGCCGG - Intergenic
1016807972 6:148232273-148232295 TTTATTAATAAGAATATGGAAGG + Intergenic
1016955829 6:149625968-149625990 GTTGAGAATGAGAATTTGGGAGG + Intronic
1017684413 6:156897568-156897590 TTTAAAAATAAGAATCTGGCTGG - Intronic
1021684792 7:23173833-23173855 GTTAAGAGTAAGAATTTAGGTGG + Intronic
1023062416 7:36341484-36341506 TTTCAAAATAAGAATGTGGGTGG - Intronic
1025272300 7:57534871-57534893 GTTAGCAAAAGGAATATTGGTGG - Intergenic
1025846770 7:65206250-65206272 CTTAAAAATAATAATATGGCTGG + Intergenic
1027815419 7:82963345-82963367 GTTAACTATCAGAAAATGTGGGG - Intronic
1031119998 7:117711509-117711531 GTTAATAATGAGAATATTGTAGG + Exonic
1033927738 7:146484847-146484869 CTTAAAAATAAGAATATGTAAGG - Intronic
1039324298 8:36467527-36467549 GTTAAAAAAAAAAAAATGGGAGG + Intergenic
1040716197 8:50255825-50255847 GTTCAACATAAGAATTTGGGGGG + Intronic
1041492084 8:58444207-58444229 CTTACCAATAGGAATATTGGGGG + Intronic
1041521221 8:58758334-58758356 GTCAACAATTACAATGTGGGAGG - Intergenic
1041819781 8:62017891-62017913 ATAAACAACAAGAATATGGCCGG - Intergenic
1043001572 8:74766352-74766374 ATTAAAAAAAAGAATATGGGGGG + Intronic
1043675550 8:82948531-82948553 GTTAATCATAAGAAAAGGGGAGG + Intergenic
1044919709 8:97155873-97155895 GATAGCAATAAGAGTAGGGGAGG + Intergenic
1046010489 8:108540603-108540625 GTGAAATCTAAGAATATGGGCGG - Intergenic
1046316089 8:112503538-112503560 ATTAACAATTAGTATATTGGAGG - Intronic
1050580805 9:7054126-7054148 GTTCACCAAAAGAATATGTGAGG + Intronic
1050974107 9:11914756-11914778 CTTAACAATAATAATAAGGCAGG - Intergenic
1052047541 9:23811904-23811926 GGTAACAAAAACAATATGGGAGG + Intronic
1052374091 9:27698320-27698342 GTAAACCATCTGAATATGGGAGG + Intergenic
1053260754 9:36661490-36661512 CTAAAGAATAAGAAGATGGGAGG + Intronic
1056169426 9:83969068-83969090 GTTCACAATAATTACATGGGGGG + Exonic
1056996216 9:91461988-91462010 GTCAACATTAACAAAATGGGGGG + Intergenic
1185819710 X:3190552-3190574 GTTAACAATATGGTTAAGGGTGG + Intergenic
1186995071 X:15112467-15112489 GACGACAATAAGAAAATGGGAGG + Intergenic
1188077139 X:25791826-25791848 GTTAATAATCAGAATATGTAAGG + Intergenic
1192567101 X:72174145-72174167 GTTCACCATAAAATTATGGGGGG + Intergenic
1193801287 X:85939686-85939708 AAAAAGAATAAGAATATGGGGGG - Intronic
1194438361 X:93897532-93897554 TATAACAATAATAATTTGGGTGG + Intergenic
1196481458 X:116155023-116155045 GTGAAAAAGCAGAATATGGGTGG + Intergenic
1196639915 X:118046894-118046916 TTTAACAATTATAATATGAGTGG + Intronic
1198193385 X:134333928-134333950 CTAAACAGTAAGAATATGGCTGG + Intergenic
1199379380 X:147150238-147150260 TTTAACAATATGAATTTTGGGGG + Intergenic
1200455795 Y:3390608-3390630 GAAAACAAAAAGAATATGTGGGG - Intergenic
1201387656 Y:13460298-13460320 GTTAAAGATAAAAATATGGTAGG - Intronic
1201629363 Y:16052728-16052750 GTTCAAAATAAGAATTTTGGGGG - Intergenic