ID: 1011650992

View in Genome Browser
Species Human (GRCh38)
Location 6:89506022-89506044
Sequence TAGAGTAGGAAGGTAGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011650988_1011650992 18 Left 1011650988 6:89505981-89506003 CCACTTATATGTGGAATCTTAAA 0: 4
1: 21
2: 83
3: 269
4: 1182
Right 1011650992 6:89506022-89506044 TAGAGTAGGAAGGTAGTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011650992 Original CRISPR TAGAGTAGGAAGGTAGTTGC GGG Intronic
No off target data available for this crispr