ID: 1011651814

View in Genome Browser
Species Human (GRCh38)
Location 6:89513362-89513384
Sequence CAGGTTAAGGATTGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011651814 Original CRISPR CAGGTTAAGGATTGGGAGGG GGG (reversed) Intronic
901078409 1:6569927-6569949 CAGGTTCTGGAAGGGGAGGGTGG + Intronic
903002987 1:20279604-20279626 CAGGTTAAGGACAGGGAAGTAGG + Intergenic
904024946 1:27496934-27496956 CAGATTAAGGATGTGGAGGTGGG - Intergenic
904789774 1:33010717-33010739 CAGGGTGAGGATGGTGAGGGAGG - Intronic
905380338 1:37557267-37557289 CAGATTTAGGATGGGGAAGGAGG + Intronic
907890295 1:58630729-58630751 CAGGGTGAGGATGGTGAGGGAGG - Intergenic
908401482 1:63775512-63775534 CAGGTTTAGGGCTGGGAGTGGGG - Intronic
910240035 1:85076280-85076302 AAGGTTAAGGATTTTGAGGTGGG - Intronic
911219232 1:95229719-95229741 TAGGTTAATGATTGGTGGGGTGG - Intronic
911772854 1:101769306-101769328 GAGGTAAAGGATTTGCAGGGTGG - Intergenic
912285548 1:108364854-108364876 CAGGATGAGGAATGGGAGGAAGG + Intergenic
912947945 1:114100219-114100241 CAGCTCAAGAAATGGGAGGGCGG + Intronic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
913521732 1:119650910-119650932 CAGAGGAAGGCTTGGGAGGGAGG + Intergenic
914375862 1:147073055-147073077 CTGTATTAGGATTGGGAGGGAGG + Intergenic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
916010159 1:160698186-160698208 CAGGTTATAGTTTGGGAGGCTGG - Intronic
916594476 1:166230376-166230398 CTGGTTCAGTCTTGGGAGGGTGG + Intergenic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
917294807 1:173507534-173507556 CAGCATAAGAATTGGGTGGGAGG - Intronic
917568276 1:176234609-176234631 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
920054706 1:203183610-203183632 CAGGTCAGGGACAGGGAGGGAGG - Intronic
920074280 1:203325465-203325487 CAGGCTAGGGGTGGGGAGGGAGG - Intergenic
920105234 1:203547962-203547984 CAGGTTGAGGATGAGGTGGGAGG + Intergenic
920550350 1:206855438-206855460 CAGGTCAAGGGTGGGGAGGGCGG + Intergenic
920905423 1:210160421-210160443 GAGGTCAAGGATGGGGTGGGAGG + Intronic
923827886 1:237520678-237520700 CTGGTTCAGTCTTGGGAGGGAGG - Intronic
1063636172 10:7785276-7785298 CAGGTTAAACATTTGCAGGGAGG - Intronic
1065077685 10:22097696-22097718 CAGACCAAGGATGGGGAGGGAGG - Intergenic
1066350584 10:34633341-34633363 GAGGTTAGCGGTTGGGAGGGGGG - Intronic
1067006447 10:42668563-42668585 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1068275691 10:54792853-54792875 CAGGTTGAGCACTGGCAGGGTGG + Intronic
1069677960 10:70262232-70262254 CAGGATATGGTTGGGGAGGGGGG + Intronic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1071900501 10:90115788-90115810 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1072505899 10:96066676-96066698 CAGTTTAAACATTGGGAAGGAGG + Intergenic
1072744994 10:97933586-97933608 CAGGCAGAGGATTGGGAGAGGGG + Intronic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1075987880 10:126803701-126803723 TTGGTTAGGGACTGGGAGGGAGG - Intergenic
1076352924 10:129831256-129831278 CAGGTGCGGGAGTGGGAGGGAGG - Intergenic
1077754930 11:5017014-5017036 CAGATTCAGGTTTGAGAGGGAGG - Intergenic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079248135 11:18768400-18768422 CAAGTTTAGGATTGGAAGGTTGG - Intronic
1079968336 11:27005892-27005914 CAGGTTGAGGGTAGGGAGGTGGG + Intergenic
1080587875 11:33697706-33697728 CAGAGTAAGGATTGCCAGGGTGG - Intergenic
1081149426 11:39608466-39608488 CAGGGTAAAGGTTGGGTGGGTGG + Intergenic
1083508875 11:63188259-63188281 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
1083941004 11:65895789-65895811 CAGGTAGAGGATGGGGAGAGAGG - Intronic
1085255955 11:75173221-75173243 AATGTTAAGAATTGGGAGGGTGG + Intronic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1085498924 11:76999631-76999653 GAGGTTAAGGACAGGGAGTGAGG - Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1087424714 11:97971756-97971778 CAGATTAAGGGTTGAGAGAGAGG + Intergenic
1087747948 11:101971519-101971541 CTGTTTAAGGTTTGGGCGGGGGG + Intronic
1088077098 11:105863613-105863635 CAGGGGCAGGAGTGGGAGGGAGG - Intronic
1088193343 11:107250234-107250256 CAGGTGAGGGATTGGCAGAGAGG + Intergenic
1088616207 11:111631443-111631465 CAGGTTGAGGATTAGAATGGTGG + Intronic
1088965707 11:114719247-114719269 CTGGGTTTGGATTGGGAGGGAGG - Intergenic
1089126922 11:116183007-116183029 CAGGTGAAGGAGGGGGAGAGAGG - Intergenic
1092076466 12:5677665-5677687 GAGGTCAAGCATTGGGAGAGAGG + Intronic
1092670409 12:10855074-10855096 CAGGAGAAGGACTGGGTGGGGGG - Intronic
1096001794 12:48136186-48136208 GAGGTTAAGAATGAGGAGGGAGG - Intronic
1096030056 12:48405884-48405906 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1096321083 12:50613471-50613493 AAGGGTAAGGATCGGTAGGGAGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097181395 12:57173995-57174017 CAGGAGAAGGGTAGGGAGGGTGG + Intronic
1097566490 12:61276003-61276025 GAGGTCAAGGAGTGGGAGGAGGG + Intergenic
1097792645 12:63831057-63831079 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1098906341 12:76166594-76166616 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1099516037 12:83597730-83597752 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1100673705 12:96844207-96844229 TAAGTTAAGGATGGGGAGAGGGG + Intronic
1101027859 12:100631158-100631180 CAGGTGAAGAGTTGGGATGGGGG - Intergenic
1101427908 12:104602932-104602954 CAGGTGAGAGATTGGGAAGGGGG - Intronic
1102616009 12:114154786-114154808 CAGGTTAAGGAATGCCAGGTAGG - Intergenic
1104517755 12:129443523-129443545 CAAGTCCAGGAGTGGGAGGGAGG - Intronic
1106074033 13:26441940-26441962 CAAGGTACAGATTGGGAGGGAGG + Intergenic
1106109635 13:26765686-26765708 CGGGTTAAGGGTTGGGGGCGGGG - Intergenic
1106197854 13:27509485-27509507 TATGTTTAGGATTGGGAGGATGG - Intergenic
1106817159 13:33421373-33421395 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1107043639 13:35973770-35973792 CAGGTTAAGGATGGAGAAGATGG + Intronic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1110692592 13:78448712-78448734 AAGTCTAAGAATTGGGAGGGTGG + Intergenic
1112018950 13:95354928-95354950 CAGGCTGAGGGTTGGGAGGCTGG - Intergenic
1112567663 13:100565079-100565101 AAGGTCAAAGATTGGGAAGGAGG - Intronic
1113436327 13:110294419-110294441 CAGATGGAGGAATGGGAGGGAGG - Intronic
1113722448 13:112569913-112569935 CAAGTTAAGAATGGGGAGAGGGG + Intronic
1113848384 13:113404789-113404811 CAGGTTCAGGAATGGGACCGGGG - Intergenic
1113853907 13:113433651-113433673 CAGGTTAAGTGTGGGGTGGGGGG - Intronic
1116767374 14:49088989-49089011 CAGATTGGGGGTTGGGAGGGAGG + Intergenic
1118233493 14:63976993-63977015 AAGGTCAAGGGGTGGGAGGGTGG + Intronic
1119265853 14:73262915-73262937 GAAGTTAGGGATGGGGAGGGAGG - Intronic
1119922023 14:78455326-78455348 CATGCTAAGGATGGAGAGGGAGG + Intronic
1122447622 14:101781316-101781338 CGGGTTGAGGCTTCGGAGGGTGG - Intronic
1122655141 14:103253680-103253702 GAGGCCAAGGATTGGGAGGAGGG - Intergenic
1122762341 14:104038489-104038511 CAGCTGAAGGATTTGGAGGCTGG + Intronic
1124450180 15:29781250-29781272 CTGGTTCAGTCTTGGGAGGGTGG - Intronic
1124654520 15:31497774-31497796 CCAGTGAAGGGTTGGGAGGGTGG - Intronic
1125012399 15:34893559-34893581 CAGGTTAGGGGTTGAGGGGGAGG - Intronic
1125373578 15:39004203-39004225 CTGGTTCAGTCTTGGGAGGGTGG - Intergenic
1126878736 15:53071970-53071992 CAAGATAAAGCTTGGGAGGGAGG - Intergenic
1127545262 15:59988000-59988022 CAGGTTAAGGGTGGGGAAAGAGG + Intergenic
1128240265 15:66096692-66096714 CAGGTTAGGGATAGGGTGGAGGG + Intronic
1128496143 15:68199735-68199757 GAGACTAAGGATGGGGAGGGCGG - Intronic
1129232374 15:74203893-74203915 CAGGCTCAGGATGGGGATGGGGG + Intronic
1129516252 15:76159418-76159440 CAGGTTCTGGAGTGGGAGTGAGG - Intronic
1131135702 15:89933518-89933540 CAGGGGCAGGAGTGGGAGGGAGG + Intergenic
1131944185 15:97601047-97601069 AAGGTGAAGGAATGGGAGAGAGG - Intergenic
1132574452 16:658103-658125 CAGGGTCAGGCTCGGGAGGGAGG - Intronic
1133362331 16:5184376-5184398 CAGGTAAAGGCTTGGGAAGTGGG + Intergenic
1134224387 16:12380337-12380359 CAGGTGAAGGGATGGGTGGGTGG - Intronic
1135915768 16:26604192-26604214 TAGGTTAGGAATTAGGAGGGTGG + Intergenic
1136909144 16:34132581-34132603 CAGGTTGAGGGTGGGGAGGAGGG + Intergenic
1137740686 16:50769803-50769825 GAGGTTAAGGATGGGGCAGGAGG - Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1139601062 16:67987515-67987537 CAGAATAAGGACTGGGAAGGTGG + Exonic
1143005442 17:3829937-3829959 CATGTTAATGATTGGTAGTGAGG - Intronic
1143650804 17:8263400-8263422 CAGGTTCAGGGTTGGAAGGGTGG + Intronic
1144110996 17:12032753-12032775 CAGAATAAGGATGGTGAGGGAGG - Intronic
1144292422 17:13839259-13839281 CAGGTTAAAGGTTGGGCGTGGGG + Intergenic
1144604384 17:16652015-16652037 AGGGTGAAGGAGTGGGAGGGGGG + Intronic
1144755671 17:17679195-17679217 CAGGTTAAGGTAAGGCAGGGAGG + Intergenic
1146169369 17:30621250-30621272 GAGGGTAAGGCTTGGGAGGCAGG + Intergenic
1146170193 17:30626199-30626221 GAGGGTAAGGCTTGGGAGGCAGG - Intergenic
1146343645 17:32042228-32042250 GAGGGTAAGGCTTGGGAGGCAGG - Intronic
1146944075 17:36862439-36862461 AAGCTTTAGGATGGGGAGGGAGG - Intergenic
1147166623 17:38596830-38596852 CAGGTTGAGGGTTGGGGGTGTGG - Intronic
1148622777 17:49046850-49046872 CTGGGAAAGGAATGGGAGGGTGG - Intronic
1152345113 17:79746764-79746786 CAGGTTAAGGAGTGTGGGAGTGG - Intergenic
1152497750 17:80686068-80686090 AAGATAAAGGATTGGGAGGATGG + Intronic
1153899511 18:9604355-9604377 AATGGTAGGGATTGGGAGGGAGG - Intronic
1156369619 18:36461034-36461056 CAGGATGAGGGTTGAGAGGGAGG + Intronic
1156519747 18:37712136-37712158 CAGGTTAGGGTTTGGGCGGGTGG + Intergenic
1157125965 18:44956195-44956217 GAGGCTAAGGCTTGGAAGGGAGG - Intronic
1157599108 18:48882633-48882655 CAGGTTAAGGAATGGAAAGAAGG - Intergenic
1158689884 18:59650781-59650803 CAGGTACAGGATCGGTAGGGAGG - Intronic
1161562831 19:4983316-4983338 CGGGGGCAGGATTGGGAGGGTGG - Intronic
1162193775 19:8967727-8967749 CAGGGAAAGGATTCAGAGGGAGG - Intronic
1163123784 19:15233258-15233280 CAGGTCTAGGACTAGGAGGGAGG + Intronic
1163513281 19:17748362-17748384 CACCTTAAGGATGGGGTGGGGGG + Intronic
1163758102 19:19118944-19118966 CAGTTTGAGGAATGGGAGGGCGG - Intergenic
1163883067 19:19944448-19944470 CAGGTTTGGGAAGGGGAGGGTGG - Intergenic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
925196315 2:1928956-1928978 CAGGATAAGGATGTGCAGGGAGG + Intronic
925706554 2:6689822-6689844 CAGGTAAAAGGGTGGGAGGGGGG + Intergenic
925969557 2:9096866-9096888 CAGGTCAAGGGCGGGGAGGGTGG + Intergenic
927639418 2:24837281-24837303 CAGGTTATGGAGTGGGAAGGAGG + Intronic
927743950 2:25598720-25598742 CAGGTTGAGGATAGGGACTGGGG + Intronic
928224396 2:29435544-29435566 CAGGAAAAAGATTGGGAGAGGGG - Intronic
928332390 2:30367732-30367754 CAGGTTAGGGATTGAGAGCCAGG - Intergenic
929736484 2:44555437-44555459 TAGGGTGAGGATGGGGAGGGAGG + Intronic
930152568 2:48073754-48073776 CAGGCTTGGGCTTGGGAGGGAGG + Intergenic
931520116 2:63087360-63087382 CAGGTAAAGGAATGTGAGTGTGG + Intergenic
932115455 2:69042732-69042754 CAGGTGAAGGGTGGGGAGGAGGG - Intronic
932140552 2:69273612-69273634 GAGGCTGAGGATTGGGAGGGAGG - Intergenic
932587444 2:73040400-73040422 CAGGTTAAGGGTGGGAAGGATGG - Intronic
935278881 2:101500755-101500777 CAGGGGGAGGATTGGGAGGGAGG - Intergenic
936934591 2:117826974-117826996 CTGGTTAGGGACTGAGAGGGAGG - Intronic
937680661 2:124640818-124640840 CAGGTGAAGGGTTAGGAAGGAGG + Intronic
943636973 2:190317701-190317723 GAGGTTAAGGTTTGGGAGTGTGG + Intronic
946378763 2:219330716-219330738 CTGGTTAGAGATGGGGAGGGGGG - Intronic
947258357 2:228191433-228191455 CATCTAAAGGTTTGGGAGGGTGG + Intergenic
947335655 2:229080075-229080097 CAGGTCATGCCTTGGGAGGGTGG - Intronic
948822367 2:240556654-240556676 CAGGTTAAGAATTGAAAGGTGGG - Intronic
1170652765 20:18257678-18257700 CAGGGTAAGGTTGGGCAGGGTGG + Intergenic
1170712699 20:18806695-18806717 CATGTTCAGGATGGGCAGGGGGG + Intergenic
1170872249 20:20217050-20217072 CAAGTGAAGGACTTGGAGGGAGG - Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1171412614 20:24957085-24957107 CAGGTTAGGGGTGGGTAGGGTGG + Intronic
1172531256 20:35632757-35632779 GAGGTTAAGGTTGTGGAGGGAGG - Intronic
1172824277 20:37767190-37767212 CAGGATACGGATTGGAAGGGGGG + Intronic
1173154984 20:40601101-40601123 CAGGTTAAGGCAGGGGAGGAGGG + Intergenic
1173614660 20:44394899-44394921 CAGGCTAAGGACAGGGAGGGAGG + Intronic
1174230946 20:49045243-49045265 TAGGTTATGGATGGGGAGGAGGG + Intergenic
1174381087 20:50155780-50155802 GAGCTTAAGGCTTGGGTGGGGGG + Intergenic
1175345067 20:58267032-58267054 CAGGCTCAGGAAGGGGAGGGAGG + Intergenic
1180049310 21:45324124-45324146 GAGGCTGAGGGTTGGGAGGGAGG - Intergenic
1180317304 22:11285979-11286001 CAGGTTGAGGGTGGGGAGGAGGG - Intergenic
1183605220 22:38863941-38863963 CAAGCTGAGGTTTGGGAGGGTGG - Exonic
1183730465 22:39615623-39615645 CAGGACAAGGATGGGGAGAGAGG - Intronic
1183733480 22:39630955-39630977 CAGGTTCAGGTGTGGCAGGGAGG + Intronic
1184838478 22:47038280-47038302 CACGTTCAGGATTTGCAGGGGGG + Intronic
949421028 3:3866152-3866174 CTGGTTTAGTCTTGGGAGGGTGG - Intronic
949532389 3:4969179-4969201 CCGGTTTAGTCTTGGGAGGGTGG - Intergenic
950264667 3:11564887-11564909 CAGGCCAAGGCTGGGGAGGGAGG + Exonic
950381925 3:12623507-12623529 CAGGCTAAGGGTTGGGTGCGGGG + Intronic
952750346 3:36820115-36820137 AAGGTTAGGGAGTGGGATGGGGG - Intergenic
953383419 3:42490925-42490947 GAGGTGAAGGATTGTGATGGAGG + Intronic
953539500 3:43803591-43803613 CTGGTTTAGTGTTGGGAGGGTGG + Intergenic
954183211 3:48898003-48898025 CAGACTGAGGCTTGGGAGGGAGG - Intronic
954563250 3:51576561-51576583 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
954671707 3:52294489-52294511 CAGGCTGGAGATTGGGAGGGAGG + Intergenic
955153407 3:56391499-56391521 GGGGTTAAGGAATGGGAGGCAGG + Intronic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960678731 3:120224903-120224925 CAGATTAAAGATTGGAAAGGAGG - Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961414971 3:126750528-126750550 CAGGATAAGGACTGAGATGGAGG + Intronic
963584034 3:147161730-147161752 GAGGTTAAGGACTAGGAAGGAGG - Intergenic
965103688 3:164334118-164334140 CTGGTTTAGGAAGGGGAGGGGGG + Intergenic
965464163 3:169006224-169006246 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
965635201 3:170773625-170773647 GAGGATAAGAATTGGGAGGAAGG + Intronic
967683384 3:192391909-192391931 CAGATTGAGGAGTGGGAGAGAGG + Intronic
969624425 4:8295115-8295137 CAGGTGAATGAGTGGGTGGGTGG - Intronic
970163769 4:13215064-13215086 CAGGTTGAGGATAGAGAAGGGGG - Intergenic
970439573 4:16068431-16068453 CAGGTTAAGGATTGAAATGGAGG - Intronic
972200135 4:36704086-36704108 CAGAGTTAGGATTGGGAAGGAGG - Intergenic
973630032 4:52811624-52811646 CTGGTGAAGGAGTTGGAGGGAGG + Intergenic
973781282 4:54290427-54290449 AAGCTGAAGGACTGGGAGGGTGG + Exonic
974135863 4:57817121-57817143 GTGGTCAGGGATTGGGAGGGAGG + Intergenic
975245180 4:72112234-72112256 CACTTTAAGAAGTGGGAGGGAGG + Intronic
976597591 4:86908621-86908643 AAGGTTGAGGAGGGGGAGGGAGG - Intronic
976828269 4:89284197-89284219 CAGGTGAAGGAATGGGTGGGTGG + Intronic
977724707 4:100282379-100282401 CAGGTAAACGATGGGGAGGATGG + Intergenic
977995912 4:103497149-103497171 CAGGTCAAGGCTGGGTAGGGAGG + Intergenic
979918839 4:126473888-126473910 CTGATTATGGATAGGGAGGGAGG + Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
981539170 4:145831148-145831170 CAGGTTAGGGAATGTGGGGGTGG + Intronic
983754151 4:171312871-171312893 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
984388565 4:179097286-179097308 CAGCTTTTGGATGGGGAGGGTGG - Intergenic
984489296 4:180412269-180412291 AAGGTGAAGGGTTAGGAGGGAGG - Intergenic
985553885 5:546732-546754 CGGGTTAAGGATGGGGCGAGCGG + Intergenic
986521547 5:8624240-8624262 AGTGTTAAGGAGTGGGAGGGAGG + Intergenic
988172568 5:27678804-27678826 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
988297933 5:29390531-29390553 CAGGTTCAGGAAGGGGAGGGTGG - Intergenic
989002923 5:36779929-36779951 CAGGTTGAGGATGGGGATGTGGG - Intergenic
989562307 5:42866226-42866248 CTGGTTTAGTCTTGGGAGGGTGG - Intronic
989583576 5:43056554-43056576 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
990369196 5:55099942-55099964 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
990416287 5:55590253-55590275 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
991609564 5:68436310-68436332 CAGGTGAAGGCTTTGGGGGGTGG + Intergenic
991711129 5:69409434-69409456 CAGGGTTGGGAATGGGAGGGAGG + Intronic
993053018 5:82947439-82947461 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
993225232 5:85161287-85161309 CTGGTTCAGTCTTGGGAGGGTGG + Intergenic
993230536 5:85229650-85229672 CTGGTTCAGTCTTGGGAGGGTGG + Intergenic
993305598 5:86271576-86271598 CAGGATGAGGAATGGGAGGAAGG + Intergenic
996215010 5:120855970-120855992 TAGGTTCAGGATGGGGAGTGTGG - Intergenic
997335281 5:133104129-133104151 TAGGTTGAGGATTGGGTGGTGGG + Intronic
997809712 5:136955247-136955269 TAGGTTAAGAATTGGGAGATGGG + Intergenic
997813179 5:136991897-136991919 CATGTTATGGATGGGGAGAGGGG + Intronic
998401234 5:141850125-141850147 CAGGTGCAGGATGGGGTGGGAGG - Intergenic
998976188 5:147651067-147651089 CAGGTGATGGATTTGGAGGGAGG + Intronic
999486731 5:152004387-152004409 GAGCTCATGGATTGGGAGGGGGG + Intergenic
1001220927 5:169900226-169900248 CAGGTTAGGGCCTGGGATGGTGG - Intronic
1001289578 5:170447229-170447251 AAGGGGAAGAATTGGGAGGGGGG + Intronic
1001313043 5:170624817-170624839 CAGGGTAAGGATGGTGAGGAAGG - Intronic
1002101745 5:176861330-176861352 CAGGTTCAGGATGGGGTGGATGG + Intronic
1002980214 6:2128630-2128652 CAGGTAGAGGAGTGGGAGGAAGG - Intronic
1002989791 6:2228043-2228065 TAGGTTCAGCACTGGGAGGGAGG - Intronic
1003181083 6:3792294-3792316 CAGGTGAATGAATGGGTGGGTGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005877400 6:30022264-30022286 GAGGTTATGGATTCGGGGGGAGG - Intergenic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006597165 6:35201943-35201965 GAGGTTAAGGTTTGGGAGAAAGG - Intergenic
1007172325 6:39872491-39872513 CTGGTTAGGGATGGGGAGAGGGG - Intronic
1007825414 6:44596195-44596217 GAGGCTAAGGATATGGAGGGAGG - Intergenic
1007915540 6:45558208-45558230 CAGATTGAGGATTGGGATGGGGG - Intronic
1008025605 6:46632605-46632627 GAGGGTAGAGATTGGGAGGGGGG - Intronic
1008267289 6:49444156-49444178 CAAGGGAAGGACTGGGAGGGGGG + Intronic
1008754865 6:54782527-54782549 GAGGCTAAGTGTTGGGAGGGTGG + Intergenic
1009220968 6:60983660-60983682 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1009229973 6:61050119-61050141 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1011286424 6:85729343-85729365 CAGGTGAAAGGGTGGGAGGGGGG - Intergenic
1011651814 6:89513362-89513384 CAGGTTAAGGATTGGGAGGGGGG - Intronic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1014883470 6:126750847-126750869 CTGGTTCAGTCTTGGGAGGGTGG - Intergenic
1017505862 6:155068028-155068050 CAGGCTAAGAATTGGGAGAAGGG + Intronic
1019479910 7:1261579-1261601 CAGGGGATGGATTGGGAGGATGG + Intergenic
1020748738 7:12112092-12112114 CAGGGTATGGATTCCGAGGGTGG - Intergenic
1021526969 7:21598729-21598751 GAGGGTAAGGATTGGAAGGAGGG - Intronic
1021585341 7:22201829-22201851 CAGGTTTGGGAGTGGGATGGAGG + Intronic
1022028358 7:26469123-26469145 CAGTCAAAGGATTGGGAAGGGGG - Intergenic
1023343919 7:39251875-39251897 CAGGGTAGGGATTGTAAGGGTGG - Intronic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1024340254 7:48250383-48250405 CAGGTAAGGGAATGGGAGGAGGG + Intronic
1026228408 7:68462793-68462815 GAGGTGAAGGAAGGGGAGGGAGG - Intergenic
1026379392 7:69784012-69784034 CAGTTGAAGGTTGGGGAGGGGGG - Intronic
1026413492 7:70153418-70153440 CAGGCACAGAATTGGGAGGGAGG + Intronic
1027149877 7:75725466-75725488 GAGGTTGGTGATTGGGAGGGTGG - Intronic
1027604212 7:80280121-80280143 CAGATCAAGGAAAGGGAGGGTGG + Intergenic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1031531968 7:122886538-122886560 CGGGAGGAGGATTGGGAGGGGGG + Intronic
1032836471 7:135680065-135680087 TTGGTTAAGTTTTGGGAGGGAGG - Intronic
1033351998 7:140569441-140569463 CAGGACAAGGATGGGGAGGCAGG + Intronic
1034488606 7:151381324-151381346 CAGGTCAGGGATGGGGAGGGAGG + Exonic
1034537234 7:151733056-151733078 CAGGCACAGGCTTGGGAGGGAGG + Intronic
1037557920 8:20043473-20043495 ATGGTTCAGGATTGGGAGAGTGG + Intergenic
1039727333 8:40232909-40232931 CAAGGTAAGGATTGTGAGAGGGG + Intergenic
1041079548 8:54203042-54203064 CTGGTTAGGGAATGGGATGGTGG + Intergenic
1042230641 8:66550964-66550986 CAAATTAAGGGTTGGGAGGTGGG - Intergenic
1043105819 8:76108760-76108782 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1043269300 8:78309822-78309844 CAGGTAAGGGAGTGGGAGGAGGG - Intergenic
1044678690 8:94755380-94755402 CTGGTTAAGGGAAGGGAGGGTGG + Intronic
1044747421 8:95384260-95384282 CAGATTGAGGAGTGGGATGGAGG + Intergenic
1047774666 8:128059906-128059928 CAGGTGAGGGATTGTGAGGCAGG + Intergenic
1048373963 8:133805462-133805484 CCTGTTAAGCATGGGGAGGGTGG + Intergenic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1049461080 8:142728107-142728129 CAGGTTAAGAAATGGCAGGAGGG - Intronic
1051273977 9:15381494-15381516 CAGGTTTAGGCTTGGGCTGGCGG - Intergenic
1051391139 9:16565256-16565278 CAGGTTAAGGATTTTGTGTGTGG - Intronic
1052061234 9:23963415-23963437 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1053305274 9:36980427-36980449 CTGGTTAAGGGTTGGGGGAGGGG + Intronic
1053752375 9:41269410-41269432 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1053752823 9:41273667-41273689 CAGGTGGAGGACTGGGCGGGAGG - Intergenic
1054257903 9:62833742-62833764 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1054258347 9:62838019-62838041 CAGGTGGAGGACTGGGCGGGAGG - Intergenic
1054333422 9:63782022-63782044 CAGGTGGAGGACTGGGCGGGAGG + Intergenic
1055155826 9:73061742-73061764 CAGGGTAGGGAGTGGGTGGGGGG - Intronic
1055384019 9:75741661-75741683 GAGGTTAAGGAGTGGGAGTGAGG - Intergenic
1056008373 9:82299060-82299082 CAGGTAAAGGAGTTTGAGGGAGG + Intergenic
1056862168 9:90195602-90195624 CTGGTTTAGTCTTGGGAGGGTGG - Intergenic
1057684859 9:97222382-97222404 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1059058063 9:111005267-111005289 ATTGTTAAGAATTGGGAGGGAGG + Intronic
1059673249 9:116511717-116511739 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
1059675420 9:116534075-116534097 CTGGTTTAGTCTTGGGAGGGTGG + Intronic
1060018061 9:120104424-120104446 GAGGAGAAGGATTGGGATGGTGG + Intergenic
1060150861 9:121287239-121287261 CAGGGGGAGGAGTGGGAGGGAGG + Intronic
1060294864 9:122336639-122336661 GAGTTAAAGAATTGGGAGGGTGG + Intergenic
1060305870 9:122411342-122411364 CTGGTTTAGTCTTGGGAGGGTGG + Intergenic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1061369869 9:130192136-130192158 CAGGTATGGGATTGGGAGTGGGG + Intronic
1202800427 9_KI270719v1_random:170356-170378 CAGGTGGAGGACTGGGCGGGAGG + Intergenic
1202800872 9_KI270719v1_random:174638-174660 CAGGTGGAGGAGTGGGTGGGAGG + Intergenic
1203697146 Un_GL000214v1:109268-109290 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1187504434 X:19867302-19867324 CAAGTTAGGGGTGGGGAGGGAGG + Intronic
1187851492 X:23595643-23595665 CTGCTTAATGATTGGGATGGAGG - Intergenic
1189518578 X:41741716-41741738 CAGGATCATGACTGGGAGGGTGG - Intronic
1190159759 X:48022713-48022735 CATGTTAATGATTGGTAGAGTGG - Intronic
1190497896 X:51044268-51044290 TAGGTGCAGGAGTGGGAGGGTGG + Intergenic
1190508503 X:51153478-51153500 TAGGTGAAAGAGTGGGAGGGTGG - Intergenic
1191099352 X:56708469-56708491 CTGGTTCAGTCTTGGGAGGGTGG + Intergenic
1191778372 X:64843054-64843076 CAGGTTCAGGAAGGGGAGAGTGG - Intergenic
1192215743 X:69156946-69156968 GAGGTTGAGGGTTGAGAGGGTGG + Intergenic
1195657586 X:107347015-107347037 CAGGGAAAGATTTGGGAGGGAGG + Intergenic
1197654866 X:129106093-129106115 CGGGGTAGGGATTGGGTGGGAGG - Intergenic
1197696630 X:129556944-129556966 CCAGCTAAGGAATGGGAGGGAGG + Intronic
1198012827 X:132576265-132576287 CAGAGAAAGTATTGGGAGGGAGG + Intergenic
1199949737 X:152698582-152698604 AGGGGTAAGGATTGGGACGGGGG - Intergenic
1199959937 X:152769879-152769901 AGGGGTAAGGATTGGGACGGGGG + Intergenic
1201153345 Y:11107331-11107353 CAGGTGGAGGAGTGGGCGGGAGG + Intergenic
1201311103 Y:12598690-12598712 CTGGTTCAGGAAGGGGAGGGTGG + Intergenic
1201461845 Y:14234101-14234123 AAGATTTAGGATTGGGAGAGAGG - Intergenic