ID: 1011652172

View in Genome Browser
Species Human (GRCh38)
Location 6:89516594-89516616
Sequence TAAACCCAGATACTTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011652172_1011652179 28 Left 1011652172 6:89516594-89516616 CCTCCTGCAAGTATCTGGGTTTA 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1011652179 6:89516645-89516667 ATTTGTATTTTTAGTAGAGACGG 0: 1194
1: 199808
2: 143919
3: 66988
4: 40675
1011652172_1011652181 30 Left 1011652172 6:89516594-89516616 CCTCCTGCAAGTATCTGGGTTTA 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1011652181 6:89516647-89516669 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
1011652172_1011652180 29 Left 1011652172 6:89516594-89516616 CCTCCTGCAAGTATCTGGGTTTA 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011652172 Original CRISPR TAAACCCAGATACTTGCAGG AGG (reversed) Intronic
901029225 1:6297155-6297177 TAATCCCAGCTACTAGGAGGCGG - Intronic
901211810 1:7530934-7530956 TAATCCCAGCTACTTGGGGGAGG - Intronic
901265242 1:7905263-7905285 TAATCCCAGCTACTCGCAGGAGG - Intergenic
901271472 1:7955147-7955169 TAATCCCAGCTACTTTCGGGAGG - Intronic
901512712 1:9725431-9725453 TAATCCCAGCTACTTTCGGGAGG + Intronic
904829644 1:33298646-33298668 TATACCCAGCTACATCCAGGTGG + Intronic
905424793 1:37874675-37874697 TAATCCCAGCTACTGGGAGGCGG + Intronic
905561987 1:38934535-38934557 TAATCCCAGCTACTCGGAGGTGG + Intronic
905709515 1:40089165-40089187 TAATCCCAGCTACTCGGAGGCGG + Intronic
906582448 1:46947313-46947335 TTAACCCAGAAACCTGCAGATGG + Intergenic
907341019 1:53736422-53736444 TAAACACAGAACGTTGCAGGAGG + Intergenic
909569967 1:77098453-77098475 TAATCCCAGCTACTTGAGGGAGG - Intronic
912183107 1:107242152-107242174 TAGTCCCAGCTACTTGGAGGAGG + Intronic
912284540 1:108355039-108355061 TAGTCCCAGATACTTGGATGAGG - Intergenic
916335026 1:163661443-163661465 TCAACCCAGATATTGACAGGTGG + Intergenic
917912971 1:179670268-179670290 TAATCCCAGCTACTTGGGGGAGG + Intronic
918905783 1:190491156-190491178 TAAAAGCACATTCTTGCAGGTGG - Intergenic
919856951 1:201712595-201712617 GAACCCCAGATCCTGGCAGGGGG - Intronic
919908982 1:202098451-202098473 TAATCCCAGCTACTCGAAGGAGG - Intergenic
920419391 1:205821026-205821048 TAATCCCAGCTACTCCCAGGAGG - Intergenic
923814949 1:237367213-237367235 TAATCCCAGCTACTTTCAGGAGG - Intronic
924772458 1:247089317-247089339 AAAGCCCAAATACTTTCAGGCGG - Intergenic
1067732051 10:48819590-48819612 TTACCCCAGATACGTCCAGGAGG - Intronic
1073848127 10:107583145-107583167 TAGTCCCAGCCACTTGCAGGGGG - Intergenic
1075111662 10:119591283-119591305 TAATCCCAGCTACTTGGGGGAGG + Intronic
1075450361 10:122547296-122547318 TAGTCCCAGCTACTTGTAGGGGG - Intergenic
1075872490 10:125781065-125781087 TAGTCCCAGCTACTTGCGGGAGG - Intergenic
1075987977 10:126804604-126804626 TAAACAAAGACACTTGCAGCAGG + Intergenic
1077590347 11:3486148-3486170 GAAACTAAGATTCTTGCAGGTGG - Intergenic
1077860297 11:6171928-6171950 TAGTCCCAGCTACTTGGAGGCGG + Intergenic
1080364832 11:31561561-31561583 TAATCCCAGCTACTTGGAGGAGG - Intronic
1080523712 11:33091831-33091853 TAGTCCCAGATACTGGGAGGCGG - Intronic
1082015248 11:47480914-47480936 TAATCCCAGCTGCTTGCAGTTGG + Intronic
1083063646 11:59900176-59900198 TAGTCCCAGCTCCTTGCAGGTGG + Intergenic
1083127231 11:60582682-60582704 TAAAGCCAAATACTTACAGTTGG + Intergenic
1084246066 11:67857929-67857951 GAAACTAAGATTCTTGCAGGTGG - Intergenic
1084468424 11:69340952-69340974 TAAAGCCAGACCCCTGCAGGGGG - Intronic
1084826608 11:71736571-71736593 GAAACTAAGATTCTTGCAGGTGG + Intergenic
1087244986 11:95824848-95824870 TAAACCCAAAGACTGGCAGTTGG - Intronic
1087723186 11:101690000-101690022 TAAACCCAGGTACTTTCAACTGG + Intronic
1088588984 11:111386043-111386065 TAGTCCCAGCTACTTGAAGGTGG + Intronic
1088666606 11:112099826-112099848 TAATCCCAGCTACTTTCAGAAGG - Intronic
1090297461 11:125601499-125601521 TAATCCCAGTTACTTTCAGAAGG + Intronic
1090596476 11:128326064-128326086 TAATCCCAGCTACTCTCAGGAGG + Intergenic
1092226605 12:6752376-6752398 GAAGCTCAGATACTTGGAGGTGG + Intronic
1092416643 12:8295054-8295076 GAAACTAAGATTCTTGCAGGTGG - Intergenic
1092906900 12:13109125-13109147 TAATCCCAGCTACCTGCAGGAGG - Intronic
1093599141 12:21000994-21001016 TAAAGTCACATACTTGGAGGGGG - Intergenic
1094251240 12:28364264-28364286 TAATCCCAGCTACTTGGGGGAGG + Intronic
1095259905 12:40085956-40085978 TAATCCCAGCTACTTGGTGGAGG - Intronic
1095879685 12:47119843-47119865 TAATCCCAGCTACTTGGGGGAGG + Intronic
1096358359 12:50962287-50962309 TAATCCCAGCTACTTGGGGGAGG + Intronic
1096594550 12:52686310-52686332 TAAACCAAGAGGCTGGCAGGAGG - Intergenic
1098978950 12:76934218-76934240 TAATCCCAGCTACTTATAGGAGG + Intergenic
1099545244 12:83971442-83971464 TAAACCAAGATACTTTGAAGAGG - Intergenic
1103387681 12:120546278-120546300 CAAACCCAGATTCCTGAAGGTGG + Intronic
1103817824 12:123672612-123672634 CAGTCCCAGATACTTGGAGGGGG + Intronic
1104311952 12:127661208-127661230 TTAACCCAGATGCTTCCATGAGG - Intergenic
1104454816 12:128902361-128902383 TAATCCCAGCTACTTTCGGGAGG + Intronic
1104728744 12:131093728-131093750 TAACCCCAGCTGCATGCAGGAGG - Intronic
1105065744 12:133195835-133195857 TAATCCCAGCTACTTGGAAGGGG - Intronic
1105392376 13:19992445-19992467 TAGTCCCAGCTACTTGGAGGTGG + Intronic
1108106023 13:47011091-47011113 TAATCCCAGCTACTCGTAGGAGG + Intergenic
1108320186 13:49281931-49281953 TAATCCCAGATACTGGGGGGTGG - Intronic
1111033851 13:82644110-82644132 TAATCCCAGCTACTTGGAGTTGG - Intergenic
1111200992 13:84936984-84937006 AAAACCCAGAAACTTACAGCAGG - Intergenic
1113174323 13:107545189-107545211 TAAAGACAGATACATGCAGAGGG + Intronic
1113447777 13:110383549-110383571 TAAACCAAGATGCTAACAGGAGG + Intronic
1113729943 13:112634200-112634222 CAACCCCACATGCTTGCAGGTGG - Intergenic
1114416850 14:22550606-22550628 TAAACCCGGCCACTTTCAGGAGG - Intergenic
1114536311 14:23425171-23425193 CAAACACAGAGACCTGCAGGAGG - Intronic
1117182961 14:53211353-53211375 TAATCCCAGCTACTTTCAGGAGG + Intergenic
1118296779 14:64577357-64577379 TGCACCCAGACACTGGCAGGAGG - Intronic
1119006427 14:70934536-70934558 TAATCCCAGCTACTCACAGGAGG - Intronic
1120838457 14:89062088-89062110 TAAAACAAGAAATTTGCAGGAGG + Intergenic
1120930073 14:89839467-89839489 ACAGCCCAGATACTTACAGGAGG + Intronic
1121623950 14:95371258-95371280 TAAACCCGGATACGAGCAGCTGG - Intergenic
1121802736 14:96788441-96788463 TAGACCCAGAGACATGCAGAGGG - Intergenic
1122677042 14:103424086-103424108 TAATCCCAGCTACTTGGGGGAGG + Intronic
1123174996 14:106408523-106408545 TATTCCCAGATACTGGGAGGAGG + Intergenic
1202943686 14_KI270726v1_random:7258-7280 TATTCCCAGATACTGGGAGGAGG - Intergenic
1124202702 15:27692026-27692048 AAAACCCAGATAATTCCAGCTGG - Intergenic
1125480604 15:40077131-40077153 TAGTCCCAGATACTTGGCGGTGG + Intergenic
1125546852 15:40512249-40512271 CAACCCCAGATCCTTGCAGAGGG - Intergenic
1127045896 15:55025299-55025321 TAATCCCAGCTACTCGGAGGTGG + Intergenic
1127119673 15:55760326-55760348 TAATCCCAAAGACTTGGAGGTGG - Intergenic
1127811271 15:62567713-62567735 TAATCCCAGCTACTTGGGGGTGG + Intronic
1129247379 15:74287700-74287722 TAATCCCAGCTACTGGGAGGCGG + Intronic
1129764567 15:78153899-78153921 TAATCCCAGCTACTTTCAGGAGG + Intronic
1131140339 15:89972074-89972096 TAATCCCAGGTACTCTCAGGAGG - Intergenic
1133355717 16:5135227-5135249 GAAACTAAGATTCTTGCAGGTGG - Intergenic
1133950155 16:10384947-10384969 TAATCCCAGCTACTTGTTGGGGG + Intronic
1135800238 16:25487801-25487823 TAATCCCATATTCTTGGAGGTGG + Intergenic
1137603382 16:49771322-49771344 TAATCCCAGCTACTCTCAGGAGG - Intronic
1138211577 16:55167440-55167462 TAATCCCAGCTACTCCCAGGAGG + Intergenic
1138500267 16:57437643-57437665 TAACCCCAGCTACTTGGTGGGGG - Intronic
1141561792 16:84873356-84873378 TAATCCCAGCTACTCTCAGGAGG + Intronic
1142654862 17:1384825-1384847 TAATCCCAGCTACTCCCAGGAGG - Intronic
1143237775 17:5418018-5418040 TAATCCCAGCTACTCGCGGGGGG + Intronic
1145838604 17:27974723-27974745 TACACCAAGCTACTCGCAGGAGG - Intergenic
1145937172 17:28721230-28721252 TAATCCCAGCTACTCGCGGGAGG + Intronic
1148432799 17:47656132-47656154 TAATCCCAGCTACTTGCTGGGGG + Intronic
1148663498 17:49356305-49356327 TAATCCCAGCTACTTGGGGGAGG + Intronic
1148828308 17:50411370-50411392 TAATCCCAGCTACTTGGAGGTGG - Intergenic
1148960589 17:51389351-51389373 TAGACCCAGCTACTTGGAGGCGG + Intergenic
1150440356 17:65186333-65186355 TAATCCCAGTTACTTGGTGGGGG - Intronic
1151626913 17:75282428-75282450 TAATCCCAGCTACTGGGAGGCGG + Intronic
1151687370 17:75656194-75656216 TAATCCCAGCTACTTGGAAGAGG - Intronic
1157116077 18:44863974-44863996 TGAACCCAGATGCTTGCATCTGG - Intronic
1158077115 18:53543659-53543681 GAAACAAACATACTTGCAGGTGG + Intergenic
1158183730 18:54747629-54747651 TGAACTCATATACATGCAGGTGG - Intronic
1158721919 18:59932654-59932676 TAAACACACATCCTTCCAGGTGG - Intergenic
1159585257 18:70277814-70277836 TAATCCCAGCTACTTTCTGGAGG - Intergenic
1160907565 19:1458801-1458823 TAATCCCAGCTACTCGGAGGTGG - Intronic
1161271805 19:3393693-3393715 TAATCCCAGCTACTCTCAGGAGG + Intronic
1161764916 19:6201912-6201934 TAATCCCAGCTACTGGGAGGTGG + Intergenic
1162126986 19:8504962-8504984 TAATCCCAGCTACTTGAAGCCGG - Intergenic
1164394157 19:27849498-27849520 TTAAACCAGCTGCTTGCAGGTGG + Intergenic
1166056139 19:40290125-40290147 TAATCCCAGCTACTGGGAGGCGG + Intergenic
1166955532 19:46462112-46462134 TAGTCCCAGCTACTTGCAGAGGG + Intergenic
1167113407 19:47474993-47475015 TAGACCCAGATACAGGCCGGAGG - Intergenic
1167318356 19:48779859-48779881 TAACCCCAGTGACTTGCAAGGGG + Intergenic
1168485615 19:56759703-56759725 AAAACCCAGAGAGATGCAGGAGG - Intergenic
1168527633 19:57101381-57101403 TAATCCCAGCTACTTTCGGGAGG + Intergenic
929765410 2:44839944-44839966 TAAAGCCAGATTCGTGGAGGCGG - Intergenic
933012681 2:77088193-77088215 TAACCCCATATACTTCCAGGTGG + Intronic
935945648 2:108284031-108284053 TAGACCCAGAAACTTGCACAGGG + Intergenic
938848711 2:135238481-135238503 TAATCCCAGCTACTTTCGGGAGG - Intronic
938924156 2:136024061-136024083 TAATCCCAGCTACTTGGAGGCGG - Intergenic
940555319 2:155218725-155218747 TAAACTCAGCTACTTTCATGTGG - Intergenic
941866188 2:170337103-170337125 GAAAAACAGATACTTGTAGGAGG + Intronic
942481850 2:176396614-176396636 TAAACCAAGAAACTTGGTGGAGG - Intergenic
942637452 2:178023151-178023173 TCAACTCAGAAACTTGCAGATGG - Intronic
943006849 2:182395542-182395564 CAAATCCAGATAGTTGTAGGAGG - Intronic
944484668 2:200192474-200192496 TAAAGCCAGCAACTGGCAGGTGG + Intergenic
944535560 2:200705971-200705993 TAACCCCAGGTGCTTGCAGCTGG - Intergenic
944962143 2:204887323-204887345 TAAACAAAGATATATGCAGGTGG - Intronic
945058160 2:205885992-205886014 TAGAGTCAGATACTTGCCGGAGG - Intergenic
945943903 2:215975964-215975986 TAATCCCAGCTACTCGCGGGGGG + Intronic
947204965 2:227652127-227652149 TAAATGAAGATACTAGCAGGGGG - Intergenic
1169063319 20:2677353-2677375 TAATACCAGATACTAGCAGATGG - Intergenic
1169494288 20:6099281-6099303 TAATCCCAGCTACTTGGGGGAGG + Intronic
1170173908 20:13445794-13445816 TAAAGCCAGATAGTGGCAGAAGG + Intronic
1171467201 20:25338146-25338168 TAAGCCCAGATGCCTGCAGAGGG + Intronic
1172645152 20:36464438-36464460 TATTCCCAGCTACTTGGAGGAGG + Intronic
1172985728 20:38987360-38987382 TAATCCCAGCTACTCGCAGGAGG - Intronic
1175139090 20:56846572-56846594 CAAACCCAGATCTTTCCAGGAGG - Intergenic
1176063899 20:63184351-63184373 TAGACCCATATACTTCTAGGAGG + Intergenic
1176348746 21:5773414-5773436 AACACCCAGATATTTGCAGTGGG + Intergenic
1176355560 21:5893998-5894020 AACACCCAGATATTTGCAGTGGG + Intergenic
1176496081 21:7551041-7551063 AACACCCAGATATTTGCAGTGGG - Intergenic
1176543067 21:8171484-8171506 AACACCCAGATATTTGCAGTGGG + Intergenic
1176562018 21:8354529-8354551 AACACCCAGATATTTGCAGTGGG + Intergenic
1177427162 21:20938258-20938280 TAAACCCAGAAACTTGTATTTGG + Intergenic
1177577560 21:22977625-22977647 TACTCCCAGATACTTGGGGGTGG + Intergenic
1177936776 21:27358058-27358080 TAAAACGAGAAACTTACAGGGGG + Intergenic
1181260234 22:21592145-21592167 TAACCCCACATATTTGCAAGGGG + Intronic
1181300785 22:21879642-21879664 TAATCCCAGCTACTTGGAGGAGG + Intergenic
1182980354 22:34664978-34665000 TAATCCCAGCTACTTGGGGGAGG - Intergenic
1183565691 22:38613437-38613459 TGGACCTAGATCCTTGCAGGGGG - Intronic
1183902729 22:41018703-41018725 TAAACCCAGACTCCTTCAGGAGG - Intergenic
1183908135 22:41058332-41058354 TAATCCCAGCTCCTTGGAGGTGG - Intergenic
1184359777 22:44008229-44008251 TAATCCCAGCTACTCGGAGGCGG - Intronic
1184470628 22:44693747-44693769 TAGTCCCAGCTACTTGTAGGAGG - Intronic
1185084275 22:48730262-48730284 TAGTCCCAGCTACTTTCAGGAGG + Intronic
1203247938 22_KI270733v1_random:87722-87744 AACACCCAGATATTTGCAGTGGG + Intergenic
949412722 3:3783395-3783417 CAAACCCAGATGTCTGCAGGGGG - Intronic
953938011 3:47063353-47063375 TAGTCCCAGCTACTTGCAAGAGG + Intronic
954179672 3:48871933-48871955 TAGTCCCAGCTACTTGCGGGTGG - Intronic
954282985 3:49597447-49597469 TAGTCCCAGCTACTGGCAGGTGG - Intronic
955176753 3:56622742-56622764 TAAAATCAGATGCTTGCAGGAGG - Exonic
956283098 3:67579560-67579582 CAAACCAAGAAACTTGCAGAGGG + Intronic
956506219 3:69943154-69943176 TAATCCCAGCTACTTGAGGGAGG - Intronic
956720315 3:72111619-72111641 TTAAACCATATAGTTGCAGGCGG - Intergenic
957060397 3:75476654-75476676 GAAACTAAGATTCTTGCAGGTGG - Intergenic
957431283 3:80111437-80111459 TAAGACCAGCTACTTGCAGCTGG + Intergenic
959023138 3:101211132-101211154 TAATCCCAGCTACTTGCAGTGGG + Intergenic
959361090 3:105392609-105392631 CAAACCCAGAAACTAGCAGAAGG - Intronic
959984604 3:112558856-112558878 TAATCCCAGCTACAGGCAGGAGG - Intronic
960956727 3:123037423-123037445 TCAACCCAAATACTCGCTGGAGG + Intergenic
961792254 3:129384686-129384708 TAAACACAGATTCTTGGAGAAGG - Intergenic
964530680 3:157664288-157664310 TCCACCCAGATGCTTTCAGGGGG + Intronic
965658403 3:171015348-171015370 TAGTCCCAGCTACTTGGAGGGGG + Intronic
967312739 3:188121497-188121519 TAATCCCAGCTACTTGTGGGAGG - Intergenic
968298216 3:197593476-197593498 TAATCCCAGCTACTTGGGGGAGG + Intergenic
969004284 4:4006730-4006752 GAAACTAAGATTCTTGCAGGTGG - Intergenic
969809618 4:9637984-9638006 GAAACTAAGATTCTTGCAGGTGG + Intergenic
969927095 4:10594972-10594994 TAATCCCAGCTACTGGCTGGGGG + Intronic
971189466 4:24413595-24413617 TTAACCCAGATCCTTGTGGGGGG + Intergenic
972987374 4:44780774-44780796 TAGTCCCAGCTACTAGCAGGGGG - Intergenic
978062533 4:104355233-104355255 TAATCCCAGCTACTCGGAGGTGG + Intergenic
979191826 4:117870655-117870677 TATAAACAGATACTTGCAGATGG + Intergenic
980227427 4:130004653-130004675 TAGTCCCAGCTACTTGGAGGGGG + Intergenic
980336805 4:131485511-131485533 TAAACCCACATACCAGTAGGAGG + Intergenic
986525459 5:8669468-8669490 TAGAACCAGATAGTTGAAGGTGG - Intergenic
988960824 5:36369747-36369769 TAAAGATAGAGACTTGCAGGTGG - Intergenic
990319013 5:54611640-54611662 TAACCCCAGATATTTCCAAGAGG + Intergenic
991726219 5:69538425-69538447 TAATCCCAGCTACTAGGAGGAGG - Intronic
991868738 5:71089449-71089471 TAATCCCAGCTACTAGGAGGAGG + Intergenic
995502314 5:112820981-112821003 TAGTCCCAGATACTCTCAGGAGG - Intronic
995861789 5:116648555-116648577 TAATCCCAGCTACTTTCAGGAGG - Intergenic
996486873 5:124046034-124046056 TAAACACAAAGACTTGCAGCAGG + Intergenic
997290331 5:132728324-132728346 TAATCCCAGCTATTTACAGGTGG - Intronic
997493007 5:134295134-134295156 TAATCCCAGCTACTTGGGGGAGG - Intronic
998318169 5:141202729-141202751 TAGTCCCAGCTACTTGGAGGCGG - Exonic
998360806 5:141585074-141585096 TAATCCCAGCTACTGCCAGGAGG - Intronic
998566628 5:143221640-143221662 TAGTCCCAGCTACTTGGAGGAGG - Intronic
999657552 5:153825531-153825553 TGAACCCAGTTACCTGAAGGAGG - Intergenic
1000989044 5:167893118-167893140 CAAACCCAGTTACTTACAGGAGG - Intronic
1002493048 5:179593195-179593217 TAATCCCAGCTACTCTCAGGAGG - Intronic
1003459649 6:6318398-6318420 TAAAACCAGAGATTGGCAGGGGG + Intronic
1003996848 6:11550289-11550311 TAATCCCAGCTACTTGGGGGCGG - Intronic
1004365336 6:15008146-15008168 TAATCCCAGCTACTTGGAGGCGG - Intergenic
1006383466 6:33715037-33715059 TAATCACAGCTACTTGGAGGCGG + Intergenic
1006494688 6:34413867-34413889 TAATCCCAGCTACTCGGAGGCGG - Intronic
1007354764 6:41306116-41306138 TAATCCCAGCTACTCACAGGAGG - Intergenic
1007648520 6:43401249-43401271 TAATCCCAGCTACTTCCGGGAGG + Intergenic
1007995317 6:46301770-46301792 TAAAGGCAGATAATTCCAGGAGG + Intronic
1008029303 6:46675334-46675356 TAAACCAATATACTTGGAGTTGG - Intronic
1008884116 6:56412730-56412752 TAAAACCAGAGACTGGTAGGAGG + Intergenic
1011652172 6:89516594-89516616 TAAACCCAGATACTTGCAGGAGG - Intronic
1014832202 6:126115954-126115976 AAAACCCAGAATCTTGGAGGGGG - Intergenic
1015934331 6:138393251-138393273 GAAACCCAGATTCTTACATGTGG + Intergenic
1017469505 6:154725563-154725585 TAATCCCAGCTACTTACAGCTGG + Intergenic
1017624610 6:156335893-156335915 TAAAATAAGATACTTGGAGGAGG + Intergenic
1017790312 6:157792258-157792280 TAGTCCCAGCTACTTGGAGGCGG - Intronic
1020324417 7:6963231-6963253 GAAACTAAGATTCTTGCAGGTGG - Intergenic
1020566119 7:9797902-9797924 TAATCCCAGCTACTTGGGGGAGG - Intergenic
1023038149 7:36151029-36151051 GAAACCCAGAGACTTGAATGTGG - Intergenic
1024089448 7:45923005-45923027 TCAACGCAGATACTAGAAGGAGG - Intergenic
1024323971 7:48094333-48094355 TAATCCCAGCTACTCTCAGGAGG - Intronic
1024931699 7:54671200-54671222 AAAACTCAGATACTTTCTGGAGG - Intergenic
1026556592 7:71413818-71413840 TAAACCCTGATCATTGGAGGTGG + Intronic
1026824338 7:73571939-73571961 TAATCCCAGCTACTTGGGGGAGG + Intronic
1026921735 7:74160647-74160669 TAGACCCAGCTACTCGCGGGGGG + Intergenic
1027125342 7:75553055-75553077 TAATCCCAGGTACTGGGAGGTGG - Intronic
1029859482 7:103554216-103554238 CAAACCCATATACTTTCTGGGGG + Intronic
1033049063 7:137987803-137987825 TAGTCCCAGCTACTTGCAGGAGG - Intronic
1035201304 7:157268523-157268545 TATACCCAGTTACTTGGGGGAGG + Exonic
1036371649 8:8167721-8167743 GAAACTAAGATTCTTGCAGGTGG + Intergenic
1036879254 8:12497923-12497945 GAAACTAAGATTCTTGCAGGTGG - Intergenic
1037499976 8:19476358-19476380 TAATCCCAGCTACTTGGGGGAGG - Intronic
1038731466 8:30131797-30131819 TATACCCAGTGACTTGCAGTAGG - Intronic
1038781164 8:30569290-30569312 AAACCCCAGTCACTTGCAGGTGG - Intronic
1039556223 8:38477201-38477223 TAATCCCAGCTACTCTCAGGAGG - Intergenic
1043522358 8:81059894-81059916 TAATCCCAGCTACTTGTGGGGGG + Intronic
1047058686 8:121197301-121197323 TAAACCCAGATTCTTGTATTTGG - Intergenic
1049584012 8:143424688-143424710 TACACCCAGACACATGCATGTGG - Intronic
1049776365 8:144407565-144407587 TAATCCCAGCTACTTGGTGGAGG + Intronic
1049995608 9:1031158-1031180 TAATCCCAGCTACTTGGAGGGGG + Intergenic
1052950143 9:34202249-34202271 TAATCCCAGCTACTCGGAGGTGG - Intronic
1053034429 9:34812114-34812136 TAATCCCAGCTACTTGGCGGTGG + Intergenic
1057003480 9:91534353-91534375 TAAACACACACACTTCCAGGGGG + Intergenic
1058278344 9:103077026-103077048 TAATCCCAGCTACTTGGAGCAGG - Intergenic
1059925621 9:119206294-119206316 TAATCCCAGCTACTCGCAAGGGG + Intronic
1060660573 9:125402849-125402871 TAATCCCAGCTACTGCCAGGAGG - Intergenic
1061695953 9:132373647-132373669 TAATCCCAGCTACTCTCAGGAGG + Intergenic
1062660337 9:137627827-137627849 TAATCCCAGCTACTTGGGGGTGG - Intronic
1203464337 Un_GL000220v1:70953-70975 AACACCCAGATATTTGCAGTGGG + Intergenic
1186560363 X:10605768-10605790 TAAACTCATATACTTCCAAGAGG + Intronic
1186981808 X:14964870-14964892 AAAACCCAGATTCTCACAGGGGG + Intergenic
1189201042 X:39195768-39195790 TAAAACCAGACATTTGGAGGTGG + Intergenic
1189966956 X:46383223-46383245 TAATCCTAGCTACTTGCAGAAGG + Intergenic
1190164944 X:48065531-48065553 TAATCCCAGCTACTTGGTGGCGG + Intronic
1190832687 X:54073549-54073571 TAATCCCAGCTACTCTCAGGAGG - Intronic
1193927702 X:87508806-87508828 TAATCCCAGCTACTCGGAGGGGG + Intergenic
1198825334 X:140692702-140692724 TAAACCAAGAAACTTACATGTGG - Intergenic
1199891880 X:152092667-152092689 TAATCCCAGCTACTCGCAGAGGG + Intergenic