ID: 1011652173

View in Genome Browser
Species Human (GRCh38)
Location 6:89516597-89516619
Sequence CTGTAAACCCAGATACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6975
Summary {0: 1, 1: 1, 2: 73, 3: 1538, 4: 5362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011652173_1011652179 25 Left 1011652173 6:89516597-89516619 CCTGCAAGTATCTGGGTTTACAG 0: 1
1: 1
2: 73
3: 1538
4: 5362
Right 1011652179 6:89516645-89516667 ATTTGTATTTTTAGTAGAGACGG 0: 1194
1: 199808
2: 143919
3: 66988
4: 40675
1011652173_1011652180 26 Left 1011652173 6:89516597-89516619 CCTGCAAGTATCTGGGTTTACAG 0: 1
1: 1
2: 73
3: 1538
4: 5362
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1011652173_1011652181 27 Left 1011652173 6:89516597-89516619 CCTGCAAGTATCTGGGTTTACAG 0: 1
1: 1
2: 73
3: 1538
4: 5362
Right 1011652181 6:89516647-89516669 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011652173 Original CRISPR CTGTAAACCCAGATACTTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr