ID: 1011652176

View in Genome Browser
Species Human (GRCh38)
Location 6:89516630-89516652
Sequence ATACAAATATTAGCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225803
Summary {0: 7, 1: 1086, 2: 37414, 3: 77522, 4: 109774}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011652176_1011652179 -8 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652179 6:89516645-89516667 ATTTGTATTTTTAGTAGAGACGG 0: 1194
1: 199808
2: 143919
3: 66988
4: 40675
1011652176_1011652180 -7 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1011652176_1011652182 8 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652182 6:89516661-89516683 GAGACGGGGTTTTGCCGTGTTGG 0: 134
1: 4379
2: 23373
3: 81370
4: 161412
1011652176_1011652183 13 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652183 6:89516666-89516688 GGGGTTTTGCCGTGTTGGCCAGG 0: 274
1: 9755
2: 35463
3: 150425
4: 242528
1011652176_1011652181 -6 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652181 6:89516647-89516669 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
1011652176_1011652184 17 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652184 6:89516670-89516692 TTTTGCCGTGTTGGCCAGGCTGG 0: 478
1: 15411
2: 44568
3: 154032
4: 279178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011652176 Original CRISPR ATACAAATATTAGCTGGGAG TGG (reversed) Intronic
Too many off-targets to display for this crispr