ID: 1011652180

View in Genome Browser
Species Human (GRCh38)
Location 6:89516646-89516668
Sequence TTTGTATTTTTAGTAGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628644
Summary {0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011652173_1011652180 26 Left 1011652173 6:89516597-89516619 CCTGCAAGTATCTGGGTTTACAG 0: 1
1: 1
2: 73
3: 1538
4: 5362
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1011652175_1011652180 -4 Left 1011652175 6:89516627-89516649 CCACCACTCCCAGCTAATATTTG 0: 7
1: 1099
2: 38358
3: 103346
4: 177258
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1011652172_1011652180 29 Left 1011652172 6:89516594-89516616 CCTCCTGCAAGTATCTGGGTTTA 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1011652176_1011652180 -7 Left 1011652176 6:89516630-89516652 CCACTCCCAGCTAATATTTGTAT 0: 7
1: 1086
2: 37414
3: 77522
4: 109774
Right 1011652180 6:89516646-89516668 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011652180 Original CRISPR TTTGTATTTTTAGTAGAGAC GGG Intronic
Too many off-targets to display for this crispr