ID: 1011654500

View in Genome Browser
Species Human (GRCh38)
Location 6:89537819-89537841
Sequence CGTTTGTAACCTCTACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011654500 Original CRISPR CGTTTGTAACCTCTACCTTC TGG (reversed) Intronic
901561687 1:10076819-10076841 TCTCTGTAACCTCCACCTTCTGG + Intronic
902755487 1:18546605-18546627 CATTTGCAACCTCCACCTCCCGG - Intergenic
903871233 1:26436323-26436345 CATTTGCAACCTCCACCTTTCGG - Intronic
905859404 1:41339711-41339733 CGTAATTAACCTCTACCTCCTGG + Intergenic
906619480 1:47263825-47263847 TGACTGTAACCTCTGCCTTCTGG + Intronic
908050398 1:60223467-60223489 GTTTTGTAACCGGTACCTTCTGG - Intergenic
911978753 1:104538359-104538381 TCATTGTAACCTCCACCTTCCGG - Intergenic
912352193 1:109024915-109024937 TGTATGTAACTTCTAACTTCTGG - Intronic
916035384 1:160917837-160917859 CTTTTTTAACCTCTAACTTTGGG - Intergenic
917223835 1:172760734-172760756 CATTTGCAAGTTCTACCTTCAGG - Intergenic
918019171 1:180668201-180668223 CAATTGCAACCTCCACCTTCTGG + Intronic
918457744 1:184741572-184741594 GGTTTATAACATCTACATTCTGG + Intronic
919328747 1:196142097-196142119 ATTTTGTAACCTCTATTTTCTGG + Intergenic
919377321 1:196809967-196809989 CGTTTGGAGCTTCTTCCTTCTGG - Intergenic
920217675 1:204372981-204373003 CATTTGTAGCCTCAAACTTCTGG + Intronic
920408109 1:205734818-205734840 CCACTGTAACCTCCACCTTCCGG - Intronic
921580442 1:216890188-216890210 TGATTGTAGCCTCAACCTTCTGG - Intronic
922281158 1:224125714-224125736 CCACTGTAACCTCCACCTTCCGG + Intronic
922553269 1:226513065-226513087 AGATTTTAACATCTACCTTCTGG + Intergenic
923255027 1:232214446-232214468 TGTTTGTGCCCTCTACCTACAGG - Intergenic
1064548499 10:16475201-16475223 TGTTTGTAACCTCTGGCTTAGGG - Intronic
1065307035 10:24379041-24379063 CATTTATAACCTCTGCCTTTTGG - Intronic
1067880181 10:50036184-50036206 TCATTGTAACCTCTGCCTTCTGG - Intergenic
1069810063 10:71152317-71152339 AGTCTGCAAGCTCTACCTTCTGG - Intergenic
1071221737 10:83475019-83475041 CCTTTGTACACTGTACCTTCAGG - Intergenic
1071673005 10:87628320-87628342 TGTTTTTGACCTCTAACTTCAGG + Intergenic
1074030080 10:109678257-109678279 TGTTTGTGACCTTGACCTTCTGG - Intergenic
1075336023 10:121609339-121609361 TTTTTTTAACCTCTACCTCCCGG + Intergenic
1075763330 10:124873226-124873248 CCTCTGTAACCTCTGCCTCCTGG + Intergenic
1077617374 11:3687002-3687024 CAATTGTAACCTCAACCTCCTGG + Intronic
1077932077 11:6744075-6744097 TGGCTGCAACCTCTACCTTCTGG + Intergenic
1078893228 11:15576332-15576354 CGACTGTAACCTCTGCCTCCTGG - Intergenic
1079801056 11:24869529-24869551 TCATTGTAACCTCTGCCTTCGGG + Intronic
1080182319 11:29440122-29440144 TCATTGTAACCTCTGCCTTCTGG - Intergenic
1080362528 11:31532844-31532866 TCATTGTAACCTCTGCCTTCCGG + Intronic
1080478675 11:32623081-32623103 TCATTGTAACCTCTGCCTTCCGG + Intronic
1081859523 11:46324751-46324773 CGTCTCTGGCCTCTACCTTCTGG - Intergenic
1084467203 11:69332150-69332172 TCACTGTAACCTCTACCTTCTGG + Intronic
1085273300 11:75283079-75283101 GGTTTGTCACCTGTACCTTTGGG - Intronic
1086468350 11:87078686-87078708 CTTTTGCAACCTCCACCTCCTGG + Intronic
1091827183 12:3521497-3521519 TGACTGCAACCTCTACCTTCCGG - Intronic
1094222791 12:28012539-28012561 CATTTGTATCCTCTAACTTTTGG + Intergenic
1095319651 12:40810926-40810948 TGATTGTAACCTCAAACTTCTGG - Intronic
1095434837 12:42176169-42176191 CACTTGCAACCTCTGCCTTCTGG - Intronic
1096125274 12:49114732-49114754 CTCTTGTAACCTCTGCCTCCTGG + Intergenic
1097861120 12:64519593-64519615 TGTATGTAAACTCTACCTTAAGG + Intergenic
1100668221 12:96779030-96779052 TCATTGCAACCTCTACCTTCTGG - Intronic
1100955824 12:99906994-99907016 TGTGTGTAAGCTCTGCCTTCAGG - Intronic
1102009395 12:109608766-109608788 AGTTTATAACCTCTACCCTGTGG + Intergenic
1102119076 12:110426908-110426930 TCATTGTAACCTCCACCTTCTGG + Intergenic
1102158208 12:110747253-110747275 CTCATGTAACCTCTACCTCCCGG + Intergenic
1102760463 12:115380563-115380585 GGTTTGTAACCTCTAACATCTGG + Intergenic
1104831433 12:131754706-131754728 TGACTGTAACCTCTACCTCCTGG + Intronic
1106038877 13:26070702-26070724 CCATTGCAACCTCTGCCTTCTGG + Intergenic
1108002643 13:45918583-45918605 AGTTTTTAACCTCTATCATCGGG - Intergenic
1108007534 13:45965496-45965518 TGTGTGTACCCTCTACCTTTTGG - Intronic
1108211394 13:48143144-48143166 ACTTTTTAACCTCTACCTGCAGG - Intergenic
1112406155 13:99122660-99122682 CCACTGTAGCCTCTACCTTCTGG + Intergenic
1112847817 13:103665702-103665724 CGATTGTAGCCTCGACCTCCTGG - Intergenic
1114028036 14:18547000-18547022 TGACTGTAACTTCTACCTTCTGG + Intergenic
1115368625 14:32586550-32586572 CCTCTGCAACCTCTGCCTTCCGG - Intronic
1115560035 14:34574573-34574595 CAACTGTAACCTCTTCCTTCTGG - Intronic
1116081665 14:40181645-40181667 CCTCTGTAACCTCAAACTTCTGG + Intergenic
1122532628 14:102439516-102439538 CGTTGGTATCATTTACCTTCAGG + Intronic
1122535584 14:102459691-102459713 TCTTTGTAACCTCCACCTCCCGG - Intronic
1202840520 14_GL000009v2_random:116852-116874 CTTTTCTGACCTCTACCTTTGGG + Intergenic
1125871081 15:43102489-43102511 TGTTTATAACCTCTACCTAGGGG - Intronic
1131950438 15:97675525-97675547 CTTTTGTGACCCCTACCTCCAGG - Intergenic
1132723733 16:1329909-1329931 CGGCTGTAACCTCTGCCTCCTGG - Intergenic
1133603302 16:7361054-7361076 TGTTTGTAAACTCTGCCTGCTGG + Intronic
1135015469 16:18921060-18921082 CACTTGTAACCTCCACCTCCTGG - Intronic
1136346965 16:29682102-29682124 TGTTTGTAGCCTCCAACTTCTGG + Intronic
1137427903 16:48395238-48395260 CCATTGTAACCTCTGCCTCCAGG + Intronic
1139929645 16:70515607-70515629 CGTGTGCAACCTCCACCTCCTGG - Intronic
1140781606 16:78302033-78302055 TGATTGTAACCTCCACCTCCCGG + Intronic
1142724129 17:1799442-1799464 CATTTGCAACCTCCACCTCCCGG + Intronic
1143703141 17:8676359-8676381 TCATTGCAACCTCTACCTTCTGG + Intergenic
1143793338 17:9315937-9315959 CACTTGCAACCTCTACCTCCCGG - Intronic
1143816359 17:9518791-9518813 CCACTGTAACCTCTGCCTTCCGG - Intronic
1144666053 17:17102932-17102954 CGTTTGTAACCACTTCTGTCTGG + Intronic
1146337657 17:31988995-31989017 CGGCTGCAACCTCCACCTTCTGG - Intronic
1146963383 17:37004028-37004050 AGTCTGCAACCTCTACCTCCTGG - Intronic
1149606728 17:57930366-57930388 TGTTTGTAAGGGCTACCTTCTGG - Intronic
1149801331 17:59570756-59570778 TCTCTGTAGCCTCTACCTTCTGG + Intronic
1149882429 17:60306561-60306583 TCATTGTAACCTCTGCCTTCCGG - Intronic
1151637167 17:75358021-75358043 CGTCTGCAACCTCCACCTCCCGG - Intronic
1151873839 17:76855028-76855050 TTATTGCAACCTCTACCTTCTGG + Intergenic
1152776008 17:82202391-82202413 GGTGTGCAACCTCTACCTCCTGG - Intronic
1153117359 18:1675869-1675891 CCACTGTAACCTCCACCTTCTGG + Intergenic
1154999750 18:21674788-21674810 AGTTTCAAACTTCTACCTTCAGG - Intronic
1156311563 18:35927071-35927093 TGTTTGTAACATATACCCTCTGG + Intergenic
1156773878 18:40763761-40763783 CATTTGTAAGCTCTACGGTCAGG + Intergenic
1158486041 18:57866868-57866890 CTTATGTAACCTCTGCCTCCCGG + Intergenic
1162656644 19:12136299-12136321 CCACTGTAACCTCTACCTCCTGG - Intronic
1163129069 19:15260742-15260764 CCTTGGTAAACTCTACATTCAGG + Intronic
1163668909 19:18616352-18616374 CGTTTGTAACCTAGAGCCTCTGG - Intronic
925728471 2:6897920-6897942 GCTCTGTAACCTCTGCCTTCAGG - Exonic
926193553 2:10746072-10746094 AGTTTGTGACCTCCACCTCCTGG + Intronic
926531503 2:14051892-14051914 TGATTGCAACCTCTACCTCCCGG - Intergenic
927750535 2:25665549-25665571 TCATTGTAACCTCTACCTCCTGG - Intronic
927856240 2:26529705-26529727 CCTTTGTGACATCTCCCTTCAGG + Intronic
929921468 2:46174762-46174784 CTCTTGCAACCTCTACCTCCTGG + Intronic
931945222 2:67298909-67298931 TGTCTGTAACCTCTGCCTCCTGG - Intergenic
932744240 2:74318609-74318631 GGTCTGCAACCTCTGCCTTCTGG - Intronic
933068015 2:77822563-77822585 CATTTATAATCTCTACATTCAGG + Intergenic
935044052 2:99463442-99463464 CGTTTGCAACCTCCACCTTCTGG - Intronic
935522626 2:104126538-104126560 CCTTTATAACTTCTACCCTCTGG - Intergenic
936554205 2:113478963-113478985 CGTTTTTCACCTGTAGCTTCTGG + Intronic
939105948 2:137949002-137949024 CGTTTATAACCTGTACCTGTCGG + Intergenic
940439643 2:153699144-153699166 TTTTTGCAACCTCTACCTCCTGG - Intergenic
941956983 2:171215013-171215035 CCATTGTAACCTCTAACTCCTGG + Intronic
943586788 2:189750046-189750068 TGCATGCAACCTCTACCTTCTGG - Intronic
944869231 2:203893174-203893196 TCATTGTAACCTCTACCTTCTGG + Intergenic
945420827 2:209634006-209634028 CTTTTGTAACATCTGCTTTCTGG - Intronic
947417710 2:229915175-229915197 CACTTGTAACCTCTGCCTCCCGG - Intronic
947764584 2:232629178-232629200 TGTTTGAAGCCGCTACCTTCAGG + Intronic
1169339487 20:4785586-4785608 CCTTTGTAACATTTATCTTCTGG - Intronic
1169353692 20:4890575-4890597 CACTTGCAACCTCCACCTTCCGG - Intronic
1170508610 20:17054549-17054571 CTACTGAAACCTCTACCTTCTGG - Intergenic
1172351834 20:34249052-34249074 TCATTGTAACCTCTGCCTTCAGG - Intronic
1173636814 20:44566769-44566791 TCACTGTAACCTCTACCTTCTGG - Intronic
1175117963 20:56696679-56696701 CACTTATAACCTCTGCCTTCTGG + Intergenic
1177803849 21:25855002-25855024 GCTTTGTAACCTCTGCCTCCTGG + Intergenic
1177994631 21:28081917-28081939 CTTTTCCAACCTCTACCTCCTGG + Intergenic
1178136254 21:29630872-29630894 TGTTTGCAACCTCTGCCTCCCGG + Intronic
1179652352 21:42819774-42819796 TCTCTGTAACCTCTACTTTCTGG - Intergenic
1180452161 22:15474053-15474075 TGACTGTAACTTCTACCTTCTGG + Intergenic
1181380368 22:22497454-22497476 CCTTTGTAACCTCCGCCTCCCGG - Intronic
1182979905 22:34659110-34659132 TCACTGTAACCTCTACCTTCTGG - Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
950257601 3:11518470-11518492 CCACTGCAACCTCTACCTTCTGG - Intronic
950727799 3:14928668-14928690 CCACTGTAACCTCTACCTCCCGG - Intronic
951999202 3:28766242-28766264 CTTTAGGAACATCTACCTTCTGG - Intergenic
953728598 3:45424901-45424923 CCTTTTTATTCTCTACCTTCTGG + Intronic
954082701 3:48221874-48221896 CATTTCAACCCTCTACCTTCAGG - Intergenic
954162410 3:48732294-48732316 TCATTGTAACCTCTACCTCCTGG - Intronic
956129598 3:66040495-66040517 TGATTGTAACCTCGAACTTCTGG + Intergenic
958156264 3:89760009-89760031 TCATTGTAACCTCCACCTTCTGG - Intergenic
959755198 3:109888959-109888981 AGTTTATAACCTCCACCTTGTGG + Intergenic
962530682 3:136277358-136277380 CTTTTGTAAACGCTACCTCCAGG - Intronic
968201011 3:196755531-196755553 CCTCTGTAACCTCTACTTCCCGG + Intronic
969628061 4:8317940-8317962 CCTCTGCAACCTCTGCCTTCTGG - Intergenic
972696512 4:41451761-41451783 CAGTTAAAACCTCTACCTTCGGG + Intronic
974341796 4:60623326-60623348 TCTTTGTAACCTCTAACTCCTGG - Intergenic
974594633 4:63999718-63999740 AGTTTGAAACCTCTACCATTTGG + Intergenic
975156684 4:71080236-71080258 CGTGGGTAGTCTCTACCTTCCGG - Intergenic
978530221 4:109704777-109704799 CTTTTGCAACCTCTGCCTCCTGG + Intergenic
978658131 4:111091046-111091068 CCATTGCAACCTCTACCTCCCGG - Intergenic
981318891 4:143369012-143369034 TCATTGCAACCTCTACCTTCTGG + Intronic
985337230 4:188909635-188909657 CAGCTGTAACCTCTACCTTTTGG - Intergenic
987478343 5:18420598-18420620 CTTTTGTAAGCTTTACCTCCAGG + Intergenic
994244540 5:97465038-97465060 CTTTTCTAACCTCTAACTTTTGG - Intergenic
994325279 5:98439499-98439521 CTTTTGTAACCTCTTCCATACGG + Intergenic
995958921 5:117815532-117815554 CGTCTGTAGCCTCCACCTCCTGG + Intergenic
997081921 5:130749387-130749409 TCACTGTAACCTCTACCTTCTGG + Intergenic
998392755 5:141797928-141797950 CCTCTGCAACCTCTACCTCCTGG + Intergenic
999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG + Intergenic
1004113891 6:12748800-12748822 CTTTTCTAACCACTAACTTCTGG - Intronic
1005466206 6:26116623-26116645 TCATTGTAACCTCCACCTTCTGG - Intronic
1006854160 6:37121150-37121172 CCACTGCAACCTCTACCTTCCGG - Intergenic
1010661266 6:78573002-78573024 TCATTGTAACCTCTACCTCCTGG - Intergenic
1011341725 6:86323122-86323144 CCTTTGTGACCTCTAACTTTGGG + Intergenic
1011654500 6:89537819-89537841 CGTTTGTAACCTCTACCTTCTGG - Intronic
1014253769 6:119141330-119141352 AGTTTGTCACTTCTTCCTTCTGG + Intronic
1015381649 6:132576939-132576961 TGCTTGTAACCACTACCTTTTGG - Intergenic
1016128606 6:140437143-140437165 CTATTGTAACCTCAAACTTCTGG + Intergenic
1017191133 6:151653888-151653910 CCATTGCAACCTCTACCTCCTGG + Intergenic
1017421953 6:154281927-154281949 TCATTGCAACCTCTACCTTCTGG - Intronic
1021601843 7:22372224-22372246 CTCTTGTAGCCTCTACCTGCAGG - Intergenic
1022063826 7:26829466-26829488 CCTCTGTAGCCTCTACCTCCTGG - Intronic
1022087001 7:27078098-27078120 TGTCTGCAACCTCTACCTCCCGG - Intergenic
1023877555 7:44295601-44295623 CTTTTGTAAGTTCTACCTCCAGG + Intronic
1027582410 7:80015550-80015572 TTACTGTAACCTCTACCTTCTGG + Intergenic
1028479329 7:91287434-91287456 TGTTTGTAAACTTTACCTCCAGG - Intergenic
1029714145 7:102316942-102316964 TGACTGTAACCTCTGCCTTCCGG - Intronic
1030043757 7:105476047-105476069 CCATTGCAACCTCCACCTTCTGG - Intronic
1031831880 7:126637885-126637907 TATTTGTATCATCTACCTTCAGG - Intronic
1034173323 7:149080095-149080117 TGACTGTAACCTCTGCCTTCCGG - Intronic
1035897615 8:3421852-3421874 GGTTTCTAACTTCTAACTTCAGG + Intronic
1036577633 8:10043075-10043097 TGTCTGCAACCTCCACCTTCTGG - Intergenic
1042140359 8:65672583-65672605 TCATTGTAACCTCTGCCTTCTGG + Intronic
1043109978 8:76168961-76168983 TCACTGTAACCTCTACCTTCCGG + Intergenic
1045473343 8:102532633-102532655 TCACTGTAACCTCTACCTTCTGG + Intronic
1048956473 8:139541248-139541270 AGTTTGTAACCTCTGCATTGAGG - Intergenic
1049512337 8:143035312-143035334 GCTCTGCAACCTCTACCTTCAGG + Intergenic
1049703183 8:144024171-144024193 CGTTAGGACCCTCTCCCTTCAGG + Intronic
1050379338 9:5010393-5010415 CCGTTGCAACCTCTGCCTTCGGG + Intronic
1051202523 9:14643375-14643397 AGTTAGTAACCTTTACCTTTAGG - Intronic
1053117235 9:35516123-35516145 CATTTGTTTCCTCTAGCTTCTGG + Intronic
1053586057 9:39460074-39460096 TCATTGTAACCTCCACCTTCTGG - Intergenic
1055374804 9:75637197-75637219 TGTTTGTCACCTCTTCCTTTGGG + Intergenic
1055983783 9:82034747-82034769 CATTTGTAAGCTTTAACTTCAGG + Intergenic
1056385718 9:86095301-86095323 TGTCTGTAACCTCTGCCTCCTGG + Intronic
1057136407 9:92691729-92691751 GCTTTGTAAGCTTTACCTTCAGG - Intergenic
1058618146 9:106857626-106857648 TGACTGTAACCTCTACCTCCCGG - Intergenic
1061975304 9:134065347-134065369 CCACTGTAACCTCTACCTCCCGG - Intronic
1185660610 X:1725947-1725969 TCTTTGCAACCTCTGCCTTCCGG + Intergenic
1195534697 X:105997966-105997988 TCATTGTAACCTCTGCCTTCTGG - Intergenic
1197734209 X:129838592-129838614 CTTTTGCAACCTCTGCCTCCCGG - Intronic
1198745583 X:139887367-139887389 CGTTTGTAATCTCAGCCCTCTGG + Intronic
1199890114 X:152070882-152070904 CGTATGCAACCTCTGCCTCCTGG + Intergenic
1199946287 X:152670796-152670818 GGATTCTAATCTCTACCTTCTGG + Intergenic
1200285007 X:154812497-154812519 TGTTTCTAGCCTCTCCCTTCTGG - Intronic
1201126235 Y:10917296-10917318 CTTTTCTAGCCTCTACCTACAGG + Intergenic
1202625336 Y:56851338-56851360 CTTTTATAATCTCTACCTACAGG + Intergenic