ID: 1011656409

View in Genome Browser
Species Human (GRCh38)
Location 6:89555891-89555913
Sequence CACATAAATCAAGGCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011656409 Original CRISPR CACATAAATCAAGGCGGGGG AGG Intronic
901635854 1:10669811-10669833 CACATTACTCACGGCTGGGGAGG - Intronic
903119672 1:21207363-21207385 CACTTAAATCCAGGAGGTGGAGG - Intergenic
903543943 1:24111998-24112020 CCCAGAAATCAGGGTGGGGGAGG - Intronic
903739161 1:25548429-25548451 CACTTAAACCAAGGAGGTGGAGG - Intronic
907376929 1:54052107-54052129 CTCATAAAACAACGTGGGGGAGG + Intronic
907783547 1:57589671-57589693 CACTTGAATCCAGGAGGGGGAGG + Intronic
909133893 1:71772318-71772340 CACTTAAATCCAGGAGGTGGAGG + Intronic
910572698 1:88723411-88723433 CAAATAAATAAAAGGGGGGGGGG - Intronic
915134528 1:153721420-153721442 CAGAAAAAAAAAGGCGGGGGGGG - Intergenic
916541526 1:165760345-165760367 CACTTGAATCCAGGCGGTGGAGG + Intronic
917212861 1:172647634-172647656 CACTTAAATCCAGGAGGCGGAGG - Intergenic
919170592 1:193948990-193949012 AACAGAAATAATGGCGGGGGGGG + Intergenic
920496178 1:206456480-206456502 CTCAGAAACCAAGGCGGGGTTGG + Intronic
923711485 1:236391028-236391050 CACTTAAACCCAGGAGGGGGAGG - Intronic
924722088 1:246633363-246633385 CACTTGAATCCAGGAGGGGGAGG + Intronic
1064352672 10:14590903-14590925 CACATGAATCCAGGAGGCGGAGG + Intronic
1066400068 10:35067658-35067680 CACTTAAACCCAGGAGGGGGAGG + Intronic
1067049462 10:43004187-43004209 TAAATAAATCAATGTGGGGGAGG - Intergenic
1069924966 10:71843086-71843108 CAAATAAAGCAAGGTGGGGTGGG + Intronic
1070190303 10:74106002-74106024 CACTTGAATCCAGGCGGGGGCGG - Intronic
1073352848 10:102832155-102832177 CACTTGAACCAAGGCGGCGGAGG - Intronic
1073408503 10:103319887-103319909 CACATGAATCCAGGAGGTGGAGG - Intronic
1073738019 10:106372044-106372066 CTCAAAAAAAAAGGCGGGGGGGG + Intergenic
1074117215 10:110465443-110465465 CACTTAAACCCAGGAGGGGGAGG - Intergenic
1074738371 10:116459849-116459871 CACTTGAATCAAGGAGGTGGAGG - Intronic
1074820515 10:117174977-117174999 CTCATAAAGGAAGTCGGGGGCGG - Intergenic
1075338851 10:121629557-121629579 CACATAAACCTAGGAGGCGGAGG - Intergenic
1075455151 10:122580226-122580248 CACAGACAGCAAGGCAGGGGAGG + Intronic
1075640630 10:124061871-124061893 CACATAAGGCAAGGCAGAGGTGG + Intronic
1077629997 11:3805034-3805056 CACATAAATCAAGGTAGGCGAGG + Intronic
1080437184 11:32255923-32255945 CACATAAACAAAGGGGGGTGGGG + Intergenic
1080638330 11:34142808-34142830 CACATCAATCCAGGCAGTGGAGG - Intronic
1081488980 11:43552899-43552921 GACATAAAACAAGGCTGTGGGGG - Intergenic
1082062436 11:47872330-47872352 CACATAGATTCAGGCAGGGGAGG + Intergenic
1083830960 11:65233266-65233288 CACGTAAATCATGGTGGCGGTGG - Intergenic
1084734052 11:71093040-71093062 CTCAAAAATAAAGGGGGGGGGGG + Intronic
1085063163 11:73467337-73467359 CACAGAAATTAAGTCTGGGGAGG + Intronic
1085131436 11:74042460-74042482 AACATAAATCTGGCCGGGGGTGG + Intronic
1085694857 11:78695445-78695467 CACTTAAATCCAGGAGGCGGAGG - Intronic
1090220576 11:125019565-125019587 CACATAAGACAAGGCCAGGGAGG + Intronic
1090292658 11:125558999-125559021 CACATGAATCCAGGAGGTGGAGG + Intergenic
1090949404 11:131459841-131459863 CACCTGATTCAAGGCTGGGGTGG + Intronic
1091038979 11:132259056-132259078 CAGAGAAACCAAGGCAGGGGAGG - Intronic
1095910645 12:47423523-47423545 CACCTAAAGCAAGGAGGGAGAGG + Intergenic
1096711777 12:53462851-53462873 CACATAAAACATGGATGGGGTGG - Intronic
1096854158 12:54467396-54467418 CACATGAACCCAGGCGGTGGAGG - Intronic
1097157495 12:57023505-57023527 AAAAAAAATCAAGGCCGGGGAGG - Intronic
1104668495 12:130664850-130664872 AACATAAATAAAGGGGGGCGGGG + Intronic
1107475849 13:40734905-40734927 CAAATAACGCTAGGCGGGGGAGG + Intronic
1112463987 13:99627212-99627234 CACAGAAAAAAAGGAGGGGGTGG - Intronic
1113447108 13:110377659-110377681 CAAAAATATGAAGGCGGGGGAGG - Intronic
1116144903 14:41052652-41052674 TACACAAATCAAGGAGGGGAGGG + Intergenic
1116830269 14:49712791-49712813 CACAAAAATTAAGCCGGGTGTGG - Intronic
1117222435 14:53619443-53619465 AACATATATAAAGGTGGGGGGGG + Intergenic
1117458523 14:55921677-55921699 ACCATAAATCAAGGCCAGGGAGG - Intergenic
1120346368 14:83295956-83295978 GAGAGAAATCAAGGGGGGGGGGG - Intergenic
1120524623 14:85563454-85563476 CACAGAAAGCATGGCTGGGGAGG + Intronic
1121146728 14:91590445-91590467 CACTTAAATCCAGGAGGCGGAGG + Intronic
1122603766 14:102934242-102934264 CACAAAAATCAGGCCGGGCGTGG + Intronic
1122765336 14:104065609-104065631 CACAGAAAGCATGGCTGGGGAGG + Intergenic
1124185310 15:27520317-27520339 CACTTAAATCAAGACGGCGTAGG + Intronic
1124373370 15:29115788-29115810 CACACAGATCCCGGCGGGGGAGG + Intronic
1126406291 15:48326135-48326157 CACTTGAATCAAGGAGGTGGAGG - Intergenic
1128731119 15:70021876-70021898 CACTTAAATCCAGGAGGTGGAGG + Intergenic
1129538144 15:76330827-76330849 CACTTAAACCCAGGCGGTGGAGG - Intergenic
1131400821 15:92124317-92124339 CACATACATCAGGGAGGGAGGGG + Intronic
1134186416 16:12088454-12088476 CATATAAATGAGGGCTGGGGAGG - Intronic
1137629285 16:49930930-49930952 CACATGAATCAGGGCAGGGCTGG + Intergenic
1138772736 16:59685408-59685430 CACAGGAATCATGGCTGGGGAGG + Intergenic
1139419856 16:66843659-66843681 CACTTGAATCAAGGAGGTGGAGG + Intronic
1142635958 17:1257896-1257918 CGCATAAATCCAGGAGGTGGAGG - Intergenic
1144703840 17:17354746-17354768 CACAGCAAGCAAGGCTGGGGTGG + Intergenic
1145182686 17:20767060-20767082 CACATGAATCCAGGAGGTGGAGG + Intergenic
1151258312 17:72896967-72896989 CACATGAATCCAGGAGGTGGAGG + Intronic
1152264034 17:79283079-79283101 GAAAGAAATCAAGGCGGGGGCGG + Intronic
1152654279 17:81512811-81512833 CGCTTAAATAACGGCGGGGGAGG - Intronic
1154269846 18:12909991-12910013 AACATAAATCAAGCCAGGCGCGG + Intronic
1155234530 18:23806148-23806170 CACCAAAAGCAAGGCGGGTGTGG - Intronic
1158353716 18:56593126-56593148 CACAGAAGTCATGGCTGGGGAGG + Intergenic
1158528939 18:58240891-58240913 CACTTGAATCCAGGAGGGGGAGG - Intronic
1158642009 18:59212077-59212099 TATATAAATCAATGGGGGGGGGG - Intergenic
1158666777 18:59439684-59439706 CACATTAAGCAAGGCCGGAGGGG - Exonic
1161792964 19:6371817-6371839 CACATAAATCCAGGCTGTGGGGG - Intergenic
1162823264 19:13236200-13236222 CACAAACACCAGGGCGGGGGTGG + Intronic
1163338499 19:16688907-16688929 CACATGAATCCAGGAGGTGGAGG + Exonic
1165864519 19:38928292-38928314 CACTTGAATCAAGGAGGCGGAGG + Intronic
1168222489 19:54970570-54970592 CACTTAAATCTAGGAGGCGGGGG + Intronic
927373645 2:22387220-22387242 CACTTAAATCCAGGAGGTGGAGG + Intergenic
928039509 2:27861049-27861071 CACTTGAATCAAGGAGGTGGAGG - Intronic
928068475 2:28190684-28190706 CTCAAAAAACAAGGGGGGGGCGG + Intronic
929045748 2:37787373-37787395 CAAATAAGACAAGGAGGGGGAGG - Intergenic
929561956 2:42961662-42961684 CACATAAATAACGTCTGGGGCGG - Intergenic
930538916 2:52680453-52680475 CACATAAAGCAAGGAAGGAGAGG + Intergenic
932176679 2:69609277-69609299 CACCTAAACCCAGGAGGGGGAGG + Intronic
932799662 2:74729609-74729631 CACTTAAACCCAGGAGGGGGAGG + Intergenic
933656184 2:84888805-84888827 CACATAGATCAAGGCAGGTAAGG + Intronic
933662098 2:84936200-84936222 CACTTAAATCCAGGGGGTGGAGG + Intergenic
935208114 2:100914205-100914227 CACATAATGCAAGGCAGGAGAGG - Intronic
935486280 2:103658876-103658898 CACTTAAATCCAGGAGGTGGAGG - Intergenic
939594158 2:144104096-144104118 TAAATAAATAAAGCCGGGGGAGG + Intronic
940208670 2:151233749-151233771 CACTTGAATCCAGGAGGGGGAGG + Intergenic
940449281 2:153817884-153817906 AAAATAAATTAAGGAGGGGGAGG + Intergenic
941165152 2:162075834-162075856 CACAGAGGTCAAGGTGGGGGAGG - Intergenic
945627427 2:212228100-212228122 CACACAAACCAAGGAGGGGGAGG - Intronic
946274540 2:218621011-218621033 CACTTGAATCAAGGAGGTGGAGG - Intronic
946890621 2:224272326-224272348 CAGATAAATCACGGCTGGGCAGG + Intergenic
947412296 2:229853571-229853593 CACTTGAATCCAGGAGGGGGAGG + Intronic
948221613 2:236274257-236274279 TACAGAAATCATGGCTGGGGAGG + Intergenic
1170475458 20:16709785-16709807 CACTTAAATCCAGGAGGCGGAGG - Intergenic
1172041022 20:32045933-32045955 CACTTAAACCTAGGCGGTGGAGG + Intergenic
1172578203 20:36026020-36026042 CACACAAAACAAAGCCGGGGTGG - Intronic
1173200984 20:40954983-40955005 CTCATAAATGAAGGCTGGGAAGG + Intergenic
1173880851 20:46411165-46411187 AACATCAAGCAAGCCGGGGGGGG + Intronic
1174214576 20:48906316-48906338 CACATAAACAAACGTGGGGGTGG - Intergenic
1175393595 20:58643387-58643409 CACAGGATTCAAGGCAGGGGTGG + Intergenic
1176302117 21:5103397-5103419 CACATAAACCCAGGAGGCGGAGG + Intergenic
1177924265 21:27194282-27194304 CACTTGAATCCAGGAGGGGGAGG + Intergenic
1178077586 21:29026116-29026138 CAAAGACATCAAGGCGGGGAGGG + Intronic
1178988860 21:37334735-37334757 CACAGAAAGCATGGCTGGGGAGG + Intergenic
1183864518 22:40693686-40693708 CACTTAAATCCAGGAGGCGGAGG - Intergenic
954765137 3:52908650-52908672 CACATGAACCCAGGCGGTGGAGG - Intronic
955094037 3:55779415-55779437 CACTTAAATCCAGGAGGTGGAGG + Intronic
962525084 3:136230664-136230686 CACTTAAATCCAGGAGGCGGAGG + Intergenic
963728785 3:148950412-148950434 CACATAAATCACTGGGGGTGGGG + Intergenic
965080238 3:164023897-164023919 CACTTAAAACAAGGCCAGGGGGG + Intergenic
969041143 4:4297152-4297174 CACTTGAACCCAGGCGGGGGAGG - Intronic
969422503 4:7105450-7105472 CCCATAATTCAAGGCTGGCGTGG - Intergenic
969565237 4:7973415-7973437 CACTTAAATCCAGGAGGTGGAGG + Intronic
969845175 4:9914736-9914758 GATATAAAGCAAGGCCGGGGTGG - Intronic
970879962 4:20917317-20917339 AATATAAATCATGGCCGGGGCGG - Intronic
975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG + Intergenic
977276943 4:94989303-94989325 CACTTGAATCCAGGCGGTGGAGG + Intronic
980508622 4:133756853-133756875 CACTTAAATCCAGGAGGCGGAGG - Intergenic
980828021 4:138095349-138095371 GAGATAAATGAGGGCGGGGGTGG + Intergenic
981694482 4:147546415-147546437 CAGATAAATCAAGAAGGGGATGG - Intergenic
982078026 4:151758226-151758248 CAGATAAATGAAGGAGGAGGAGG - Intronic
983567189 4:169165623-169165645 CAGAGAAAAAAAGGCGGGGGGGG + Intronic
984105873 4:175544887-175544909 CACTGAAATCAGGGCTGGGGTGG - Intergenic
986995911 5:13606867-13606889 CACATAACACAAGGCTGGGCAGG + Intergenic
989090071 5:37721278-37721300 GAAATAAATAAAAGCGGGGGTGG - Intronic
989444364 5:41510356-41510378 CAGATAAAGCAGGGCGGGGCAGG + Intronic
990454096 5:55967878-55967900 CACTTAAATCCAGGAGGCGGAGG - Intronic
992067952 5:73124480-73124502 GACATAAACCAAGGCAGGAGAGG - Intronic
992288703 5:75262707-75262729 CACATGAATCCAGGAGGCGGAGG - Intergenic
993534289 5:89062517-89062539 CACTTAAATCTAGGAGGTGGAGG - Intergenic
997942779 5:138173312-138173334 CACTTAAATCCAGGAGGTGGAGG + Intronic
1002923206 6:1588123-1588145 CAGATAAATCAAGGCAGTGCCGG - Intergenic
1003000101 6:2324196-2324218 TACATAAAGCATGGCTGGGGAGG - Intergenic
1003040334 6:2682061-2682083 CACATAAATCAAGACAGTGAGGG + Intronic
1004660421 6:17705556-17705578 CTCCAAAATAAAGGCGGGGGTGG + Intronic
1011656409 6:89555891-89555913 CACATAAATCAAGGCGGGGGAGG + Intronic
1012022877 6:93947399-93947421 CACTTTAATCAAGGTGGTGGTGG - Intergenic
1012302046 6:97601880-97601902 CACATAAAAAAAGCCGGGTGTGG - Intergenic
1013269216 6:108530164-108530186 CACTTAAATCCAGGAGGCGGAGG + Intergenic
1014946651 6:127506574-127506596 AAAATAAATAAAGACGGGGGAGG - Intronic
1015923871 6:138291208-138291230 CACATAACTCAAGTCTGGGTGGG - Intronic
1015959237 6:138630467-138630489 CACATGAATCAGGGAGGCGGAGG - Intronic
1016982444 6:149864852-149864874 CACAAAAATCAAGCCTGGTGAGG + Intergenic
1017985292 6:159438287-159438309 CACATAAATCACTGCAGAGGTGG + Intergenic
1019198828 6:170297316-170297338 CACAGAAAGGGAGGCGGGGGCGG - Intronic
1020368303 7:7404192-7404214 GACACAAAACAAGGTGGGGGAGG + Intronic
1021959369 7:25857283-25857305 CGCATAAATCATCGCGGGGGCGG - Intergenic
1023946651 7:44808449-44808471 CACTTGAATCCAGGAGGGGGTGG - Intronic
1024506129 7:50163274-50163296 CACATGAATCCAGGAGGCGGAGG + Intergenic
1025944384 7:66094827-66094849 CACTTGAATCTAGGAGGGGGAGG + Intronic
1026440845 7:70442572-70442594 CACTTGAATCAAGGAGTGGGAGG - Intronic
1027468161 7:78540547-78540569 CACATAAGTCATGGCAGGTGGGG - Intronic
1028334683 7:89636941-89636963 CACCTAAATCAAGGAAGGGGAGG - Intergenic
1029811432 7:103053234-103053256 CACTTGAATCAAGGAGGTGGAGG - Intronic
1030194553 7:106840952-106840974 CACATACATCCAGGCGGAGGGGG - Intergenic
1030826370 7:114164426-114164448 CACTTGAATCCAGGAGGGGGAGG - Intronic
1031065809 7:117104354-117104376 CACTTAAATCCAGGAGGCGGAGG + Intronic
1032133898 7:129256552-129256574 AAGATAGATTAAGGCGGGGGGGG - Intronic
1032714942 7:134500036-134500058 CACTTGAATCAAGGAGGCGGAGG + Intergenic
1035395227 7:158530528-158530550 CACATAGAGCAAGGCGGGGGGGG + Intronic
1037186500 8:16069936-16069958 CACTTAAACCAAGGAGGCGGAGG + Intergenic
1037323898 8:17669759-17669781 CACATGAATCCAGGAGGTGGAGG + Intronic
1037792255 8:21955810-21955832 CACATAAACCCAGGCAGCGGAGG - Intronic
1038768911 8:30457864-30457886 AATATAAATCAAGGCTAGGGCGG - Intronic
1041497430 8:58502543-58502565 CAACGAAATCTAGGCGGGGGTGG + Intergenic
1042386226 8:68177824-68177846 CACATAGAGCAAGGGGGTGGGGG - Intronic
1043061885 8:75515847-75515869 CACTTAAACCCAGGAGGGGGAGG - Intronic
1043579796 8:81698994-81699016 CACATGAACCCAGGAGGGGGAGG - Intergenic
1047903167 8:129445557-129445579 CTCATAAATCAGGGCTGGGGAGG - Intergenic
1052396047 9:27939485-27939507 TATATAAATCAAGGTGGTGGAGG + Intergenic
1053202280 9:36160957-36160979 CACTTAAACCAAGGAGGTGGAGG + Intronic
1055183789 9:73425023-73425045 AAAATAAATCAAGGCTGGAGTGG - Intergenic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1057705989 9:97395568-97395590 CACAAAAATGGAGGCGGTGGGGG - Intergenic
1057799933 9:98184746-98184768 CACTTAAATCAAGGGGTGTGTGG + Intronic
1058401195 9:104621984-104622006 AACACAAATCGAAGCGGGGGTGG - Intergenic
1060569797 9:124628109-124628131 CACTTAAATCCAGGAGGCGGAGG - Intronic
1061901602 9:133675265-133675287 CACTTGAATCAAGGAGGTGGAGG + Intronic
1061976204 9:134068930-134068952 CACATAAATCAAGTTGTGGGGGG + Intergenic
1185801969 X:3019529-3019551 CACGTACATAGAGGCGGGGGTGG - Intronic
1187227264 X:17385428-17385450 CGCTTAAATCAAGGAGGTGGAGG + Intronic
1191994681 X:67080239-67080261 CACCTAAATAAAGCTGGGGGTGG + Intergenic
1193026901 X:76854813-76854835 CACAAAAATCTAGCTGGGGGCGG + Intergenic
1193138819 X:78003856-78003878 CACTTAAACCCAGGCGGCGGAGG + Intronic
1198401294 X:136270938-136270960 CTCAAAAATAAAGGGGGGGGGGG - Intergenic
1199781134 X:151061110-151061132 CACTTGAACCCAGGCGGGGGTGG - Intergenic
1201463283 Y:14252083-14252105 CACTTGAATCCAGGAGGGGGAGG + Intergenic