ID: 1011662223

View in Genome Browser
Species Human (GRCh38)
Location 6:89604477-89604499
Sequence TTTCTTTAAAGAGGCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011662221_1011662223 -2 Left 1011662221 6:89604456-89604478 CCTCTGCTTACTTTTTTTTTTTT 0: 4
1: 25
2: 918
3: 5408
4: 29193
Right 1011662223 6:89604477-89604499 TTTCTTTAAAGAGGCTATGCTGG 0: 1
1: 1
2: 2
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011662223 Original CRISPR TTTCTTTAAAGAGGCTATGC TGG Intronic
903036464 1:20496035-20496057 TTTCCTTAAACATGCCATGCTGG - Intergenic
905023528 1:34834521-34834543 TTTATTTAAAGAGGGTAGGCTGG - Intronic
905222664 1:36459609-36459631 CTTCTCAAAAGAGGCTATGGAGG + Intronic
905491487 1:38347510-38347532 TTTCTTTAAAAAGGTAGTGCAGG + Intergenic
905919757 1:41711593-41711615 TGTCTTCACAAAGGCTATGCAGG - Intronic
908673881 1:66579175-66579197 TTTCTTTTAAGAAGCTAAGGTGG + Intronic
908674059 1:66581911-66581933 TTTCTTTTAAGAAGCTAAGGTGG + Intronic
908803957 1:67910307-67910329 CTTTTTTAAAGAGACTACGCTGG - Intergenic
910712774 1:90198970-90198992 TTTCTTTAAAGAAGATTTCCTGG - Intergenic
911999486 1:104812704-104812726 TTTTTTCCAAGAAGCTATGCAGG - Intergenic
912047474 1:105477848-105477870 TTTCTGTAAATAGAGTATGCTGG + Intergenic
912862561 1:113227023-113227045 TTTCTTTAAAAAGTAAATGCAGG + Intergenic
915137365 1:153742384-153742406 TTTCTTTAAAATGGATGTGCTGG - Intronic
915926547 1:160025484-160025506 CTTCTTAAAATAGGCTATGAAGG + Intergenic
916192495 1:162192876-162192898 TTCCTTTATAGAGACTATGGGGG + Intronic
916398516 1:164419103-164419125 AATCTTTAAGGAGGCCATGCAGG - Intergenic
916814118 1:168334285-168334307 TTTCTTTAAGGCGGCTTTCCCGG + Intergenic
918151862 1:181803831-181803853 TTTGTTTAGAGAGGCTTTTCAGG - Intronic
918676690 1:187295401-187295423 TTTCTTTAAACAGGATAAGATGG + Intergenic
920770352 1:208878899-208878921 TTCCTTTAAAGAGGCAAAACTGG + Intergenic
1063737584 10:8778095-8778117 TTTCTGCAAACAGGCTCTGCTGG + Intergenic
1063840579 10:10067206-10067228 TTTCCTTAAAGAAGCTAGGGAGG + Intergenic
1064199093 10:13269710-13269732 TATCTTTAAAGAGGTAATGAAGG + Intergenic
1069515055 10:69070683-69070705 CTTCTTTAAAGAGGCGAGGAAGG - Intergenic
1069998895 10:72361396-72361418 TTTTTATAAAGAGGCCTTGCAGG - Intergenic
1070460522 10:76664545-76664567 TTTCTCTAAAGAATATATGCAGG + Intergenic
1072076558 10:91980321-91980343 TTTCATTAAAAAGGCTAAACAGG - Intronic
1073404035 10:103281274-103281296 TTTCTATAAAGATGCTATCATGG - Intronic
1075915772 10:126165492-126165514 TATCTTGAAAGAGACTCTGCAGG + Intronic
1076712524 10:132346375-132346397 TTACTTTAAAAAGTCTTTGCTGG + Intronic
1080683980 11:34500436-34500458 TCTCTTTCCATAGGCTATGCTGG - Intronic
1082786412 11:57319839-57319861 TTTCTTTACAGAGTTGATGCAGG - Intronic
1084712416 11:70852260-70852282 TTTCTTTAAAGCTTCTAAGCAGG - Intronic
1085483046 11:76838447-76838469 TCTCTTTAAAAAAGCTTTGCCGG + Intergenic
1086747682 11:90450766-90450788 TTCCTTTAAAGCTGCTATGGAGG - Intergenic
1086813050 11:91334996-91335018 TTTTTTTAAAGAAGCAATGCAGG + Intergenic
1087098577 11:94343900-94343922 TTCCTTTGAAGTGGCTATTCTGG + Intergenic
1087765290 11:102145362-102145384 TTTCTTTAAAGAGTTCATGAAGG + Intronic
1087952052 11:104233548-104233570 TTTCTTTAATAAGGCTATTCAGG + Intergenic
1089015751 11:115163858-115163880 TTTCTTCTAAGAGGGTTTGCTGG + Intergenic
1090463558 11:126912628-126912650 CTTCCTTCAAGAGGCCATGCTGG + Intronic
1091914854 12:4263855-4263877 TTTGTTTAAAGAGGCTCACCAGG + Intergenic
1092000938 12:5031777-5031799 TTTCTTTGAAGAGCCTTTGCAGG + Intergenic
1092403666 12:8199268-8199290 TTTCTTTCAAGAAGCTACACAGG - Intergenic
1094790223 12:33904268-33904290 TTTCTTTCAAGAAGCAGTGCAGG + Intergenic
1095107208 12:38249016-38249038 TTTCCTTGAAGAGGCTTTTCTGG + Intergenic
1099055168 12:77830859-77830881 TTTCTTTAAAAAGAGAATGCAGG + Intergenic
1099165807 12:79306005-79306027 TTTCTTTAAAGAGTCTCTCTTGG + Intronic
1100821022 12:98430039-98430061 TTTCTTTAAAGAAGCTAAATTGG - Intergenic
1101546484 12:105718220-105718242 TTTCTTTACTGAGGTTATGTAGG + Intergenic
1102030182 12:109735859-109735881 TTTCATTAAAGAGCCGAGGCTGG + Intronic
1105838912 13:24236334-24236356 TTTCTCTAAAGAAGATATGCAGG + Intronic
1106102358 13:26706148-26706170 TTTCTTTAGTGAGGATGTGCTGG + Intergenic
1106827207 13:33536718-33536740 TTTCTTTAAAGAGGAAAACCAGG - Intergenic
1107070461 13:36262662-36262684 ATTCTTTAAAGATGCTATGCTGG - Intronic
1107200693 13:37713518-37713540 TTTCTTTGAAGGGACTATGTTGG - Intronic
1109404855 13:61884715-61884737 TTTCACTATATAGGCTATGCTGG - Intergenic
1110963935 13:81666851-81666873 TTTCTTTAAAGAGGCTATTCAGG - Intergenic
1111557467 13:89900132-89900154 TCTGTTTATAGAGGCTATCCAGG - Intergenic
1112116945 13:96366539-96366561 TTTCTTTAGTGAGTCTAGGCTGG + Intronic
1112135139 13:96569755-96569777 TTTCTTTAAATAGGGAATGTGGG + Intronic
1112916577 13:104558011-104558033 TTTCATTAAAGAAACTAAGCTGG + Intergenic
1115575952 14:34712236-34712258 TTTCTTTTAAGAAGATATGCAGG + Exonic
1116000439 14:39237435-39237457 TTTCTTTAAAGATGAAAAGCAGG - Intronic
1116013395 14:39377766-39377788 TTTTTTTAAATTGGCTTTGCTGG + Intronic
1116108680 14:40546466-40546488 TTTCATTAAAAAGGATATTCAGG + Intergenic
1117217207 14:53563652-53563674 TTTCATCAAAAAGGATATGCAGG + Intergenic
1117494009 14:56283733-56283755 TTTATTTAAAGAGGCTGAGCTGG - Intronic
1117721413 14:58632119-58632141 CTTAATTAAAGAGGCTGTGCGGG + Intergenic
1119193360 14:72699715-72699737 TTTCTTTAAAATGGGGATGCAGG - Intronic
1119196936 14:72723995-72724017 TTTCTAACAAGAGACTATGCTGG + Intronic
1122104837 14:99444947-99444969 TTTTTTTAAAAAGGCCATGATGG + Intronic
1122359243 14:101149767-101149789 TATCTTGAAAGAGGATTTGCTGG + Intergenic
1122475661 14:102006995-102007017 TTTCTTTAAACAGGACCTGCTGG + Exonic
1123885891 15:24728101-24728123 TTTCTTTAAACATGCCATTCAGG + Intergenic
1124108967 15:26769632-26769654 TTACTTGAAAGAGGATATTCTGG - Intronic
1125973899 15:43934458-43934480 TTTCTTTAAAAAGGATAATCGGG + Intronic
1127167406 15:56260792-56260814 TTTCCTGAAAGAGGTTATGTAGG + Intronic
1127813312 15:62582996-62583018 TTTTTTTAAGGAGGCAATGGAGG - Intronic
1129490804 15:75923767-75923789 TTTTTTTAAAAAGTATATGCAGG + Intronic
1131388344 15:92026644-92026666 TTTATTTTAAAAAGCTATGCAGG + Intronic
1131445804 15:92497198-92497220 TTTCTTTCCAGAGGCTCTGGGGG + Intronic
1131926185 15:97386456-97386478 TTTCTTTAAACAGGCAATGTGGG + Intergenic
1133361772 16:5179718-5179740 TGTATTTCAAGAAGCTATGCTGG + Intergenic
1133541245 16:6756669-6756691 TTTCTTAAAAGAAGATATACAGG + Intronic
1133647702 16:7779652-7779674 TTCCTTTCAAAAGGCTCTGCTGG + Intergenic
1134219788 16:12344889-12344911 TTACTTTAAAAAGGCTCTGCTGG - Intronic
1134273392 16:12754580-12754602 TTTTTATAAATAGACTATGCAGG - Intronic
1134802875 16:17101526-17101548 ATTCTTTTATGTGGCTATGCAGG + Intergenic
1135701412 16:24635894-24635916 TGACTTTAAAGAGACAATGCTGG + Intergenic
1137819582 16:51431018-51431040 TTTCTTTAACGAGGTCAAGCTGG + Intergenic
1138973861 16:62179720-62179742 TTTCTTGAAAGAGGCTTTCCTGG - Intergenic
1138983669 16:62300643-62300665 TTTCTTTAAAGAGTCCAAGCAGG - Intergenic
1139782153 16:69360759-69360781 TTTCTTTAAACAAGAAATGCAGG + Intronic
1140738092 16:77916705-77916727 GTTCTCTAAAGAATCTATGCTGG + Intronic
1144008035 17:11118954-11118976 TTCCTTTAAAGGGACTATTCAGG - Intergenic
1144195079 17:12885367-12885389 TTTCTCTAGAGTGGCTCTGCTGG + Intronic
1144841652 17:18190238-18190260 ATTCTTTAAAGAAACTATGCAGG - Intronic
1149083572 17:52686970-52686992 GATATTTAAAGAGGCTCTGCTGG - Intergenic
1149164385 17:53733378-53733400 TTTCTTTAAAGAGGTTTTATAGG - Intergenic
1150145180 17:62762840-62762862 TTTCATGAAAGAGGATAGGCCGG - Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150707346 17:67499171-67499193 TTTCTTCAAAGAAGATATACGGG - Intronic
1150957473 17:69875836-69875858 TTTCTTGAAAGAGGTTGTGAAGG - Intergenic
1153192832 18:2561368-2561390 TTTCTTTATAAAGGCCTTGCAGG - Intronic
1155115324 18:22760224-22760246 TTTTTTTTAATAGCCTATGCTGG - Intergenic
1157200324 18:45654023-45654045 TTCCTTTAAAGAGGCAGAGCTGG - Intronic
1157880176 18:51313998-51314020 GTCCTTCAAAGAGTCTATGCGGG + Intergenic
1158194299 18:54867070-54867092 TTCCTTTAAAGAGACTGTTCAGG - Intronic
1159486563 18:69067339-69067361 TATCTTTGAAGAGGCTATAAAGG - Intergenic
1161886168 19:6997656-6997678 TTTCTTGAAAGCTGCTATGTCGG - Intergenic
1164630488 19:29758667-29758689 TTTTTTTAAAAAGGATATGTGGG + Intergenic
1166353131 19:42210204-42210226 TTTCCTTAAACAGTCTATCCTGG - Intronic
1166416410 19:42597502-42597524 TTTCTTCAAAGAAGATATACAGG - Intronic
926030257 2:9580264-9580286 TCATTTTAAAGTGGCTATGCTGG - Intergenic
926457601 2:13087066-13087088 TCTCTTTAAATTGGCTTTGCAGG - Intergenic
928090509 2:28371122-28371144 TTTTTTTAAAGCAGCTATGTTGG - Intergenic
929686539 2:44039974-44039996 TTTTGTTAAAGAGGCAAGGCTGG + Intergenic
930734223 2:54758768-54758790 CTTGTTTTAAGAGGCTTTGCAGG + Intronic
930805441 2:55484902-55484924 TTTCTTTAAAGATTATAGGCTGG - Intergenic
932197622 2:69797955-69797977 TTTGTTTAAAGAGCATATGGAGG - Intronic
932795692 2:74693504-74693526 TTTCTTTTAAGAGGATAGGATGG + Intergenic
934588416 2:95526213-95526235 TTTTACTAAAGAGGCTATCCTGG + Intergenic
935886759 2:107629091-107629113 CCTCTTTAAAGAAGATATGCAGG - Intergenic
938983751 2:136552507-136552529 TTTTTATAGAGAGGCAATGCGGG + Intergenic
940130519 2:150376306-150376328 TTTCTTTCAATAGTCTTTGCTGG + Intergenic
941348530 2:164401873-164401895 TTTCTTAAAAGAAGACATGCAGG + Intergenic
941764158 2:169278101-169278123 TTTTTTTAAAGAGACTGTGGGGG + Intronic
943333669 2:186589496-186589518 TCACTTGCAAGAGGCTATGCTGG + Intergenic
943620414 2:190141900-190141922 TTTATTTAAAAAGGCTTAGCGGG + Intronic
945078597 2:206065949-206065971 GTTCTTTATAGTGGCTATACTGG - Intronic
946577634 2:221093602-221093624 TTTTTTTAAAAAAGCAATGCAGG + Intergenic
948253246 2:236547563-236547585 TTCCTTTAAGGAAGCTTTGCTGG + Intergenic
948356738 2:237384311-237384333 TCTCTTTAATGTGGCTCTGCAGG + Intronic
948487757 2:238291562-238291584 TCTCTTTAGAGAGACTTTGCTGG - Intergenic
1169604287 20:7298538-7298560 TTTCTTTAAAGAAGACATACAGG - Intergenic
1169891471 20:10457745-10457767 TTTTTTTAAAGAGTTTATGAGGG + Intronic
1171935423 20:31270470-31270492 TTGTTTTAAAGAAGCTAAGCAGG + Intergenic
1172189060 20:33050555-33050577 TCTCTTCCAAGAGGCTAGGCTGG + Intergenic
1173772785 20:45677902-45677924 TTTCTTTAAATATGCTTTGTGGG + Intergenic
1176333278 21:5570776-5570798 TTTTTTTAAAGAAACTATACAGG + Intergenic
1176394479 21:6250176-6250198 TTTTTTTAAAGAAACTATACAGG - Intergenic
1176442678 21:6738928-6738950 TTTTTTTAAAGAAACTATACAGG + Intergenic
1176466940 21:7065998-7066020 TTTTTTTAAAGAAACTATACAGG + Intronic
1176490501 21:7447776-7447798 TTTTTTTAAAGAAACTATACAGG + Intergenic
1176510141 21:7690607-7690629 TTTTTTTAAAGAAACTATACAGG - Intergenic
1177155341 21:17495523-17495545 TTTTTTTTAAGAAGGTATGCTGG - Intergenic
1177227344 21:18274690-18274712 TGACTCTAACGAGGCTATGCAGG + Intronic
1177422171 21:20874151-20874173 TTTTTTTAAAAAGCCTATACTGG - Intergenic
1179420346 21:41231077-41231099 CTTCTTTAAGGAGGCTAAACTGG + Intronic
1181850885 22:25749215-25749237 TTTCATTAAAAAGGCTCTCCAGG - Intronic
1184062757 22:42094212-42094234 TTTCTCCAAAGAGGATATACGGG + Intergenic
949464093 3:4326276-4326298 TTTTTTTAAATTGGCTTTGCTGG + Intronic
952255503 3:31691703-31691725 TTTCTTTAAAGAGACAACTCAGG - Intronic
952619840 3:35324611-35324633 CTTGTTTAAATAGGCTTTGCTGG + Intergenic
953903393 3:46856115-46856137 TTTCTCTAAAGAGGATGTGCAGG - Intergenic
953988759 3:47467302-47467324 TTTCTCTAAAGAAGATATACAGG + Intronic
954383313 3:50231143-50231165 TTTCTTTGAGGAGGTGATGCAGG - Intronic
955626263 3:60922742-60922764 TTTCTTTAAAGAAGGTAAGATGG - Intronic
956611523 3:71128497-71128519 TCTCTTTAAAGATGTTAGGCAGG - Intronic
956663165 3:71618969-71618991 TTTCTGTAAAGTGGCAATGCGGG - Intergenic
957910200 3:86610000-86610022 TTTAGTTACAGAGGCTATGGAGG - Intergenic
959605024 3:108233247-108233269 TTTTTTTTAAGAGGCTATAGAGG - Intergenic
961885003 3:130091291-130091313 TTTCTTTAAAGAGGCACCTCTGG + Exonic
964639951 3:158898519-158898541 TTTCCTTAAAGAATCTATACTGG - Intergenic
964642631 3:158926422-158926444 TCTCTTAAAAGAGGCTTTTCTGG + Intergenic
968765409 4:2465722-2465744 TCTCTGTAAAGAGCCTATGCAGG - Intronic
969819737 4:9710757-9710779 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
970285645 4:14511228-14511250 TTTCATTAAAAATGCTATTCCGG + Intergenic
973201771 4:47511801-47511823 TGTATTTATAGAGGCTATGGTGG + Intronic
973580969 4:52343888-52343910 TTATTTGAAAGAGGCTATGAGGG - Intergenic
974360600 4:60873535-60873557 TTACTTAAAAGAGGCCCTGCTGG + Intergenic
974761166 4:66276165-66276187 TTTATTTTCAGAGGCTATGAAGG + Intergenic
975167598 4:71195249-71195271 TTTTTTTAAAGAGCTTATGGGGG + Intronic
977055006 4:92181255-92181277 TTTCTCTAAAGAGGACATACAGG + Intergenic
977533705 4:98230964-98230986 ATTCTTAAAAGAAGTTATGCTGG - Intergenic
978419908 4:108520458-108520480 ATGCTTTTCAGAGGCTATGCTGG - Intergenic
980060797 4:128127179-128127201 TTTCTTTCATGAGACTCTGCTGG - Intronic
980926582 4:139144058-139144080 TTTTTTCAAAGAAGCAATGCAGG + Intronic
982201231 4:152963014-152963036 CTTCTTTAGGGAGGGTATGCCGG + Exonic
982265508 4:153535019-153535041 TAGGTTTAAAGAGGCCATGCTGG + Intronic
982605567 4:157512789-157512811 TTTCTAAAACGAAGCTATGCAGG - Intergenic
983160763 4:164411347-164411369 TTTCTTTAAAGCACATATGCTGG - Intergenic
984686302 4:182672202-182672224 TTTCTAGAAGGAGGCCATGCAGG + Intronic
986298477 5:6459347-6459369 TTTCATTTAAGAGGGTATCCTGG + Intronic
986394652 5:7316422-7316444 TTTCTGAAGAGAGGCTCTGCTGG + Intergenic
987230773 5:15891657-15891679 TTATTTTAAAGAGGTTATTCTGG + Intronic
988058163 5:26128248-26128270 TCTCTTTTAAGATACTATGCAGG + Intergenic
988837190 5:35044913-35044935 TTTCTTAAAATAGGCTTGGCAGG + Intronic
988895561 5:35669398-35669420 TTTCTTTAAAGAGACCTTCCTGG + Intronic
991159243 5:63477418-63477440 TTTCTTTAAAAAGCTTATTCTGG - Intergenic
991167269 5:63578627-63578649 GTTCTTTAAAGAGGAAATGGAGG + Intergenic
992979290 5:82151063-82151085 TCACTTTAAAGACTCTATGCTGG - Intronic
993641817 5:90415090-90415112 CTTCTTTCAGGAGGCTTTGCGGG - Intergenic
994755097 5:103785349-103785371 TTACTTTACAGAAGCAATGCAGG - Intergenic
995536951 5:113146180-113146202 TTTCTTAAATGAGACTGTGCTGG + Intronic
996051496 5:118939723-118939745 TTTAAGTAAAGAGGCTATGCTGG - Intronic
996624911 5:125559063-125559085 TTTGTTTTATGAGGCTAAGCAGG + Intergenic
996944646 5:129052079-129052101 TTTATTTAAATAGGCTGTGAAGG - Intergenic
997116449 5:131130615-131130637 TTTTTTTAAACATGCTAGGCTGG + Intergenic
997765076 5:136494807-136494829 ATTCTTAAAAGAGGATAGGCTGG - Intergenic
999652385 5:153780087-153780109 TTTCTTTTAAGAGGCTGTCTTGG + Intronic
1000170130 5:158694151-158694173 TTTGTTCATAGGGGCTATGCTGG - Intergenic
1000342020 5:160285229-160285251 TTTCCTTAAAGAAGTTAAGCTGG - Intronic
1001634936 5:173203036-173203058 CTTATTTACAGAGGCTTTGCGGG - Intergenic
1003125183 6:3350176-3350198 TTTCTTTAAAAATGCTGGGCAGG + Intronic
1003247771 6:4398906-4398928 TTTCTTTAAAGGGGCTTTAAAGG - Intergenic
1003461921 6:6337216-6337238 GTTCTTAATATAGGCTATGCTGG + Intergenic
1003461923 6:6337241-6337263 GTTCTTAACATAGGCTATGCTGG + Intergenic
1003552485 6:7110785-7110807 TGTTTTTAAAGAGGATTTGCTGG + Intronic
1004190649 6:13460847-13460869 TTTTTTTAAAAAGGGTTTGCAGG + Intronic
1005294358 6:24410469-24410491 TTTCTTCAAAGAGTCTTTGATGG + Intronic
1007388333 6:41534524-41534546 TTTCTTTCTAGCTGCTATGCTGG + Intergenic
1007436328 6:41814958-41814980 TCTCTTTAAGCAGTCTATGCAGG - Intronic
1007679948 6:43627120-43627142 TCCCTTCATAGAGGCTATGCTGG - Intronic
1008394154 6:50987539-50987561 CTTACTTAAAAAGGCTATGCAGG + Intergenic
1010660166 6:78561043-78561065 TTTCTTTAAAGGACATATGCTGG + Intergenic
1011394348 6:86891008-86891030 TTTTTTTCAAGAAGCAATGCAGG + Intergenic
1011662223 6:89604477-89604499 TTTCTTTAAAGAGGCTATGCTGG + Intronic
1012814074 6:103999850-103999872 TTTAATTAAAGAGTCCATGCAGG + Intergenic
1013275383 6:108579887-108579909 TTTCCTTAAGGAGGCTATAGAGG + Intronic
1015540748 6:134311182-134311204 TTCCTTTAAACAGGCTTTGGTGG - Intronic
1016596459 6:145807664-145807686 TTTCTTTATAAAGGTTATGATGG - Intronic
1017598544 6:156056681-156056703 TTTCTCCAAAGAAGATATGCAGG - Intergenic
1017723010 6:157257361-157257383 TTTCTCTAAACATGCTGTGCAGG + Intergenic
1017989718 6:159475636-159475658 TTTATTTGATGAGTCTATGCTGG - Intergenic
1018014961 6:159703987-159704009 TTTCTTTAAAAAGGAAAGGCTGG + Intronic
1018177781 6:161192683-161192705 TTTCTTTAGTGAGGATATGATGG + Intronic
1020829972 7:13083005-13083027 TTTCATAAAACAGGCTAAGCTGG + Intergenic
1021078613 7:16335698-16335720 TTTCTTTAAATATGCTTTCCAGG - Intronic
1022025508 7:26444428-26444450 ATTCTTTAAAGAAGCAATCCAGG - Intergenic
1025220119 7:57100850-57100872 TTTCTTTAAAAAGGCAATCTTGG + Intergenic
1025630898 7:63272430-63272452 TTTCTTTAAAAAGGCAATCTTGG + Intergenic
1025651569 7:63474184-63474206 TTTCTTTAAAAAGGCAATCTTGG - Intergenic
1031119115 7:117700508-117700530 AGTCTTTAAAGAGACTATACCGG + Intronic
1032400677 7:131622315-131622337 GCTCTTTAAAGAGGCTGTGTGGG + Intergenic
1032747665 7:134804420-134804442 TTTCTTTAAAGAGACTTTTCTGG + Intronic
1036381945 8:8241348-8241370 TTTCTTTAAAGAGGCACCTCTGG - Intergenic
1036476225 8:9095891-9095913 TTTCTTTAATGAGGCTAGTAAGG - Intronic
1036865507 8:12392878-12392900 TTTCTTTCAAGAAGCTACACAGG - Intergenic
1037456636 8:19070911-19070933 TTTCTTTAGTTAGGCTAGGCAGG + Intronic
1038534078 8:28341473-28341495 CTTCTTTAAAGTGGCTCTTCAGG + Intronic
1039187519 8:34933856-34933878 TTTTTTGAAAGGGCCTATGCTGG - Intergenic
1039211094 8:35215426-35215448 TCTCTGTAAAGAGGCGCTGCCGG + Intergenic
1043391605 8:79797449-79797471 TTTATTTAAAAAGGCAATCCAGG + Intergenic
1044705006 8:95000051-95000073 TTTTTTTAAAGAAGCTTAGCTGG + Intronic
1045108493 8:98917331-98917353 CCTCTTTAAAAAGGCTATGCTGG - Intronic
1047165279 8:122431765-122431787 TTTCTTTATAGGGTCTATGCAGG + Intergenic
1047396544 8:124505081-124505103 TTACTTTTAAGAGGCAAGGCTGG + Intronic
1047527881 8:125649228-125649250 TTTTTTTAAACAGGGTTTGCTGG - Intergenic
1048060629 8:130916190-130916212 TCCCTTTAAAGAAGCCATGCAGG - Intronic
1049126444 8:140793485-140793507 TTTCTTTAAAGGGTCATTGCTGG - Intronic
1050211494 9:3263672-3263694 TTTCTTTAAAAGGGCTATGCGGG + Intronic
1050275297 9:3991303-3991325 CTTCATTAAAGAGGCTTTGAGGG - Intronic
1053414137 9:37935906-37935928 TTTCTTTAATGAGGCAGAGCAGG - Intronic
1054148471 9:61581607-61581629 TTTCTTTGAAGGAGCTTTGCTGG + Intergenic
1054953593 9:70882517-70882539 TTTTTTTCAAGTGGCTATTCAGG + Intronic
1057447933 9:95131497-95131519 TTTCTTCACAGAGACTATGCTGG + Intronic
1057803865 9:98206937-98206959 ATTCTTAGAAGAGGCTTTGCAGG + Intronic
1058757519 9:108096960-108096982 TTCCTTTAAAAATGCTAGGCTGG - Intergenic
1058941700 9:109819131-109819153 TTTCTTATAAGATGCTCTGCAGG - Intronic
1059783087 9:117550542-117550564 ATTTTTTAAAGAGGCTGTTCTGG + Intergenic
1060655102 9:125366510-125366532 TTTCTTTAAAGAAACAAAGCAGG - Intronic
1203428418 Un_GL000195v1:64446-64468 TTTTTTTAAAGAAACTATACAGG - Intergenic
1185989641 X:4878918-4878940 TTTCTTGAGAGAGGCTTTACAGG - Intergenic
1186263918 X:7810933-7810955 TGTCTGAAAAGAGGGTATGCTGG - Intergenic
1187759202 X:22561291-22561313 TTTCTTTTAATAGACTATGCAGG + Intergenic
1188818994 X:34750075-34750097 TTTCTTTACAAAGGCCCTGCAGG - Intergenic
1189652190 X:43202666-43202688 TTTCTCTAAACTGGCTATTCTGG + Intergenic
1190078876 X:47339395-47339417 TTTCACTAAAGAGGGTATACAGG - Intergenic
1190592165 X:52015019-52015041 TTTCTTTAAATTGGCTTTGCTGG - Intergenic
1196821686 X:119706315-119706337 TTTCTTTAAAGATGGCAGGCTGG + Intergenic
1197472967 X:126884956-126884978 TTTCTTTAAATATGTTATCCAGG - Intergenic
1198240910 X:134784758-134784780 TCTCTTTAAAAAGGCAATACAGG - Intronic
1198524494 X:137487068-137487090 TTTCTCAAAAGAGGATATACAGG + Intergenic
1199076902 X:143535325-143535347 TTTTTTTCAAGAAGCAATGCAGG + Intergenic
1199285995 X:146054800-146054822 TTTGTTTAAACAGGTTATTCTGG - Intergenic
1200322524 X:155204451-155204473 TATCTTAAAAGAGGCTTTTCTGG - Intronic