ID: 1011666354

View in Genome Browser
Species Human (GRCh38)
Location 6:89638547-89638569
Sequence GCGTGCGCGCCCTCTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 27}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011666354_1011666359 9 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666359 6:89638579-89638601 ACCCCGGAACCCGCCCCGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 35
1011666354_1011666361 10 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666361 6:89638580-89638602 CCCCGGAACCCGCCCCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 55
1011666354_1011666364 15 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666364 6:89638585-89638607 GAACCCGCCCCGTTGGGGATAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1011666354_1011666358 8 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666358 6:89638578-89638600 GACCCCGGAACCCGCCCCGTTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1011666354_1011666365 16 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666365 6:89638586-89638608 AACCCGCCCCGTTGGGGATAGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1011666354_1011666356 -7 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666356 6:89638563-89638585 CGCACGCCGCATCAGGACCCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
1011666354_1011666371 24 Left 1011666354 6:89638547-89638569 CCAATCTCAGAGGGCGCGCACGC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 1011666371 6:89638594-89638616 CCGTTGGGGATAGGGACAGATGG 0: 1
1: 0
2: 0
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011666354 Original CRISPR GCGTGCGCGCCCTCTGAGAT TGG (reversed) Intronic
901702472 1:11053082-11053104 GTGTGCTCCCCCTCTGACATCGG + Intergenic
904433124 1:30477900-30477922 GTGTGCGCCCCCTCTGTGCTGGG + Intergenic
915614490 1:157026383-157026405 GCTTGGGCGCCCTATGAGCTTGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1122072939 14:99216529-99216551 CTGTGGGCTCCCTCTGAGATTGG + Intronic
1128294151 15:66503505-66503527 GTGTGCTCGCCCACTGATATCGG - Exonic
1130225316 15:82052934-82052956 GCGTGCGCGCGCAGTGAGGTGGG - Intergenic
1135886695 16:26316593-26316615 GCGTGCTCACCCTCTTAAATGGG + Intergenic
1144592379 17:16535717-16535739 GCGTGCGCGCTCTCGGAGATAGG + Intergenic
1156171559 18:34493247-34493269 GCGTGCGCGCCCGCGGAGAGAGG + Intergenic
1160548985 18:79681042-79681064 GCGTGAGCTCCCTCTGGGAAAGG + Intronic
1163138788 19:15332392-15332414 GCGAGCGCGGCCTGTGAGCTCGG - Intronic
928164347 2:28958916-28958938 GCGCGCCAGCCCTCTGGGATTGG + Intronic
934657491 2:96123714-96123736 GAGTCCTGGCCCTCTGAGATGGG + Intergenic
942496654 2:176547273-176547295 TCATACGCGCCCTCTGAGAAGGG - Intergenic
944461017 2:199950670-199950692 ACGTGCGCGTGCCCTGAGATGGG + Intronic
1172508221 20:35479868-35479890 GGGTGCAGGGCCTCTGAGATGGG + Intronic
1176380613 21:6110763-6110785 GCGGGCGCGCCCTCGGCGGTGGG + Intergenic
1179742859 21:43427477-43427499 GCGGGCGCGCCCTCGGCGGTGGG - Intergenic
968940825 4:3636735-3636757 GCGTGGGCCTCCTTTGAGATGGG - Intergenic
985537939 5:475016-475038 GCGTGCGGGCCCTCTGCGAGGGG + Exonic
1001517101 5:172363654-172363676 GCGTAGGCACACTCTGAGATGGG + Intronic
1006945859 6:37784157-37784179 GAGAGCGCGCGCTCTGAGACGGG - Intergenic
1009363684 6:62841682-62841704 GTGTGCACGCCCTGTGATATTGG - Intergenic
1009368431 6:62874098-62874120 GTGTACACGCCCTCTGATATTGG - Intergenic
1011666354 6:89638547-89638569 GCGTGCGCGCCCTCTGAGATTGG - Intronic
1027592555 7:80134752-80134774 GCGGGCGCGCGCTCTGGGAGTGG + Intronic
1030081548 7:105782875-105782897 GCGTGCACATCCTCTGAGACAGG + Intronic
1031899486 7:127393001-127393023 GCGTGCGCGCCCACGGAGACGGG + Intronic
1034487659 7:151376079-151376101 GCGTGGGTGGCCTCTGAGGTGGG - Intronic
1058518568 9:105798529-105798551 GCGTACACTCCCTCTGATATTGG + Intergenic
1185471696 X:387415-387437 GGGTGCGCGCCCGCCGAGCTCGG + Intergenic