ID: 1011666840

View in Genome Browser
Species Human (GRCh38)
Location 6:89642425-89642447
Sequence GGGAGTTTAATCTTCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011666840_1011666849 15 Left 1011666840 6:89642425-89642447 CCCTACTGGAAGATTAAACTCCC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1011666849 6:89642463-89642485 TTTAGCCAATGAAATGTGAGTGG 0: 2
1: 10
2: 75
3: 230
4: 680
1011666840_1011666843 -9 Left 1011666840 6:89642425-89642447 CCCTACTGGAAGATTAAACTCCC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1011666843 6:89642439-89642461 TAAACTCCCTGCCCCATAGAGGG 0: 1
1: 0
2: 1
3: 10
4: 98
1011666840_1011666842 -10 Left 1011666840 6:89642425-89642447 CCCTACTGGAAGATTAAACTCCC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1011666842 6:89642438-89642460 TTAAACTCCCTGCCCCATAGAGG 0: 1
1: 0
2: 0
3: 13
4: 112
1011666840_1011666850 16 Left 1011666840 6:89642425-89642447 CCCTACTGGAAGATTAAACTCCC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1011666850 6:89642464-89642486 TTAGCCAATGAAATGTGAGTGGG 0: 1
1: 4
2: 6
3: 62
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011666840 Original CRISPR GGGAGTTTAATCTTCCAGTA GGG (reversed) Intergenic
902111348 1:14081253-14081275 TGGAGATTAATCTTCCACTTGGG + Intergenic
903039285 1:20516420-20516442 GGGAGTCTCATCTCCCAGTGTGG - Intergenic
908310731 1:62880215-62880237 TGGAGTTTAAACATCCAGGATGG + Intergenic
908989936 1:70074377-70074399 GGGTGTTTAATCTTCTAGAATGG + Intronic
915370896 1:155349656-155349678 GGGATTCTATTCTTCCAGTTAGG - Intronic
920858932 1:209689153-209689175 GGGAATCTCATCTTTCAGTATGG - Intronic
1062917510 10:1252823-1252845 GGGAGATTTTTCTTCCACTAGGG + Intronic
1064158469 10:12923161-12923183 GGAAGTTTAATCTTCTAGAAGGG + Intronic
1064871259 10:19939397-19939419 GGGAGTTATATCTGCCAATAAGG + Intronic
1066967863 10:42286174-42286196 GAATGTTTAATCCTCCAGTATGG - Intergenic
1069880725 10:71591232-71591254 GGGAGTATCATCTTACAGTTGGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1072355862 10:94609872-94609894 AGTAGTGTAATATTCCAGTACGG - Intronic
1073028774 10:100508194-100508216 GGGAGTTGAATTTTCCAGGGAGG + Intronic
1077829828 11:5854925-5854947 GGCAATTTAATTTACCAGTATGG - Intronic
1077903511 11:6510486-6510508 GGGAGTTTCATCCTCCAGTCTGG + Intronic
1078886923 11:15509400-15509422 GTGAACTTAATCTTCCAGTTTGG - Intergenic
1080944528 11:36956607-36956629 GGGAATTTTACCTTCCAATAAGG - Intergenic
1085642777 11:78203244-78203266 AGGAGTTTGATCTTACTGTACGG + Intronic
1099432254 12:82601624-82601646 TGGAGTTTCTTCTTCCAGGAGGG + Intergenic
1100294931 12:93252171-93252193 GGGAGTCTCATCTTTCAGTGGGG + Intergenic
1101904876 12:108817042-108817064 GGGAGTGGACTTTTCCAGTAAGG - Exonic
1107281080 13:38735991-38736013 AGGAGCATAATCTTCCAGGAGGG + Intronic
1108726829 13:53192090-53192112 GCGATTTTCATCTTCGAGTATGG + Intergenic
1110953107 13:81519888-81519910 GGGAGTCTCATCTCCCAGTGGGG + Intergenic
1112377651 13:98858613-98858635 GGGATTTAAATCTTCAAGAAAGG + Intronic
1117107084 14:52408783-52408805 TGGAGTCTAGTCTTCCATTACGG + Intergenic
1117817651 14:59614080-59614102 GGGAGTCTCATCTCCCAGTGGGG - Intronic
1119402287 14:74371415-74371437 GTGAGTTTCATCTTCCACAATGG - Intergenic
1121786311 14:96663672-96663694 GGAAGTGTAATCGTCCAGTGGGG - Intergenic
1124887379 15:33699863-33699885 GGGAGTGTAACCTTCGAGTTTGG - Intronic
1125174952 15:36810518-36810540 GAGACTTTAAGCTTCCAGTTGGG - Intergenic
1128351389 15:66892663-66892685 AGGAGTCTCATCTCCCAGTAGGG + Intergenic
1134747104 16:16596865-16596887 GGGAGATTAATATTTCAGAAAGG + Intergenic
1134998372 16:18756794-18756816 GGGAGATTAATATTTCAGAAAGG - Intergenic
1138827296 16:60335615-60335637 GGGAGTTTCACTTTCTAGTAGGG + Intergenic
1140586124 16:76294134-76294156 GTGAGTTTCTTCTTCCAGTCAGG + Intronic
1143345156 17:6243865-6243887 GTGAGGTTAATGGTCCAGTAGGG - Intergenic
1155269871 18:24129852-24129874 GTAAGTTTAATCTTTCAGTATGG + Intronic
1162684436 19:12369955-12369977 GGGATTTTCATCTTACAATAAGG + Intergenic
1167940679 19:52943451-52943473 GGGAGGTGAATTTTGCAGTAAGG - Intronic
1168488290 19:56784200-56784222 GGAATTTTTATCTTCCAGAAAGG - Intronic
927392800 2:22614028-22614050 GGAAGATTATTCTTCCAGTTTGG - Intergenic
928171820 2:29009321-29009343 GGGAGCTTCATCCTCCTGTAAGG + Intronic
929075412 2:38075898-38075920 GGGAGTTAAAGCTTCCAGTGAGG - Exonic
940034039 2:149294626-149294648 AGCAGGTTAATATTCCAGTAAGG + Intergenic
946407834 2:219501558-219501580 AGGAGTTTAACCTTCCAGTCAGG + Exonic
948736697 2:240012815-240012837 GGGAGTTCTATTTTCCAATAAGG + Intronic
1168987201 20:2059649-2059671 GGGTGCTTCATCTTCCGGTATGG + Intergenic
1172344335 20:34185473-34185495 ATGATTTTAATCTTACAGTATGG - Intergenic
1175054769 20:56188312-56188334 TGGAGTTTACCCTTCCAGTCTGG + Intergenic
963008709 3:140749909-140749931 GGGAGTTCCATCTTCCAGGAAGG - Intergenic
965585788 3:170317071-170317093 GGGAGTTTTATTTCCCAGTGGGG + Intergenic
970311011 4:14782546-14782568 GGGAGTATAATATTCAAGTGTGG - Intergenic
971006218 4:22376743-22376765 GGGAGTCTCATCTCCCAGCAGGG - Intronic
979535803 4:121819226-121819248 GGGAGATTAATGCTGCAGTATGG - Intronic
980267475 4:130536372-130536394 GTGATTTGAATATTCCAGTAAGG - Intergenic
981347758 4:143696755-143696777 AGGAGTTTCATCATCCACTAGGG + Exonic
981622655 4:146721019-146721041 GGAAGTTTAATCTGCAATTATGG + Intronic
986007275 5:3678348-3678370 TGGAGGTTCTTCTTCCAGTATGG + Intergenic
986815792 5:11408695-11408717 GGAAGTTAAATGCTCCAGTATGG - Intronic
988417877 5:30969234-30969256 GGGAGTCTTATCTCTCAGTAGGG + Intergenic
989164091 5:38417899-38417921 GTGGGTTTAATTTTCCAGTAAGG + Intronic
989282054 5:39655454-39655476 GAGAGTTTAATATTCTAGAAGGG - Intergenic
990860590 5:60322510-60322532 GGGAATTATATCTTCCTGTAAGG - Intronic
992857092 5:80872732-80872754 AGGAGTTTGATGTTACAGTAAGG + Intronic
992919353 5:81497416-81497438 GGGCTTTTAGTCTTCCATTAGGG - Intronic
994116451 5:96066730-96066752 AGGAGTTCAAGCTTGCAGTAAGG - Intergenic
1005119470 6:22373790-22373812 GGGAGTCTCATCTCCCAGTAGGG - Intergenic
1010172282 6:72987734-72987756 TAGAGTTTAATCTTCCAGCTTGG - Intronic
1011666840 6:89642425-89642447 GGGAGTTTAATCTTCCAGTAGGG - Intergenic
1014331565 6:120073108-120073130 GAAAATTTAATTTTCCAGTAAGG - Intergenic
1017951633 6:159140188-159140210 ATGAGTTTAAGCTTACAGTATGG - Intergenic
1022747022 7:33182932-33182954 GGGAGTCTTATCTCTCAGTAGGG + Intronic
1023800434 7:43829193-43829215 GGGAGTTTCATCTCCCAGTGTGG - Intergenic
1027387400 7:77672104-77672126 GGGAGTTTGATCTCCCAGCCTGG + Intergenic
1028109326 7:86920406-86920428 GAGACTGTAAACTTCCAGTAGGG + Intronic
1030954828 7:115839050-115839072 TGGAGTCTAAAATTCCAGTAGGG - Intergenic
1031036903 7:116797394-116797416 GGGAGTTTTATTTTGCATTAGGG + Intronic
1035933303 8:3808889-3808911 GGGATTTTAAACTTCTAGTCAGG + Intronic
1038778509 8:30551559-30551581 GGGAGTTTAACCTTCCGCAAAGG - Intronic
1044554692 8:93550181-93550203 GGGATTTTTTTCTTCCAGGAGGG + Intergenic
1050193874 9:3059376-3059398 GGGAGTTGAATCATGCATTATGG - Intergenic
1052521261 9:29550625-29550647 GGGAGTCTCATCTCCCAGTGGGG - Intergenic
1054906660 9:70419253-70419275 GGGAGCTTGATGTTCCAGCAGGG - Intergenic
1056710488 9:88989076-88989098 CTGAGTTTGATCTTCCTGTAAGG + Intergenic
1059690225 9:116677604-116677626 GGGAGTCTCATCTTCCAGTGGGG - Intronic
1059828971 9:118070119-118070141 GGAAGTATAAGCTTCCAGTTGGG - Intergenic
1060557387 9:124515413-124515435 GAGACTTTAATATGCCAGTAAGG + Intergenic
1187412164 X:19061015-19061037 GTGAGTTCAATCAGCCAGTAGGG - Intronic
1189536234 X:41938062-41938084 GGGAGTTTAATTTACCACTCTGG - Intergenic
1190515655 X:51221344-51221366 GGGAGTGTTATTTTCCATTAGGG - Intergenic
1190722934 X:53165524-53165546 GGGAGTCTCATCTCCCAGTGTGG - Intergenic
1190815673 X:53927049-53927071 GGGAGTCTCATCTCCCAGTGGGG - Intergenic
1194140632 X:90204564-90204586 GGCAGTTTTAACTTCCAGTTTGG + Intergenic
1197538840 X:127728861-127728883 AGGAGGTTATACTTCCAGTATGG - Intergenic
1199014763 X:142802384-142802406 GTGAGTTTAACGTTACAGTAGGG - Intergenic
1199430873 X:147758349-147758371 GGTAGGTTAGTTTTCCAGTATGG + Intergenic
1199537995 X:148925541-148925563 GGGAGTTCAAGCCTCCTGTAAGG + Intronic
1200486398 Y:3773690-3773712 GGCAGTTTTAACTTCCAGTTTGG + Intergenic