ID: 1011668752

View in Genome Browser
Species Human (GRCh38)
Location 6:89661763-89661785
Sequence CTTTCTGTGCAGGTTATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011668750_1011668752 4 Left 1011668750 6:89661736-89661758 CCTTTCATGTTGGAATCTCAGAT 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1011668752 6:89661763-89661785 CTTTCTGTGCAGGTTATCCAAGG 0: 1
1: 0
2: 1
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011668752 Original CRISPR CTTTCTGTGCAGGTTATCCA AGG Intronic
900098006 1:948179-948201 CTGGCTGTGCAGGTACTCCAGGG + Exonic
901103711 1:6738855-6738877 CTGTCTGTGCAGGCTATCAGGGG - Intergenic
905211046 1:36374380-36374402 CTTTCTCTGCAGGCTCTCCTGGG + Intronic
910545540 1:88412308-88412330 CTCTCTTTTCAGGTTATCAAAGG + Intergenic
913543025 1:119840007-119840029 CTGTGTGTGCAGGAAATCCACGG + Intergenic
914414613 1:147468596-147468618 CTCACTGGGCAGGTTCTCCAGGG - Intergenic
915196423 1:154193327-154193349 CTTTCTCTGGAGATTAGCCAGGG + Intronic
919414277 1:197287650-197287672 CCTCATGTGCAGTTTATCCAAGG + Intronic
921517790 1:216118833-216118855 TTTTCTGTGGATGTAATCCAGGG - Intronic
1065434310 10:25691629-25691651 ATAACTGTGCAGGTCATCCAGGG + Intergenic
1065952166 10:30662284-30662306 CTTTCTGTGTAGTTTATACAGGG + Intergenic
1067352773 10:45491792-45491814 CTTTCTGTACAGATAATCCAAGG - Intronic
1068600338 10:58950107-58950129 CTTTCTGTCCAGGTTTTTCAAGG - Intergenic
1070073714 10:73114861-73114883 CTGTCTGTTCAGGTTCTCCTTGG - Intronic
1072522481 10:96240675-96240697 CTTTCTGTGATGGTTTCCCATGG - Intronic
1073245550 10:102087822-102087844 CTACCTGTGCAGGTTCTGCAGGG + Intergenic
1074395626 10:113095752-113095774 CTCTCTGTGGAGGTCTTCCAAGG + Intronic
1080951038 11:37033310-37033332 CTTTCTGTGTAGTGTTTCCATGG + Intergenic
1084498990 11:69523758-69523780 CTTCCGGTGCAGTTTAACCAGGG - Intergenic
1085201929 11:74707059-74707081 CTTTGTGTGCTGGTTTCCCAGGG - Intronic
1086235588 11:84626369-84626391 CTTCCTGTGCAAGCTACCCATGG - Intronic
1088105784 11:106205061-106205083 TTTTCTGTTCAAATTATCCAGGG + Intergenic
1088604936 11:111520025-111520047 ATTTCTGTGATGGATATCCATGG + Intronic
1088933516 11:114376296-114376318 ATTTTGGTGCATGTTATCCAGGG - Intergenic
1091056342 11:132422828-132422850 CCATTTGTGCAGGTTTTCCAGGG + Intronic
1094161165 12:27392522-27392544 CCTTCTGTGTGGGTGATCCAAGG + Intronic
1094231238 12:28105969-28105991 CTTTGTGGGCAGGTAATTCATGG - Intergenic
1097682334 12:62660378-62660400 CTTTCTGTTCAGGTTTGCTATGG - Intronic
1100461998 12:94809042-94809064 CTTTCTGTGGAGGTAATACTTGG - Intergenic
1101871678 12:108571030-108571052 TTATCTGTGGAGGTTTTCCATGG - Intergenic
1109323242 13:60835651-60835673 CTTCCTGTGAAGTCTATCCACGG + Intergenic
1111463994 13:88583803-88583825 CTTTCTTTACAGATTGTCCAAGG - Intergenic
1113653135 13:112051944-112051966 TTTTCTATGCAGTTTATCCAAGG - Intergenic
1117705915 14:58467911-58467933 CTTACTGTGCAGGTATGCCAGGG + Exonic
1121538910 14:94710790-94710812 GTTTTTCTGCAGGTTTTCCATGG - Intergenic
1124847529 15:33306421-33306443 CTTTTTGTTCAGGTGTTCCAAGG - Intergenic
1131025330 15:89136700-89136722 CATTCTGTGTAGGTAATCCAGGG + Intronic
1134653510 16:15929110-15929132 ATTGCTATGCAGTTTATCCAAGG - Intergenic
1137913891 16:52407288-52407310 CTTTCTTTTAAGGTAATCCATGG - Intergenic
1137954702 16:52817304-52817326 TTTTCTGTTCAGGTTTTCCCTGG - Intergenic
1138573746 16:57893102-57893124 CTCTCTGTGCAGTTTATTTATGG + Intronic
1140956246 16:79869084-79869106 CTGTCTGTGCTGCTTATCCAAGG - Intergenic
1141098606 16:81180641-81180663 CCTTGTGTGCAGGTTATTGATGG + Intergenic
1144254894 17:13458127-13458149 CCTACTGTGTAGGTTCTCCAGGG + Intergenic
1145252289 17:21303193-21303215 CTTGCTGTGCAGATGCTCCAGGG - Exonic
1146477949 17:33178048-33178070 CTTCCCCTGAAGGTTATCCATGG + Intronic
1146569355 17:33939511-33939533 CTTTTTATGCAGGGGATCCAGGG - Intronic
1147388767 17:40096844-40096866 CTTTCTGGGCCGGAGATCCAGGG + Intronic
1150467285 17:65403993-65404015 CTTTCTGTGCAAGCTGGCCAGGG + Intergenic
1156193181 18:34743451-34743473 CTTTCTGTGGTGGATATCCTAGG - Intronic
1158813021 18:61059256-61059278 CTTTCTTAGCAGTATATCCAGGG - Intergenic
1161793516 19:6374191-6374213 CTCTCTGTGCAGGCCATCCACGG + Exonic
1161959751 19:7516762-7516784 CTTTCCCTGGAGGTGATCCAGGG + Intronic
1162919785 19:13893948-13893970 CTTTCAAAGCAGGTTTTCCAGGG - Intronic
1167446219 19:49539123-49539145 GTTTCTGTCCAGGTCCTCCAGGG - Exonic
925895134 2:8465474-8465496 CTTTCACTGCAGGCTTTCCATGG + Intergenic
933459642 2:82565211-82565233 CTTACTGTGCAGCTCATCAAAGG - Intergenic
933983997 2:87575585-87575607 CTATCTGTGAAATTTATCCATGG + Intergenic
936309857 2:111375211-111375233 CTATCTGTGAAATTTATCCATGG - Intergenic
937590967 2:123612814-123612836 GTTTCATTGCTGGTTATCCAGGG - Intergenic
938303289 2:130230957-130230979 CTGGCTGTGCAGGTACTCCAGGG - Intergenic
938453383 2:131443280-131443302 CTGGCTGTGCAGGTACTCCAGGG + Intergenic
940372748 2:152921118-152921140 CATTCTGTGCAGGTTACATAGGG + Intergenic
941307433 2:163888701-163888723 CTGTCTGAGCAGGTTGTTCATGG + Intergenic
942921155 2:181375002-181375024 CTTTCTGTGTAATTTATGCATGG + Intergenic
944633119 2:201647815-201647837 TTTTCTGTGTAGGATATTCAAGG - Exonic
944895146 2:204156312-204156334 CTTTCTCAGCAGATTATCCCTGG + Intergenic
945325450 2:208476910-208476932 CTTTCTCTGCAGCGTCTCCAGGG - Intronic
945452526 2:210009906-210009928 CTTTCCATGCAGATTAGCCAAGG - Intronic
946462077 2:219877752-219877774 TCTTCTCTGCAGGTAATCCAAGG + Intergenic
946768652 2:223064127-223064149 ATTTCTTTGAAAGTTATCCAGGG + Intronic
947941868 2:234063995-234064017 CTTTCTGGGAATGTGATCCAGGG - Intronic
1168876976 20:1178491-1178513 CTTTCTTTGCAGGCATTCCAGGG - Intronic
1175949729 20:62576893-62576915 CTTCCTGGGCAGGTTTCCCATGG - Intergenic
1176411146 21:6450258-6450280 CTTTGTGTGCAGGCTGTCCTGGG - Intergenic
1178897578 21:36572146-36572168 CTCTCTGGGCTTGTTATCCAAGG + Intronic
1179686639 21:43058580-43058602 CTTTGTGTGCAGGCTGTCCTGGG - Intronic
1180672807 22:17566353-17566375 GTTTCTGTGAAGATTATACAGGG - Intronic
1182768952 22:32779865-32779887 TTTTCTGCCCAGGTTATCCCAGG - Intronic
1183575084 22:38682867-38682889 TTTCCTCTGCAGGTTTTCCAGGG + Exonic
1183676651 22:39302574-39302596 CTTCCTGTTCAGGTTAACCCTGG + Intergenic
949414044 3:3798087-3798109 CTTTTCATGCAGATTATCCATGG - Intronic
953181295 3:40597491-40597513 CTTTCTCTGCAGGATCACCATGG - Intergenic
957148422 3:76453997-76454019 ATTTCTGTGCAACTTATACATGG + Intronic
959625007 3:108439797-108439819 CTCCATGTGCAGGTCATCCAGGG + Exonic
967252710 3:187559300-187559322 TTTTCTGTGCATGTTATGTAAGG + Intergenic
967263755 3:187671838-187671860 CTTTTTGTGCTTGTAATCCAAGG + Intergenic
968151448 3:196339722-196339744 ATTTCTGTGCTGGTTCACCAGGG - Intergenic
969125845 4:4947276-4947298 CTTTCTGTGCATCTTATCTCAGG + Intergenic
969651890 4:8472966-8472988 TTTTCTGTGCAGGTCACCCTGGG + Intronic
970441101 4:16082185-16082207 CTTTCTGTCCCGGTTATCCTAGG - Intronic
971255120 4:25007533-25007555 CACTCTGTCCAGGTTAGCCATGG + Intronic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
974622950 4:64384828-64384850 GTGTCTGTGCACATTATCCAGGG - Intronic
975472659 4:74788124-74788146 CTATCTCTGCAGGATATCCTAGG - Intronic
977891943 4:102322286-102322308 CTTTAGGTACAGCTTATCCAGGG - Intronic
988092141 5:26556818-26556840 TTTACTGTTCAGGTTATCCTGGG + Intergenic
990600938 5:57358028-57358050 CTTTATGTGCTGGATATCAAAGG + Intergenic
992880617 5:81105641-81105663 CTTCCTGTGTTGGTTACCCAAGG + Intronic
993047254 5:82881353-82881375 GTGTCTGTGCATGTTGTCCAGGG - Intergenic
993175819 5:84483781-84483803 CTTTCTTAGGAAGTTATCCAAGG + Intergenic
993466101 5:88249148-88249170 CTTTCTGTGGAGGGCATACAGGG - Intronic
994878686 5:105459159-105459181 CTTTCTGTGAAGGTTATCTTTGG + Intergenic
996660430 5:125996410-125996432 CTGTCTGTGCTGGTTTTCAAAGG - Intergenic
997221858 5:132174539-132174561 ATTTTTATGCAGGTTATACATGG - Intergenic
997571931 5:134936233-134936255 CTTGCTGTGCAGGTTCCCCTTGG + Intronic
1000799680 5:165709921-165709943 CTTTATGTACAACTTATCCAGGG - Intergenic
1001929005 5:175659323-175659345 CTGTCCCTGGAGGTTATCCAAGG + Intronic
1003843743 6:10150483-10150505 TTTTCTGTGCAGATTATTCTGGG - Intronic
1007400809 6:41601259-41601281 CTTTCCTTGCAGCCTATCCAGGG - Exonic
1008660958 6:53667259-53667281 CTTTCTGTGCTGGAGATCTATGG - Intergenic
1011412725 6:87082783-87082805 ATTTCTTTGCATGTTATACAAGG + Intergenic
1011668752 6:89661763-89661785 CTTTCTGTGCAGGTTATCCAAGG + Intronic
1014854082 6:126377836-126377858 GTTACTGTGAAGGTTCTCCAAGG - Intergenic
1015820815 6:137258662-137258684 TGTTCTGTACAGGTTATCCAGGG + Intergenic
1017650929 6:156581954-156581976 CTTCCTTTACTGGTTATCCAAGG - Intergenic
1023131500 7:37007623-37007645 CTTTCTGTGCATGCTTTTCAGGG - Intronic
1032862954 7:135898808-135898830 CTTCCTGTACAGGTTATTCCAGG - Intergenic
1033980483 7:147158432-147158454 CCTTTTGTGCATGTAATCCATGG - Intronic
1036241539 8:7085853-7085875 CTTTCTCTACACGTTATTCAGGG + Intergenic
1043216216 8:77592385-77592407 CTTTCTGTTCAGGGTATCCAGGG + Intergenic
1047073685 8:121376311-121376333 CTTTCTAAGCGTGTTATCCAGGG - Intergenic
1047289105 8:123513655-123513677 CTTTCTGATCAGGTGAACCATGG - Intronic
1048124240 8:131615221-131615243 CTTAGTATGTAGGTTATCCATGG + Intergenic
1050598959 9:7231568-7231590 TTCTCTGTGCAGGTAAGCCAGGG + Intergenic
1050598967 9:7231599-7231621 CACTCTGTGCAGGTAAACCAGGG + Intergenic
1050598974 9:7231630-7231652 CACTCTGTGCAGGTAAGCCAAGG + Intergenic
1050598995 9:7231723-7231745 CACTCTGTGCAGGTAAGCCAGGG + Intergenic
1051194652 9:14550085-14550107 TTTTCTGTTTATGTTATCCATGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055037385 9:71832451-71832473 CTTTTGGTGCAGGTTATGAATGG - Intergenic
1056778908 9:89534593-89534615 CCGTCTGTGGAGGTTTTCCATGG + Intergenic
1186237277 X:7527197-7527219 CGTCCTGTGCAGGTTTTCAAAGG - Intergenic
1189061304 X:37756100-37756122 CTTGCTGTGCATTTTTTCCAGGG + Intronic
1189164484 X:38847032-38847054 GTTTGAGTGCAGGTTATTCAAGG + Intergenic
1190487841 X:50946446-50946468 CATTATGTGCAGTTTTTCCATGG + Intergenic
1192062145 X:67838709-67838731 GTTTCTCTGCTGGTTATTCAGGG - Intergenic
1194619671 X:96154834-96154856 CTTTATGTACAGTTTACCCAAGG - Intergenic
1195794260 X:108626268-108626290 CTTTCTGTCCAGGTAATCCTGGG - Exonic
1196260765 X:113577989-113578011 CTTTCTGTGCATGCTTTACATGG - Intergenic
1199435550 X:147808689-147808711 CTTCCTATGTAGTTTATCCAGGG + Intergenic