ID: 1011668843

View in Genome Browser
Species Human (GRCh38)
Location 6:89662791-89662813
Sequence AACAGGACCAGGAATGGATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 552}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011668843 Original CRISPR AACAGGACCAGGAATGGATG AGG (reversed) Exonic