ID: 1011670501

View in Genome Browser
Species Human (GRCh38)
Location 6:89678772-89678794
Sequence GGAGACAATAAGAAAATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011670495_1011670501 4 Left 1011670495 6:89678745-89678767 CCTGTAAGGGAAAACAAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1011670501 6:89678772-89678794 GGAGACAATAAGAAAATCCCAGG 0: 1
1: 0
2: 2
3: 34
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011670501 Original CRISPR GGAGACAATAAGAAAATCCC AGG Intronic
901563808 1:10095288-10095310 GGAAACAATAATAAAATCATAGG - Intronic
902772248 1:18652070-18652092 GGAGGCAGCAAGAGAATCCCGGG + Intronic
903017354 1:20369663-20369685 TGAGTCAATAAGACAATCCATGG - Intergenic
903422074 1:23225227-23225249 GGAGCCAACAGGAAATTCCCGGG + Intergenic
903626686 1:24735733-24735755 GCAGACAATAAACAAATACCCGG - Intergenic
905439861 1:37988559-37988581 GGGGAAAAAAAGAAAATCCTTGG + Intronic
906129877 1:43449746-43449768 GGGGACGACAAGACAATCCCAGG + Intronic
907893124 1:58655458-58655480 GGAAAAAATAAAAATATCCCAGG - Exonic
907987281 1:59544467-59544489 GGGGACAGTCAGAAAATCCTAGG + Intronic
908004797 1:59716881-59716903 GGACAGAATCAGCAAATCCCTGG + Intronic
908261519 1:62342934-62342956 AAGAACAATAAGAAAATCCCAGG + Intergenic
908947010 1:69510676-69510698 AGAGGCAATAAGAAAAACCAGGG - Intergenic
909225807 1:73020707-73020729 GGAAACAAGAAGGAAATCCAAGG + Intergenic
909270928 1:73623006-73623028 TGCCACAAAAAGAAAATCCCAGG + Intergenic
909540260 1:76783680-76783702 GGAGGAAAAAATAAAATCCCAGG + Intergenic
913058476 1:115183444-115183466 GGAGCCCATAAGAAGACCCCAGG - Intergenic
914915482 1:151816620-151816642 GGAGACACCAGGAAAACCCCAGG + Intronic
914992857 1:152513875-152513897 GGAGACAGGAAGAAAAACCTAGG - Intronic
915883084 1:159693875-159693897 GGAGACAGTGAGAAAATCCATGG + Intergenic
917088406 1:171327533-171327555 TGAGACAAAAAAAAAATCCCTGG - Intronic
918388056 1:184030697-184030719 GGAGTCACAAAGAAACTCCCTGG + Intronic
918905648 1:190489324-190489346 AGAGACAATAAAAAAATCAGTGG + Intergenic
919107624 1:193173028-193173050 GGAGAAAAGAGGAAAATCCCTGG + Intronic
920516306 1:206586942-206586964 GGAGGCCTTAAGAGAATCCCAGG + Exonic
920926166 1:210343739-210343761 TGAGACATTAACGAAATCCCTGG + Intronic
921415785 1:214885039-214885061 GAAGACAGTAAGTAAATACCAGG + Intergenic
922521984 1:226261394-226261416 TGAGAAAAAAAAAAAATCCCTGG + Intronic
923020146 1:230157052-230157074 GGAGTAAATAAGACCATCCCAGG + Intronic
923836672 1:237618499-237618521 TGAGGCAAAAAGAAAATCCAGGG - Intronic
1065592869 10:27283315-27283337 TGAGACAAAAAGAAAACCCAGGG + Intergenic
1065657497 10:27966969-27966991 TGAGACAAAAAGAAAACCCAGGG - Intronic
1065663681 10:28034971-28034993 TGAGACAAAAAGAAAATACAGGG + Intergenic
1065806995 10:29403185-29403207 GGAGGCAGTAAAAAAATCCGTGG + Intergenic
1066369153 10:34805674-34805696 TGAGACAATAAGAAATTCTGGGG + Intronic
1066805961 10:39253776-39253798 GGAGAAAAAAAGAATTTCCCTGG - Intergenic
1066807051 10:39268026-39268048 GGAGAAAAAAGGAATATCCCAGG - Intergenic
1069079491 10:64072954-64072976 GGGGAAAATATTAAAATCCCTGG + Intergenic
1069108930 10:64419675-64419697 TGAGGCAAAAAGAAAATCCAAGG + Intergenic
1069848085 10:71386544-71386566 GGAGACAACAGTATAATCCCAGG + Intergenic
1069964491 10:72103080-72103102 GGACGCAATAAGATAATTCCTGG - Intronic
1070438630 10:76419271-76419293 GGAGACAATAAAAAGATCAGTGG - Intronic
1071244566 10:83749115-83749137 TGAGTCAATAATAAAATCTCAGG + Intergenic
1071731521 10:88253407-88253429 GGATGCAATAAGAATAACCCAGG - Intergenic
1071944210 10:90623279-90623301 GGAGTCAAGAAGAAAATCAAAGG - Intergenic
1073515726 10:104074124-104074146 CGAGGCACTAGGAAAATCCCTGG - Intronic
1073789294 10:106923191-106923213 GGAGACGGTAAGAAAGTCCATGG - Intronic
1074630661 10:115251474-115251496 GGAGACAATAGGAAAACAGCTGG - Intronic
1074799738 10:116987610-116987632 GGAGACAATAAAAAGATCAGTGG + Intronic
1076122647 10:127948539-127948561 GGAGACAGTAAAAAAATCAGTGG - Intronic
1076931525 10:133534820-133534842 GGAAAGAACAAGAAAAGCCCAGG - Intronic
1077921928 11:6647774-6647796 GGAGAGAATAAGAAATTACAGGG + Intronic
1078890254 11:15549247-15549269 GGAGACATTGAGACAATACCAGG - Intergenic
1079061449 11:17252368-17252390 GGGGACAATAAGAAAAACAGTGG + Intronic
1079694651 11:23465603-23465625 GGAGACAATAAGATGATCAGTGG + Intergenic
1079821042 11:25128699-25128721 GGAGACAGTAAAAAGATCCGTGG - Intergenic
1080948274 11:36999194-36999216 GGAGTTAATAAGAAAATCAAGGG - Intergenic
1081132767 11:39401216-39401238 GGAGACAATAAAAAGATCAGTGG + Intergenic
1081146843 11:39571702-39571724 GGAGTCAGTAAGAGAATCCCTGG + Intergenic
1081477069 11:43444092-43444114 GGAGATCATAAGAAAACTCCTGG + Exonic
1082304630 11:50556472-50556494 GGCGAAAAAAAGAATATCCCAGG - Intergenic
1082576232 11:54807749-54807771 GGAGAAAAAACGAATATCCCAGG - Intergenic
1082581563 11:54876168-54876190 GGTGACAAAGAGAACATCCCAGG - Intergenic
1082977603 11:59088470-59088492 GGAGATCAAAAGAACATCCCTGG - Intergenic
1084746700 11:71174978-71175000 GGAGACAAGGAGAGAATTCCAGG - Intronic
1085906045 11:80764233-80764255 GGACAGAATAAGAAAGTTCCAGG + Intergenic
1086853821 11:91842876-91842898 GGAGAAATTAAGAAAATACATGG + Intergenic
1088202230 11:107350853-107350875 AGACACAAGAAGAAACTCCCAGG + Intronic
1088724162 11:112619777-112619799 GGGGACAAGAAGGAAGTCCCTGG + Intergenic
1088950198 11:114560808-114560830 GGAGACAGTAAGAAAACCAGTGG - Intergenic
1089289629 11:117429804-117429826 GGATTCAATAAGAAAATCTAAGG - Intronic
1089344376 11:117781326-117781348 AGAGAAAAAAAGAAAATCCCAGG + Intronic
1090611534 11:128475436-128475458 TCACACAATAAGAAAGTCCCAGG - Intronic
1090775873 11:129965395-129965417 GGAGACAGTAGAAGAATCCCAGG + Intronic
1090899338 11:131013584-131013606 GAAGGCAAAAAGAAAATCCAGGG - Intergenic
1090921759 11:131212715-131212737 GGAGACAATAATAGGATCACTGG - Intergenic
1092009626 12:5098633-5098655 GGGGAAAATAATAAAATTCCTGG + Intergenic
1092571402 12:9726755-9726777 GGAGACAATAAATAAAGCTCTGG - Intronic
1094276769 12:28685789-28685811 GGAGACAATAAAAAGATCAGTGG - Intergenic
1095545358 12:43361899-43361921 TGAGACATCAAGAAAATCACAGG - Intronic
1098285262 12:68900832-68900854 GGAGACAATAAAAAGATCAGTGG + Intronic
1098420778 12:70294982-70295004 GCAGACAAGGAGAAAATGCCAGG - Intronic
1099084169 12:78224503-78224525 GAAGATAATGAGAAAATCTCAGG + Intergenic
1099275059 12:80564285-80564307 TGAGACAAAAAGAAAACCCAAGG + Intronic
1099849784 12:88078472-88078494 GGAGACAGTAAAAAGATCACTGG + Intronic
1101013676 12:100476929-100476951 TGTGACAATAAAAAAATACCTGG - Intronic
1102428273 12:112861711-112861733 GGAGTCATTAAGAATATCCCCGG + Intronic
1104168072 12:126253206-126253228 GGAGACAGGAAGAAAATCACTGG + Intergenic
1104610172 12:130221100-130221122 GGAGACAATAAAAAGATCAGAGG - Intergenic
1105315808 13:19261539-19261561 GGATGCAATGAGAAGATCCCAGG + Intergenic
1105670452 13:22607762-22607784 GGAGACAGTAAAAAAATCAGTGG + Intergenic
1105717446 13:23081591-23081613 AGAGAGAATAACAAAATCCCAGG - Intergenic
1106221709 13:27751422-27751444 TGAGACTGTAAGAAACTCCCTGG - Intergenic
1106480553 13:30134030-30134052 GGAGAAAATAAGAAATTCCAGGG + Intergenic
1108069087 13:46609047-46609069 GTGGACATTAAGAAAATGCCTGG - Intronic
1108392972 13:49966051-49966073 GGAGACAATAAAAAGATCAGTGG + Intergenic
1108888218 13:55218418-55218440 GGACACAAAAAGAAAATCCAGGG - Intergenic
1109124463 13:58502899-58502921 GGTGAAAATAACAAAATCCATGG - Intergenic
1109920093 13:69045351-69045373 GGAGACAATAAAAAGATCAGAGG - Intergenic
1110089737 13:71431125-71431147 GGAGGCAATAAGGAAACCCAGGG - Intergenic
1110464666 13:75787645-75787667 TGAGAAAATAAGATCATCCCTGG - Intronic
1111485900 13:88897516-88897538 GATGAGAATAAGAAATTCCCTGG - Intergenic
1111912721 13:94329816-94329838 TGGGACAAAAAAAAAATCCCTGG + Intronic
1112712081 13:102140589-102140611 TGAGAAAATAGGAAAATCCAAGG + Intronic
1113154374 13:107301799-107301821 AAAAACAATAAGAAAAACCCTGG + Intronic
1114155265 14:20095742-20095764 GGAGACAGTGAGGAAATACCGGG - Intergenic
1114465864 14:22922195-22922217 GGAAACCATGAGAACATCCCAGG + Exonic
1115663716 14:35523993-35524015 GGAGACAGAAAGAAAAACCCAGG + Intergenic
1117160195 14:52981883-52981905 GGAGACAATAAAAAGATCAGTGG - Intergenic
1117621897 14:57595798-57595820 GGAAACTATAAGACAAGCCCAGG - Intronic
1117854684 14:60016096-60016118 TGAGGCAAAAAGAAAATCCAGGG + Intronic
1117942120 14:60979740-60979762 TGACCCAATAAGAAAATACCAGG + Exonic
1117970968 14:61250549-61250571 GGAGACAATAAAAAGATCAGTGG + Intronic
1118304344 14:64642264-64642286 GGAGACAATAAAAAGATCAGTGG - Intergenic
1119580456 14:75774504-75774526 GAAGACATTAAGAAAATGCATGG - Intronic
1119681149 14:76593176-76593198 GAGGACAATAAGACAATCACTGG - Intergenic
1120122529 14:80699425-80699447 AGAGTCAAAAAGAAACTCCCTGG - Intronic
1121153782 14:91664130-91664152 GGAGACAGCAAGAAGATCCGTGG - Intronic
1122750540 14:103929273-103929295 GGAGACAGTAAAAAAATCAGTGG - Intronic
1124095332 15:26643795-26643817 GGAGACAATAAGACACTGTCAGG + Intronic
1124375038 15:29124404-29124426 TGAGAAATTAAGAAACTCCCAGG + Intronic
1124475024 15:30025746-30025768 GGAGAAAAAAAAAAATTCCCTGG - Intergenic
1125868974 15:43080391-43080413 GGAGGCAATAAAAAAATCAGTGG - Intronic
1127590454 15:60416862-60416884 GGAGAAAATAAAAAAAGGCCAGG + Intergenic
1127612339 15:60649240-60649262 GGAAAAAAAAAAAAAATCCCCGG + Intronic
1127813084 15:62581183-62581205 GGAGACAGTAAAAAGATCACTGG - Intronic
1128051454 15:64668402-64668424 AGAGACAAAAAGAAAACCCAGGG - Intronic
1130428700 15:83824666-83824688 GGAGACAGTAAAAAGATCCATGG - Intronic
1131231991 15:90666125-90666147 GGGGACAAAAATAAAAACCCAGG + Intergenic
1132739558 16:1404727-1404749 GGAGTCAATAAGGAAAGCGCGGG + Intronic
1135433656 16:22409285-22409307 GGAGACAGTAAAAAGATCACTGG - Intronic
1136002884 16:27309427-27309449 GGAGACAGTAAAAAAATCAGTGG + Intergenic
1138274435 16:55722686-55722708 GGAGAAAATAAATAAATTCCTGG + Intergenic
1138711502 16:58975707-58975729 GGAGACAATAAAAAGATCAGTGG + Intergenic
1139717788 16:68827568-68827590 AGAGAAAATAAGAACATACCAGG + Intronic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140944455 16:79754903-79754925 GGAGAGAAAAAGAAAATTCAGGG + Intergenic
1144314216 17:14044029-14044051 GGAGACAGTAAGAAGATCAGTGG - Intergenic
1146414633 17:32620522-32620544 GGAGGCAAAAAGAAAAGCCAGGG + Intronic
1146547688 17:33753263-33753285 GGAGACAGTAAGAAAATCAGTGG + Intronic
1147650775 17:42060633-42060655 GGAGACAAAGAGAGGATCCCAGG - Intronic
1148642809 17:49201037-49201059 GTAGAGAATAAGAAAATCAGAGG + Intergenic
1150002007 17:61446764-61446786 GGAGACTATCAGAAAATGCTTGG - Intergenic
1151149291 17:72069937-72069959 GGTGACAATAAAAAAATCAATGG - Intergenic
1152245230 17:79181935-79181957 GGAGACAATGAGAGACTCCAGGG - Intronic
1154302336 18:13205121-13205143 GGAGACAATAAAAAGATCAGGGG - Intergenic
1154966587 18:21363667-21363689 GGTGAAAATAAGAAAATCAAGGG + Exonic
1155094208 18:22540479-22540501 GGAGACCATAAGAAAACACAGGG - Intergenic
1157296911 18:46451960-46451982 GGAGACAATAAAAAGATCAGTGG + Intronic
1157307969 18:46530738-46530760 GGGGAAAATAAGAAAATCATGGG - Intronic
1157329433 18:46692700-46692722 ATAGAAAATAAGAAAATACCAGG - Intronic
1157485832 18:48086143-48086165 AGAGAGAAAAAGAAAAGCCCAGG - Intronic
1157525853 18:48381244-48381266 GGAGAGAATCAAAGAATCCCAGG + Intronic
1157583408 18:48786562-48786584 ATAGAAAACAAGAAAATCCCAGG + Intronic
1157679735 18:49595528-49595550 TGAGACAAAAATAAAATCCTGGG + Exonic
1158700947 18:59745660-59745682 GAAGACAATAAAAAGATCCATGG - Intergenic
1160517056 18:79484382-79484404 GGAGGCAGGAAGAAAATCACGGG - Intronic
1161138663 19:2635457-2635479 GGAGAGAAGAGGCAAATCCCAGG - Intronic
1163515730 19:17762540-17762562 TAGGACAAAAAGAAAATCCCAGG + Intronic
1164387433 19:27786324-27786346 GGAGACAGTAAGAAGATCTGTGG + Intergenic
1165273361 19:34729447-34729469 GAAGTCGATAAGAAAACCCCTGG + Intergenic
1167951914 19:53034378-53034400 GGATACAATATGAAAAGCACTGG + Intergenic
925639147 2:5970913-5970935 GGAGACAATAAAAAGATCAGTGG - Intergenic
925673520 2:6336666-6336688 GGAGACATTGTGAAAATACCAGG - Intergenic
929339790 2:40801471-40801493 GAAGACAAAAAGAAAAGGCCAGG - Intergenic
929439730 2:41955539-41955561 GGAGAGAAAAAGAATACCCCAGG - Intergenic
929530148 2:42745449-42745471 AGAAACAATAAGAAAATCAGAGG - Intronic
929726198 2:44430253-44430275 GGAGACAAAAAGAAAATGAAAGG - Intronic
929794700 2:45050018-45050040 GGAGATGAGAAGAAAACCCCTGG - Intergenic
929935275 2:46290333-46290355 GGAGACCAAGAGAAAATCCTCGG + Intergenic
930418296 2:51117841-51117863 TGAGACACAAAGAAGATCCCAGG + Intergenic
931177412 2:59867990-59868012 GGAGACAATAAATAATACCCAGG + Intergenic
933485167 2:82912183-82912205 GAAGACAATAAGAGACTGCCAGG + Intergenic
933851843 2:86373552-86373574 GGAAACAATCAGAAAAATCCAGG + Intergenic
933865545 2:86513313-86513335 GGAGACAGTAATAAAATCAGTGG + Intronic
934577760 2:95413815-95413837 GAAGACACCAAGTAAATCCCAGG + Exonic
934640048 2:96022523-96022545 GAAGACACCAAGTAAATCCCAGG + Intronic
934793602 2:97082881-97082903 GAAGACACCAAGTAAATCCCAGG - Intergenic
935195824 2:100815488-100815510 GGAGACAATAAAAAGATCAGTGG + Intergenic
935272094 2:101443664-101443686 GAAGACAAAAAGAAAACCCAGGG - Intronic
935627909 2:105186142-105186164 AAAGACAATCAGACAATCCCAGG + Intergenic
936034596 2:109100762-109100784 GGAGACAATAAGGACTTCCAGGG + Intergenic
936312389 2:111396756-111396778 GAAGAAAATAAGAAAATAACGGG + Intergenic
936445804 2:112594222-112594244 GGAGAGAATAAGAAGAGGCCTGG - Intergenic
936785205 2:116086687-116086709 AGAGAAAATGAGCAAATCCCAGG - Intergenic
936814941 2:116448688-116448710 GGAGACAAAAAAAAAATCTTTGG + Intergenic
937225170 2:120364532-120364554 GGAGAGAATTAGGAAAACCCAGG + Intergenic
937604152 2:123776270-123776292 GGGAAAAATAAGATAATCCCTGG + Intergenic
939437976 2:142203300-142203322 GGAGATATAAAGAAAATCCTTGG - Intergenic
940539742 2:154997002-154997024 GGAGACAGTAAAAAGATCACTGG + Intergenic
940719630 2:157267958-157267980 GGAGAAAAGAATAAAATCCCAGG + Intronic
941352415 2:164453142-164453164 AGAGACAATAAGAATAATCCCGG - Intergenic
941400744 2:165027268-165027290 GGATACTATAAGAAATTACCTGG + Intergenic
942705604 2:178768349-178768371 GGAGACAATAGAAAAGTCCTTGG - Intronic
943571487 2:189580633-189580655 GAAGGAAAAAAGAAAATCCCTGG - Exonic
943710520 2:191089860-191089882 GGAGACAATAAAAAAGTCAGTGG + Intronic
946151663 2:217777750-217777772 TGAGGCAAAAAGAAAATCCAGGG - Intergenic
946367192 2:219255671-219255693 GGAGACAATTAGAAAATGCAAGG - Intronic
946799668 2:223400124-223400146 CGAGATAATCAGAAAATCTCTGG + Intergenic
946857962 2:223972003-223972025 AAAAACAATAAAAAAATCCCAGG - Intergenic
947159979 2:227204674-227204696 GGATAGAATTTGAAAATCCCTGG - Intronic
947241549 2:228000100-228000122 GGAGACAATAAAAAGATCAGTGG - Intronic
947579592 2:231306780-231306802 GGAGACAATAAGAAACAACATGG + Intronic
948621427 2:239237313-239237335 GGAGAATATAGAAAAATCCCAGG - Intronic
948801844 2:240436597-240436619 GGAGACCCTACGAGAATCCCCGG - Intronic
1171432194 20:25090085-25090107 TGAGACAATAGGAAAATCCTGGG + Intergenic
1173567986 20:44055497-44055519 GGAGACAATAAGAGTACCCATGG + Intronic
1173646877 20:44638898-44638920 GGAGGCAGGAAGAAAATTCCAGG + Intronic
1174876186 20:54228875-54228897 GGGGATAATAAAAAAATCCAGGG - Intergenic
1175045720 20:56103202-56103224 AGAGCCAATCAGAATATCCCTGG + Intergenic
1175583787 20:60121400-60121422 GGAGACATTAGGAAGCTCCCAGG + Intergenic
1176049625 20:63111044-63111066 GGAGGCAATAAGGAAACCCAGGG + Intergenic
1177353381 21:19974794-19974816 GGAGACAGTAAGAAACTCAGTGG - Intergenic
1177413379 21:20761064-20761086 GGAGTTAAAAACAAAATCCCAGG - Intergenic
1177820125 21:26022301-26022323 GGAGACAATAAAAAGATCAGCGG + Intronic
1177846866 21:26299797-26299819 GGAGACAATAAAAATATCAGTGG + Intergenic
1177851113 21:26349787-26349809 GGAGCCAAGAATAAAATCCAAGG - Intergenic
1180899953 22:19363524-19363546 GGAGACAATAAAAAGATCAGTGG + Intronic
1182674087 22:32023967-32023989 TGAGACCCTTAGAAAATCCCAGG - Intergenic
1182728039 22:32464249-32464271 GCAGACAATAATAATAACCCAGG + Intronic
1182966966 22:34531308-34531330 AGAGAGATTAATAAAATCCCTGG + Intergenic
1183761173 22:39819550-39819572 GGAGACAGTAAAAAGATCACTGG + Intronic
1184142734 22:42587728-42587750 CCAGACACTAAGAAAATCCCAGG + Intronic
1184646805 22:45900005-45900027 GAAGACAATATGAAAATTCTGGG + Intergenic
949372253 3:3348074-3348096 GGAGGAAAAAAGAAAAACCCAGG + Intergenic
949428779 3:3949936-3949958 GGAGACAGTAAAAAGATCACTGG + Intronic
949783646 3:7717090-7717112 GAAGAAATTAAGACAATCCCAGG - Intronic
950959212 3:17087463-17087485 GGAGACAATAAAAAGATCAATGG + Intronic
951071836 3:18337913-18337935 TGAGGCAAAAAGAAAATCCAGGG + Intronic
952552853 3:34498545-34498567 GGAGACAGTGACAAAAGCCCTGG + Intergenic
953290047 3:41651185-41651207 GGAGAGAATAACAATATCCAGGG - Intronic
953791668 3:45952279-45952301 GGAAAAAATAAGCAAATCCAAGG - Intronic
954040713 3:47885226-47885248 GGAGACAAAAAGAAAACCCAGGG + Intronic
956676499 3:71738110-71738132 TGAGACAAAAAGAAAACCCAGGG - Intronic
957019508 3:75109296-75109318 GGAGGCATAAAAAAAATCCCAGG - Intergenic
957590374 3:82189441-82189463 GGTGAGAAAAAGGAAATCCCAGG - Intergenic
957794926 3:84991955-84991977 GGAGACAGTAAAAAGTTCCCTGG + Intronic
959568971 3:107861589-107861611 GGTGACAAGAAAAAAAACCCTGG - Intergenic
961327856 3:126120427-126120449 GGAGACAAGAAAAAGATCACTGG + Intronic
962498236 3:135964685-135964707 GGAGACAGTGAGAACAACCCAGG + Intergenic
962677679 3:137768710-137768732 GCAGACAAAAAGAAATCCCCTGG + Intergenic
964255948 3:154773970-154773992 GGAGACAGTAAGAAGATCAGTGG - Intergenic
964882654 3:161441580-161441602 GAAGACAATGAAAAAATACCAGG + Intergenic
966012356 3:175096309-175096331 GGAAAAAATAATAAAAACCCTGG - Intronic
966384891 3:179385999-179386021 TGAGGTAATAAGAAAACCCCAGG + Intronic
970821767 4:20224701-20224723 GGAGACAGGAAGTAAATTCCAGG + Intergenic
971392550 4:26199585-26199607 GGGGAGAGGAAGAAAATCCCTGG + Intronic
972068221 4:34979893-34979915 GTAGAAAATAAGATAATCCAAGG + Intergenic
972397236 4:38667904-38667926 TAAGACATTGAGAAAATCCCGGG + Intronic
972911900 4:43827448-43827470 GGAGACAGTAAGAAAATTAGTGG + Intergenic
973153390 4:46915944-46915966 GGAGAACATAGGAAAATGCCAGG + Intergenic
974354273 4:60791936-60791958 TGAGACAAAAAGAAAACCCAGGG + Intergenic
975240769 4:72056156-72056178 AGAGAGAAGAAGAAAATGCCTGG + Intronic
977090131 4:92662411-92662433 GAAGACAATAAGAAAAATTCAGG + Intronic
979726438 4:123967988-123968010 GGAGATTACAAGAAAATCACAGG - Intergenic
980417868 4:132516467-132516489 CAAAACAATAAGAAAATACCAGG + Intergenic
980772809 4:137399271-137399293 GGAGTCAATAAGCAAATGTCTGG - Intergenic
980832760 4:138151785-138151807 GGAGACAGTAAAATATTCCCAGG - Intergenic
981179777 4:141727017-141727039 GGAGACAATAAAAAGATCAGTGG + Intronic
981185453 4:141796393-141796415 GAAGACAATAAAAAAATCATTGG - Intergenic
981686340 4:147458896-147458918 GGAAACCATGAGAACATCCCAGG + Intergenic
981792064 4:148549441-148549463 GGAGACAGTAAAAAGATCACTGG + Intergenic
982675561 4:158372095-158372117 GGAGGTAATAGGAAAATTCCAGG - Intronic
984074930 4:175164524-175164546 GGAGAAAAAAAAAAAAACCCAGG + Intergenic
984258950 4:177420746-177420768 GGAGACTATAAAAAAATCAGTGG - Intergenic
984448894 4:179873770-179873792 GGAGATAAGAAGAAAAGCACAGG + Intergenic
984987017 4:185341069-185341091 GGAGTCAATAAGAAAGGCCAGGG - Intronic
986251753 5:6065981-6066003 GGAGACAGTAAAAAGATCACTGG + Intergenic
986541238 5:8845918-8845940 TGAGTCACTAAGAAAATCTCAGG - Intergenic
988245142 5:28670550-28670572 AGAGACATAAAGGAAATCCCTGG + Intergenic
988517946 5:31920801-31920823 GGAGACAGTAAGAAGATCCCTGG - Intronic
989158648 5:38369075-38369097 GGAGAAAAAAAGAACATTCCAGG - Intronic
990216274 5:53535930-53535952 GGAGACAATAAAAAGATCAGTGG + Intergenic
990555278 5:56927900-56927922 GGAAACAATAAAAAGATCACTGG - Intronic
990661523 5:58020882-58020904 GGAGAGAAGAAGGAACTCCCTGG - Intergenic
992092790 5:73333517-73333539 TGAGGCAAAAAGAAAATCCAGGG + Intergenic
992924963 5:81573714-81573736 GGACACAATAAAAAAATCCAGGG + Intronic
993001879 5:82388732-82388754 GGAGATAATAAGAGAGTGCCTGG - Intergenic
994189638 5:96855462-96855484 GGAGAAAAGAAAAAAAACCCAGG + Intronic
994382975 5:99093707-99093729 GGACAAAATAAGAAATTACCTGG + Intergenic
995081426 5:108054806-108054828 TGAAACAAAAAGAAAATCCAGGG + Intronic
995083093 5:108076935-108076957 GGAGCCAATAAGAAACCCCTTGG + Intronic
995466514 5:112454800-112454822 GGAGACAGTAAAAACATCACTGG - Intergenic
997046119 5:130320110-130320132 GGAGTCAATAAGAAATTTCCAGG + Intergenic
998051469 5:139039557-139039579 GAGGACAAAAAGAAAATCCAAGG + Intronic
998887940 5:146714082-146714104 GGACAGAAGAAGAAAATCCAGGG + Intronic
999701234 5:154230425-154230447 GGACACAAGTAGAAAATTCCTGG + Intronic
999723393 5:154415724-154415746 GGAGAAAAAAAGAAAGTCCTTGG + Intronic
1000034174 5:157430681-157430703 GGTGCCATTAAGAAAATCCCTGG + Intronic
1000205006 5:159050427-159050449 GGAGACAACAATAAATTTCCAGG + Intronic
1000931677 5:167259719-167259741 GGAGACAAAAAAAAAATCAGAGG - Intergenic
1001420884 5:171586473-171586495 GGAGACAAGGAGAAAAACCAGGG - Intergenic
1001883342 5:175264915-175264937 GCACACACTCAGAAAATCCCTGG + Intergenic
1001997941 5:176176987-176177009 GGAGACCATCAGGAAAGCCCTGG + Intergenic
1002685026 5:181003418-181003440 AGAGACAATAAGAAAATTTCAGG + Intronic
1003250975 6:4428976-4428998 GGAAACAAACAGAAAGTCCCAGG + Intergenic
1004085097 6:12439678-12439700 GAAGACAATAAGAAGCTACCAGG + Intergenic
1004565416 6:16791548-16791570 TGAGACAAAAAGAAAATCCAGGG - Intergenic
1005059744 6:21764562-21764584 GAAGAGAAAAAGAAAATCTCTGG - Intergenic
1006543510 6:34759974-34759996 GGTGACAATAGAAAAATCACTGG - Intronic
1006687149 6:35845092-35845114 GGAGACAATAAAAATATCAGTGG + Intronic
1007228126 6:40328938-40328960 GGAGCCAACTAGGAAATCCCAGG + Intergenic
1007281825 6:40718618-40718640 GGAGACAATAATATAAATCCTGG + Intergenic
1007365035 6:41385305-41385327 GGAGACAATAAAAAGATCAGTGG - Intergenic
1007448753 6:41927156-41927178 GGAAACAATAAGAAAAGCAATGG - Intronic
1007769865 6:44183879-44183901 GGAGACAGGAAGCAGATCCCAGG - Intronic
1007883588 6:45196995-45197017 GGAGAAGAAAAAAAAATCCCTGG + Intronic
1009260931 6:61486679-61486701 GGAGAAAAAGAGAATATCCCAGG - Intergenic
1009416141 6:63418673-63418695 TGAGACAAAAAGAAAATCCAGGG - Intergenic
1009416209 6:63419114-63419136 TGAGACAAAAAGAAAATCCAGGG + Intergenic
1009616644 6:66016732-66016754 GGAGACAGTAAGAAGATCAGTGG - Intergenic
1010470345 6:76219464-76219486 GGAGATAATAAAAATATCCATGG + Intergenic
1011670501 6:89678772-89678794 GGAGACAATAAGAAAATCCCAGG + Intronic
1011982770 6:93403757-93403779 GGAGACCATAAGAAAATATATGG + Intronic
1013160584 6:107540241-107540263 GGAGAAATTAAGATAATCACAGG - Intronic
1014069410 6:117163704-117163726 GGAGAAAAAGAGAATATCCCTGG - Intergenic
1014322932 6:119953773-119953795 GGAGACAATAAAAAGATCAGTGG - Intergenic
1014719514 6:124898898-124898920 GGAGAAAATAAAAAAATCCTCGG - Intergenic
1015033775 6:128628094-128628116 GGAAAGAAAAAAAAAATCCCTGG - Intergenic
1016222616 6:141693603-141693625 GGAGACAGTAAAAAGATCCATGG + Intergenic
1016321623 6:142853051-142853073 GAAGTCAATAAGAAAATAACTGG - Intronic
1016903131 6:149121543-149121565 CGAGGCAAGAAGAAAATCCAGGG - Intergenic
1017187368 6:151615631-151615653 GAAGACACTAAAAAAATCTCTGG + Exonic
1018648719 6:165972833-165972855 GAAAACAGTAATAAAATCCCTGG - Intronic
1018959658 6:168439311-168439333 GGAGAACAGAAGAAAATCCTTGG - Intergenic
1020482898 7:8684098-8684120 GGACATAAGAAGAAAATCCCTGG + Intronic
1022941419 7:35243951-35243973 GGAGATAATAAGAAAGTTCTAGG - Intronic
1024178414 7:46863736-46863758 GGAGACAAAAAATAAAACCCCGG - Intergenic
1024208875 7:47186885-47186907 GGAGACAGGAAGAGATTCCCTGG - Intergenic
1024343037 7:48286360-48286382 GGAGACAGTAAAAAGATCCGTGG - Intronic
1024875462 7:54017642-54017664 GGAGCCAATAAGAAAAGTCCAGG + Intergenic
1024972477 7:55083384-55083406 TGAGTCAAGAAGAAAATCCCAGG - Intronic
1025528824 7:61850184-61850206 GGAGAAAAACAGAATATCCCAGG - Intergenic
1025550223 7:62237267-62237289 GGTGAAAAAAAGAATATCCCAGG + Intergenic
1025575229 7:62630325-62630347 GGAGAAAAAATGAATATCCCAGG - Intergenic
1025586363 7:62793598-62793620 GGCGACAAAATGAATATCCCAGG + Intergenic
1025587731 7:62813554-62813576 GGTGAAAATGTGAAAATCCCAGG - Intergenic
1025591601 7:62866959-62866981 GGCCAAAATGAGAAAATCCCAGG + Intergenic
1025593298 7:62891568-62891590 GGTGAAAAAAAGAATATCCCAGG + Intergenic
1025598534 7:62963996-62964018 GGAGAAAAAAGGAATATCCCAGG + Intergenic
1026158400 7:67847625-67847647 GGAGAGAAAGAGAGAATCCCAGG - Intergenic
1027505691 7:79015505-79015527 GGAAACACAAAGAAATTCCCTGG + Intronic
1027519680 7:79189807-79189829 GGAGACAGTAAAAAGATCCATGG - Intronic
1027602756 7:80259756-80259778 GGAGACATTAAGTAAAGCACGGG - Intergenic
1027617107 7:80436874-80436896 GGAGCCAGTAAAAAAATCCATGG - Intronic
1028940506 7:96517032-96517054 GGAGACAATAAAAAGATCAGTGG + Intronic
1029154400 7:98504877-98504899 TGAGACAAGAAGAAAACCCAGGG - Intergenic
1029883213 7:103838517-103838539 GGGGAGAATAAGAGAGTCCCAGG + Intronic
1030600378 7:111584966-111584988 AGAGGCAATAAGGAAATCCAGGG + Intergenic
1031769236 7:125821789-125821811 GGAAAAAAAAAAAAAATCCCTGG - Intergenic
1032394302 7:131578208-131578230 GGAGACACTGAGAAAATTCCTGG + Intergenic
1032655117 7:133919567-133919589 GGAGACAATAAAAAGATCAGTGG - Intronic
1032783455 7:135182739-135182761 GGAAACAAAAAAAAAATCCTTGG + Intergenic
1033778637 7:144643382-144643404 AGAGATAATAAGATAATTCCAGG - Intronic
1033889251 7:145988573-145988595 AGAGACAATAAAAAGATTCCTGG - Intergenic
1035550267 8:517916-517938 GGAGACAGTAAAAAGATCCGTGG + Intronic
1037287321 8:17315300-17315322 GGAGACAGTAAAAAAATCAGCGG + Intronic
1037939109 8:22938153-22938175 TGAGAGAAAAAAAAAATCCCAGG + Intronic
1038101474 8:24381679-24381701 GGAGAGAATCAGATAATACCTGG - Intergenic
1038699428 8:29836001-29836023 GGAAACAATCAGAAAAACCCAGG - Intergenic
1039752208 8:40488880-40488902 GGAAATACTAAGAAAATTCCTGG - Intergenic
1039815379 8:41089780-41089802 GGAGACGATAACAAGAGCCCAGG - Intergenic
1039972611 8:42333197-42333219 TGAGACAAAAAGAAAAGCCACGG - Intergenic
1040786163 8:51165944-51165966 GGAGGCCATAAGAAAATCCAGGG + Intergenic
1041185359 8:55294488-55294510 GGAGACACTGAGAAAAGCCTTGG + Intronic
1042422089 8:68603012-68603034 GCAGGCAATAAGAAAACCCAGGG + Intronic
1043066862 8:75583624-75583646 GGAGACAACAAGAAGATCAGTGG + Intergenic
1043242312 8:77950643-77950665 GGAGAGAATAAGAAAATGATTGG + Intergenic
1043350060 8:79349451-79349473 GCAGACAAAATGAAAATCTCTGG + Intergenic
1043559776 8:81478957-81478979 AGAGACAATAAATAAATCCATGG - Intronic
1044474274 8:92607829-92607851 GGGGAAAACGAGAAAATCCCAGG - Intergenic
1044848070 8:96401210-96401232 GGAGACAATAAAAAGATCAGTGG + Intergenic
1046471308 8:114678407-114678429 GCAGACATTAAGAAAAAGCCAGG + Intergenic
1047161928 8:122390314-122390336 GGAGACAATAAAAAGATCAGTGG + Intergenic
1047585973 8:126272964-126272986 GGAGACAGTAAGAAGATCAGTGG - Intergenic
1047754211 8:127906274-127906296 CGAGACAGGAAGAAAATGCCTGG + Intergenic
1048898308 8:139014900-139014922 GCAGAGAATAAGGAAATCACAGG + Intergenic
1049856466 8:144865088-144865110 GGACATACTAAGTAAATCCCAGG - Intergenic
1050551479 9:6752407-6752429 GGAAAAAAAAAAAAAATCCCTGG - Intronic
1051275126 9:15391334-15391356 GGAGACAAACAGAATAACCCCGG + Intergenic
1051375350 9:16396840-16396862 GGAGGCGATGAGAAATTCCCAGG - Intergenic
1051947974 9:22595263-22595285 TGAGACAATTAGAGAATACCTGG - Intergenic
1051953909 9:22666435-22666457 GGAGAGTACTAGAAAATCCCAGG - Intergenic
1052582526 9:30377269-30377291 GGAGACATTAAAAATATCACTGG + Intergenic
1054363783 9:64208735-64208757 GGAGAAAAAGAGAATATCCCAGG - Intergenic
1054973897 9:71120786-71120808 GGAGAGAGAAAGAAAAGCCCAGG + Intronic
1055015432 9:71612731-71612753 GGAGACAATAAAAAGATCAATGG + Intergenic
1055062777 9:72087825-72087847 GGAGACAATAAAAATATCAATGG - Intergenic
1055319824 9:75072197-75072219 GGAGGCAAAAAGAAAACCCATGG + Intronic
1056038553 9:82635815-82635837 GGAGACAATAAAAAGATCAGTGG - Intergenic
1056640219 9:88363596-88363618 TGAGGCAAAAAGAAAATCCAGGG + Intergenic
1057028663 9:91756676-91756698 GGAGCCCAGAAGACAATCCCAGG - Intronic
1057061827 9:92010766-92010788 GGAGATAAAAAGAAAAACCAGGG - Intergenic
1057320252 9:94006092-94006114 GGAGGCAAAAAGAAAACCCAGGG + Intergenic
1057320423 9:94007568-94007590 GGAGGCAAAAAGAAAACCCAGGG - Intergenic
1057862766 9:98655053-98655075 GGAGACAATAAAAAGATCGGTGG + Intronic
1058254300 9:102742205-102742227 GGAGACAATAAAAAGATCCATGG - Intergenic
1059298703 9:113295793-113295815 GGAGAAACTGAGAAAAGCCCAGG - Intergenic
1060443301 9:123662127-123662149 GGTTACAATAAGTAAATCACAGG + Intronic
1060447785 9:123707488-123707510 GGAGACAGAAAGAAAAGCCAAGG + Intronic
1185663316 X:1744301-1744323 GTAGTCAAGAAGAAGATCCCAGG + Intergenic
1185810027 X:3099373-3099395 AGATACAACAAGAAAATCCATGG - Intronic
1186346210 X:8695811-8695833 GTATACAATGAGAAAATCACTGG + Intronic
1188249678 X:27876993-27877015 GGAGGCAATAAGGAAACCCAGGG + Intergenic
1188351266 X:29133873-29133895 GGAGACAGTAAAAAGATCACTGG - Intronic
1189058419 X:37725909-37725931 GGAGACAATAAAAAGATCAGTGG + Intronic
1189240624 X:39521853-39521875 GGAGACAATGACAAAATGCCAGG + Intergenic
1189464881 X:41271060-41271082 GGAGATAGTAAGAAGATCACTGG + Intergenic
1191130387 X:57002255-57002277 GGAGAAATTAAGATATTCCCAGG - Intergenic
1193080654 X:77403079-77403101 GGAGAGAATAAGGAAATCCCAGG - Intergenic
1194528095 X:95005358-95005380 GGAGACAGTAAAAGAATCACTGG - Intergenic
1195278058 X:103301725-103301747 TGAGACAATAAGGAAATCAAGGG + Intergenic
1196271135 X:113712232-113712254 GTAGAAAAAAATAAAATCCCAGG + Intergenic
1196324221 X:114383198-114383220 GGAGAAACTAAAGAAATCCCTGG + Intergenic
1196532854 X:116809420-116809442 GGAGGCAATAAGGAAAGCCAAGG + Intergenic
1196702781 X:118689688-118689710 AGAGAAAATAAGAAATTCCATGG + Intergenic
1197043375 X:121967727-121967749 GAATACAAAAAGAAAATTCCTGG + Intergenic
1197853129 X:130885853-130885875 GGAGAAAATAAGACAATCTCTGG + Intronic
1197896194 X:131318127-131318149 GGGGACAATGAGGAAAACCCTGG + Intronic
1197936778 X:131747704-131747726 GTAAACAATTAAAAAATCCCAGG + Intergenic
1198699134 X:139377927-139377949 GAAGATAATAAGAAAATACTGGG - Intergenic
1199071742 X:143483931-143483953 GGAGATAATAAGGAAACCCTGGG + Intergenic
1201289994 Y:12413811-12413833 GCAGACAATGAGAAAACCCTTGG - Intergenic
1202348507 Y:23961240-23961262 GGAGACACTAAGTAAATACATGG - Intergenic
1202522267 Y:25708864-25708886 GGAGACACTAAGTAAATACATGG + Intergenic