ID: 1011670987

View in Genome Browser
Species Human (GRCh38)
Location 6:89682823-89682845
Sequence CTGTGGTCCCAGCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7835
Summary {0: 3, 1: 38, 2: 160, 3: 937, 4: 6697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011670983_1011670987 -3 Left 1011670983 6:89682803-89682825 CCAGGCATGGTGGCATGTGCCTG 0: 2027
1: 10248
2: 34963
3: 80042
4: 140234
Right 1011670987 6:89682823-89682845 CTGTGGTCCCAGCACTCAGGAGG 0: 3
1: 38
2: 160
3: 937
4: 6697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011670987 Original CRISPR CTGTGGTCCCAGCACTCAGG AGG Intronic
Too many off-targets to display for this crispr