ID: 1011672379

View in Genome Browser
Species Human (GRCh38)
Location 6:89695556-89695578
Sequence GGGCTCCTTCCCTGACGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011672379 Original CRISPR GGGCTCCTTCCCTGACGTGC TGG (reversed) Intronic
900474597 1:2870210-2870232 AGGCTCCTGCCCTCACTTGCTGG + Intergenic
901673155 1:10867443-10867465 AGGCTGCTCCCCTGACGTGGAGG - Intergenic
902048868 1:13546203-13546225 GGCCTCCTTCCTTGACATGTGGG + Intergenic
906101948 1:43269695-43269717 GGAAGCCTTCCCTGACTTGCAGG - Intronic
907489340 1:54799210-54799232 CGGCTCCCTCCCTGGAGTGCTGG + Intronic
907903419 1:58762415-58762437 GGGCTCCTTTCCAGAAGAGCTGG + Intergenic
910237172 1:85048172-85048194 GCGCTCCTCCACTGACCTGCGGG + Intronic
913396242 1:118375724-118375746 GGGTTCCTCCCCTGACATGTGGG + Intergenic
915168041 1:153959442-153959464 GGCCCCCTTCACTGAGGTGCTGG + Exonic
915276808 1:154794696-154794718 GGGCTCATTCACAGAGGTGCAGG + Intronic
915304938 1:154971666-154971688 AGGCTCCTTCCCTGGTGTGAAGG - Intronic
915590395 1:156867161-156867183 GGGCTACTGCCCTGAGGAGCTGG + Intronic
920226573 1:204443431-204443453 GGGCTGCCTCCCGGACCTGCTGG + Exonic
923497015 1:234534569-234534591 GGGCCCCTCCCCTGAAGGGCGGG - Intergenic
923565660 1:235074105-235074127 GAGCTCCTGCCCTGCCGGGCGGG + Intergenic
1063966203 10:11347869-11347891 GGGCTCCTCCCATGACATGTGGG + Intergenic
1064652772 10:17526138-17526160 GGGTTCCTTCCATGACATGTGGG - Intergenic
1069419317 10:68232061-68232083 GCGCTCCTTCCCTGAGCTTCGGG - Exonic
1069824587 10:71247299-71247321 GGGAGCCTTCCCTGATGTTCTGG - Intronic
1071311496 10:84347761-84347783 GGGCTCCTTCTCAGACGGGGCGG + Intronic
1072001133 10:91196747-91196769 AGGCTCCTTCCATGCAGTGCTGG - Intronic
1074914029 10:117938583-117938605 GGCCTCTTTCCCTGACTTGTAGG + Intergenic
1076048099 10:127311140-127311162 AGGCTCCTTCCCAGACCTTCTGG - Intronic
1077080000 11:720979-721001 GGGCTCCTCCCCTCCCCTGCCGG - Intronic
1077299530 11:1840635-1840657 GGGCTCCATGTCTGAAGTGCAGG + Exonic
1077425559 11:2474360-2474382 GGTCTCTTTGCCTGATGTGCCGG + Intronic
1077490809 11:2860153-2860175 GGGCTGCTTCCCTGTCCTGGAGG + Intergenic
1079294464 11:19219946-19219968 GGGCTCCATCCCTCTCCTGCAGG - Intergenic
1081675299 11:44965101-44965123 GTGCTCGTGCCCTGACTTGCTGG + Intergenic
1082753600 11:57049288-57049310 AGGCCCCTTCCCTGACATGTGGG + Intergenic
1085689305 11:78652457-78652479 CGGCTCCTTCCCTGAGGACCTGG + Intergenic
1086183164 11:83980291-83980313 GGGCTCTCTTCCTGACTTGCAGG - Intronic
1087155043 11:94894119-94894141 GGGCAGCTTCCCTGATGTGCTGG + Intergenic
1088289897 11:108224616-108224638 AGTCTCCTTCCCTGAAGTGTTGG + Intronic
1090351509 11:126111270-126111292 GGGCTCAGTCCCTTGCGTGCAGG - Intergenic
1090940355 11:131382253-131382275 GGGATCCTTCCTGGAGGTGCAGG + Intronic
1091318418 11:134632480-134632502 CGGCTCCTGCACTGCCGTGCTGG - Intergenic
1092123466 12:6060261-6060283 GTGCTGCTTCCCTGCCCTGCTGG - Intronic
1093370037 12:18355078-18355100 GGCCTCCTTCCATGACGTGGAGG + Intronic
1095089234 12:38088300-38088322 GTGCTCCTTCCCTTTCCTGCTGG + Intergenic
1097194583 12:57236456-57236478 GGGCTCCAGCCCTGAGATGCCGG + Intronic
1099766861 12:86998354-86998376 GGACTCCTTGTCTGACATGCAGG + Intergenic
1101579054 12:106025359-106025381 GGGCTCCCTTCCTGGCTTGCAGG - Intergenic
1102031042 12:109740309-109740331 TGGCACCTTCCCTGACATGGGGG - Intronic
1104676177 12:130713991-130714013 CGGCTCCTCCCCAGACCTGCTGG + Intronic
1104716362 12:131018912-131018934 GGGCTCCTGCCCCCACCTGCAGG - Intronic
1106475345 13:30093565-30093587 GGGCTCTCTTCCTGACTTGCAGG - Intergenic
1108042070 13:46348506-46348528 AGGCTCCTTCCATGACATGTGGG - Intronic
1108447353 13:50522904-50522926 GGACTTCATCCCTGAAGTGCAGG - Intronic
1108455948 13:50613799-50613821 TGGCTCCTTCTCTGACCTGTTGG - Intronic
1110630090 13:77697816-77697838 CGGCTCCTTCCCTGTCGCCCCGG - Intergenic
1115767838 14:36642399-36642421 GGGCTCAGTCCCTGAAGCGCTGG - Intergenic
1116515959 14:45805792-45805814 GGGCTCCCTCCCTGACATGGTGG + Intergenic
1118366654 14:65102271-65102293 GGGCTTCTTCCTTCCCGTGCGGG - Intronic
1121814057 14:96915552-96915574 AGGCCCCTTCCCTGACATGCAGG - Intronic
1122179726 14:99946476-99946498 GGGCTCCTTCCATCTCCTGCCGG + Intergenic
1122738743 14:103858651-103858673 GGCCCCCTCCCCTGACGGGCCGG + Intergenic
1123002780 14:105305072-105305094 GGGCTGCTTCCCTCATGAGCGGG + Exonic
1124085874 15:26549950-26549972 GGGCTCACTGCCTGATGTGCTGG - Intronic
1124636254 15:31366689-31366711 GGGCTCACTCCCTGAAGGGCCGG + Intronic
1125575733 15:40754587-40754609 GGGCTCCTACCGTGGCGTCCGGG + Exonic
1127276620 15:57451331-57451353 GGGAACCTTCCCTGACTTGGTGG - Intronic
1128088885 15:64905612-64905634 GGCCTCCATCACTGTCGTGCCGG + Intronic
1130547423 15:84867437-84867459 GTTCTCCATCCCTGAGGTGCTGG + Intronic
1131232423 15:90669354-90669376 GGGGTCCTGCTCTGTCGTGCAGG + Intergenic
1133039007 16:3050043-3050065 CTGCTCCCTGCCTGACGTGCTGG + Exonic
1137847983 16:51710589-51710611 GGGCCCCTCCCCGGACCTGCTGG + Intergenic
1138512206 16:57515267-57515289 GGGCTCCGTCCCTGACCGGAGGG + Intronic
1138895311 16:61197614-61197636 GGGCTCCTCCCATGACATGTGGG - Intergenic
1140270920 16:73465621-73465643 GGGCTCCTCACCTGGGGTGCAGG - Intergenic
1140470167 16:75209336-75209358 GGGCTCCTTCCTCGCCGTTCGGG - Intergenic
1141836077 16:86540519-86540541 GGGCCCCTTCTATGACGCGCAGG + Intronic
1142755603 17:2014804-2014826 GGAGTCCTTCCCTGTCGTCCAGG - Intronic
1143935855 17:10483228-10483250 GGGTGCCTTCCATGACGTGTGGG + Intergenic
1146642970 17:34555182-34555204 GGGCTCCTGCCCTGCCAGGCGGG + Intergenic
1150701237 17:67448417-67448439 GGGCAGCTTCCCTGACTTGCAGG + Intronic
1150790234 17:68196890-68196912 CGGCTCCTTCCCCGACCTGGGGG - Intergenic
1151387780 17:73765660-73765682 GGGATCTTTTCCTGGCGTGCCGG + Intergenic
1151514470 17:74583416-74583438 GGCCTCCCTCCCTGGCTTGCAGG - Intronic
1151874241 17:76857440-76857462 GGGCTCCCTCCCAGAGATGCAGG - Intergenic
1152565061 17:81096653-81096675 GGACTCCTTTCCTGACCTTCAGG - Intronic
1152680694 17:81666432-81666454 GGGCTCCTCCCGGTACGTGCGGG + Exonic
1152865044 17:82717230-82717252 GGGTTCCTGCCCTGCGGTGCTGG + Intronic
1153389064 18:4534039-4534061 GGGCTCCCTCCCTGACACGTGGG + Intergenic
1160779020 19:869631-869653 GGGCGCCTTCCCGGAGGTCCCGG + Intronic
1164151500 19:22556831-22556853 GGGCTCTCTTCCTGGCGTGCAGG - Intergenic
1167348579 19:48961836-48961858 GGCCTGCTCTCCTGACGTGCCGG - Intergenic
1168336928 19:55602282-55602304 GGGCTCCTGCCCTGACTTGGGGG - Exonic
925035798 2:684744-684766 AGGCTCCTCCCCTGACATGTGGG - Intergenic
925811956 2:7709795-7709817 GGGCTCTTTTCCTGGCTTGCAGG - Intergenic
929977948 2:46653398-46653420 GGGCTTCTTCCCAGAGGTGAAGG - Intergenic
930052259 2:47225612-47225634 GGGCTCTTTCCCTGAACAGCTGG + Intergenic
930833060 2:55765878-55765900 GGGCTCCTCCCATGACATGTGGG + Intergenic
931216888 2:60253654-60253676 GGCCTCCTTCCCTGTTATGCTGG - Intergenic
932411496 2:71550506-71550528 GGGCTCCATCCCTGGCCTCCTGG + Intronic
932580450 2:72989886-72989908 GGACTCCTGGCCTGACGGGCCGG + Intronic
934519963 2:95013929-95013951 GGGGTCCTTCTCTGGTGTGCAGG + Intergenic
936013822 2:108942956-108942978 CGGCCCCTTCGCTGACGTGCAGG + Intronic
936159799 2:110076287-110076309 GGGCTCTGTCCCTGGCTTGCAGG + Intergenic
936184866 2:110295066-110295088 GGGCTCTGTCCCTGGCTTGCAGG - Intergenic
937221692 2:120345966-120345988 GCGCCCCTTCCCTGCCGCGCGGG + Intergenic
937538889 2:122924615-122924637 GGCCTCCTTCCATGAAGTGGGGG + Intergenic
939153916 2:138502107-138502129 GGGCGCCTACCTGGACGTGCTGG - Exonic
942727648 2:179027238-179027260 GGGTTCCTCCCATGACGTGTGGG - Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948750637 2:240130500-240130522 GGGCAGCTGCCCTGACGTGGAGG + Intronic
1169717019 20:8631180-8631202 AGGCTCCATCCCAGACCTGCTGG - Intronic
1174297747 20:49561109-49561131 TGGCTGCTTCCCTGAACTGCTGG - Intronic
1175731605 20:61358048-61358070 GCGCTCCTTCCCTGTCGCTCTGG + Intronic
1177264715 21:18767308-18767330 GGGCTTCCTTCCTGACTTGCAGG + Intergenic
1178793559 21:35722531-35722553 GGGGTCCTCCCATGACGTGTGGG + Intronic
1179524361 21:41966057-41966079 GGGCGCCTTCCCTGGCATGCAGG + Intergenic
1180013166 21:45064770-45064792 TGGCTCCTTCCCGGACCTCCTGG - Intergenic
1181139374 22:20792809-20792831 TGGCTCCTTCCCACAAGTGCAGG - Intronic
1181455625 22:23058746-23058768 GGGCTCCTTCCCTGCAGTGAAGG - Intergenic
1181724940 22:24805163-24805185 TGGCTCCCTCCCCGACATGCAGG - Intergenic
1181791458 22:25270439-25270461 GGGCTCTTTTCCTGTCTTGCAGG + Intergenic
1182688043 22:32135865-32135887 GAGCTCCTTCCCGGAGCTGCTGG - Intergenic
1183617376 22:38953903-38953925 GGGCTCCTTCTCTGCCCCGCGGG + Intronic
1183911360 22:41081917-41081939 GGTCGCCTTCCCTGCTGTGCAGG + Intergenic
1184608354 22:45587024-45587046 GGGCTGCTTCTCAGACCTGCGGG + Intronic
1185136399 22:49075730-49075752 GGGCTCCTTCCCAGAGAGGCAGG + Intergenic
954000550 3:47553565-47553587 GGCCTCTTTCTCTGACGTGCAGG - Intergenic
956557918 3:70542186-70542208 GGCCTCCTTCCTTGAAGTGGAGG + Intergenic
961306542 3:125961543-125961565 GGCCTCCATCCCAGAAGTGCAGG + Intergenic
963345010 3:144085158-144085180 TGGCTCCTTTCCTGACCTGAAGG + Intergenic
963761298 3:149289245-149289267 GGCCTCCTTCCATGAGGTGGGGG - Intergenic
965320672 3:167248736-167248758 GGCCTCCTTCCGTGAGGTGGGGG - Intronic
968625198 4:1623873-1623895 GGGCTCCCTCTCTGGCGGGCGGG + Intronic
968699700 4:2048700-2048722 GGGCTCCTTCCAGGACTTGGGGG + Intergenic
969217147 4:5731625-5731647 GAACGCCTTCCCTGAAGTGCTGG + Exonic
970425972 4:15946740-15946762 GGCCTCCTCCCCTTACGTGATGG + Intergenic
974455403 4:62124023-62124045 GGGTTCCTTCCATGACATGTGGG + Intergenic
976531471 4:86158268-86158290 GGGTTCCTTTCCGGAGGTGCTGG - Intronic
980988696 4:139719412-139719434 GGGTTCCTTCCCTGGCCTCCCGG - Exonic
981709162 4:147691883-147691905 AGGCTCCTCCCCTGACATGTGGG + Intergenic
982745079 4:159098215-159098237 TGGCTCCTTCCCTGGCCTCCTGG - Intergenic
983478114 4:168240954-168240976 GGGTTCCTTCTATGACATGCGGG - Intronic
984698095 4:182799464-182799486 GGGGTCCTTCCCTGACCAGAAGG - Intronic
986812347 5:11373597-11373619 GGGCCCCTCCCCTGAGGTCCTGG - Intronic
987216462 5:15743020-15743042 GGGTTCCTCCCATGACATGCAGG + Intronic
1002444124 5:179278726-179278748 GGGCTCTGTCCCTGACCTTCAGG + Intronic
1002524438 5:179807262-179807284 GGGCTCTTTCCCGGGCGTGAGGG + Intronic
1003325362 6:5086256-5086278 GCGCTCCTTCCTGGACGTGCCGG + Exonic
1005254568 6:23986868-23986890 GGGCTCCTTCCTGGACCTGCAGG - Intergenic
1006401846 6:33822341-33822363 GAGCCCCTTCCCGGAGGTGCTGG + Intergenic
1010309697 6:74370477-74370499 GGCCTCCTTCCTTGGCTTGCTGG - Intergenic
1011672379 6:89695556-89695578 GGGCTCCTTCCCTGACGTGCTGG - Intronic
1013111710 6:107069801-107069823 GATCTACTTCCCTGACATGCAGG - Exonic
1013306932 6:108856780-108856802 GGGCTCTTTCGCTGAGGTGGAGG - Intronic
1014844386 6:126257968-126257990 GGCCTTCATCCCTGACCTGCTGG - Intergenic
1015265683 6:131289859-131289881 GGGCTCCCTGCCTGATGTGCTGG - Intergenic
1015329387 6:131959453-131959475 GGCCTCCTGCCCTCACATGCAGG - Intergenic
1015675120 6:135737251-135737273 GGGTTCCTTCCATGACATGTGGG + Intergenic
1015701400 6:136039240-136039262 GGGATCCTTCCCAGGCATGCTGG - Intronic
1018383345 6:163280661-163280683 GGGCTCTTTTCCTGGCTTGCAGG + Intronic
1019147662 6:169985357-169985379 GGGCTCCGTCCCAGCGGTGCCGG + Intergenic
1019314675 7:379023-379045 GGGCTCCTTCCCTGGGTCGCAGG + Intergenic
1021256992 7:18404918-18404940 GGGCTGGTTCCCTGAGCTGCTGG - Intronic
1021932610 7:25596662-25596684 GGGCTCCTGCCCGGACTTACAGG + Intergenic
1022315806 7:29244550-29244572 GGGCTCCTTCCTGGTGGTGCAGG - Intronic
1022471044 7:30682123-30682145 GGGCTCCTTCTCTCGCGCGCTGG - Intronic
1022498893 7:30870440-30870462 TGGCTCCTTCCCAGGCCTGCTGG + Intronic
1023191713 7:37590122-37590144 GGGCTCCTACCCTCTCTTGCTGG + Intergenic
1024264749 7:47598062-47598084 GGCCTTCTTCCATGACGTGTGGG - Intergenic
1024904747 7:54363913-54363935 GGGCTCCTTCCACCACGTGAAGG - Intergenic
1029672364 7:102042261-102042283 AGGCTCCTACCCTGACATTCCGG + Intronic
1034399494 7:150852697-150852719 GGGCACCTTCTGTGATGTGCTGG - Intronic
1034491856 7:151397091-151397113 GGTCTCCTCTCCTGAGGTGCAGG - Intronic
1035276185 7:157749292-157749314 GGCCTGCGTCCCTGAGGTGCGGG + Intronic
1035398417 7:158549924-158549946 GGCCTGCTTCCCTTTCGTGCTGG - Intronic
1035403778 7:158586086-158586108 GGGCTACATCCCAGAGGTGCGGG + Intronic
1035935348 8:3831268-3831290 GGGCAGCTCCCCTGACGAGCAGG - Intronic
1037396568 8:18449881-18449903 GGGCTCTTTGCCTGAATTGCAGG + Intergenic
1037987474 8:23299024-23299046 GCTCCCCTTCCCTGAGGTGCTGG - Intronic
1038535767 8:28351905-28351927 GGGCTCCGTCCCTGGCTTGCTGG - Intronic
1039840633 8:41290610-41290632 TGGCCCCTTCCCTGACGGCCAGG + Intronic
1044591217 8:93916518-93916540 GGGCTGCTCCCCTGTCGTGCAGG - Intronic
1047987091 8:130246410-130246432 AGGCCCCTTCCCTGACATGTGGG - Intronic
1049452293 8:142668812-142668834 CGTCTCCATGCCTGACGTGCAGG - Intronic
1049526312 8:143128429-143128451 TGGCTCCTTCCCTAACCTGCTGG - Intergenic
1053662265 9:40292237-40292259 TGGCTTCTTCCATGTCGTGCTGG - Intronic
1054522345 9:66084047-66084069 TGGCTTCTTCCATGTCGTGCTGG + Intergenic
1055242130 9:74197739-74197761 GGGCTCCCTCCCAGACGGGGCGG - Intergenic
1057568357 9:96184600-96184622 GGGCTCCCTGCCTCAGGTGCCGG + Intergenic
1061668688 9:132175519-132175541 GGGCTCCTTCCTAGAGGGGCCGG + Intronic
1061888907 9:133607412-133607434 GGGCTCCTTGCCCTACCTGCTGG + Intergenic
1061985155 9:134126372-134126394 GGGCTCCTCCCCAGACCTACCGG + Intergenic
1062047867 9:134432723-134432745 GTGCTCCTGCCCTCACGTGCCGG - Intronic
1062500841 9:136851364-136851386 AGGCTCCTTCCGTGACCTGCAGG + Intronic
1190242559 X:48668728-48668750 GGACTCCTTCCCTGACACCCTGG - Intergenic
1195321416 X:103724670-103724692 GAACTCCTTCCCTGAGCTGCAGG + Intronic
1200292705 X:154887151-154887173 GGGCGCCTTCTCGGACGTGCTGG + Exonic
1200339549 X:155382891-155382913 GGGCGCCTTCTCGGACGTGCTGG + Exonic
1200346921 X:155457802-155457824 GGGCGCCTTCTCGGACGTGCTGG - Exonic