ID: 1011682021

View in Genome Browser
Species Human (GRCh38)
Location 6:89792507-89792529
Sequence TGGGGGGTAAAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1837
Summary {0: 1, 1: 2, 2: 10, 3: 165, 4: 1659}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011682007_1011682021 19 Left 1011682007 6:89792465-89792487 CCCTAAACATAATCTAGGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG 0: 1
1: 2
2: 10
3: 165
4: 1659
1011682009_1011682021 18 Left 1011682009 6:89792466-89792488 CCTAAACATAATCTAGGTTGGGA 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG 0: 1
1: 2
2: 10
3: 165
4: 1659
1011682004_1011682021 26 Left 1011682004 6:89792458-89792480 CCTAATGCCCTAAACATAATCTA 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG 0: 1
1: 2
2: 10
3: 165
4: 1659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011682021 Original CRISPR TGGGGGGTAAAGAGGGAGGA GGG Intronic
900001286 1:16164-16186 TGGGGGCTAGAGAGGAAGCAGGG - Intergenic
900021005 1:186686-186708 TGGGGGCTAGAGAGGAAGCAGGG - Intergenic
900084031 1:878528-878550 GAGGGGGTAAAGAGGGAGTTGGG - Intergenic
900244138 1:1629919-1629941 TGGGGTGTGATGGGGGAGGAGGG - Intronic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900628815 1:3623132-3623154 GGGGGGAGAAAGAGGGAGAATGG - Intergenic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900805347 1:4763862-4763884 TGGGGGAGAAAGAGGGAGGGAGG - Intronic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
900852711 1:5156695-5156717 AGGGAGGGAAAGAGGGAGCAGGG + Intergenic
900859074 1:5212230-5212252 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
901026072 1:6279353-6279375 TGGGGGCAGATGAGGGAGGAAGG + Intronic
901037995 1:6347944-6347966 TGGGGAGGAAAGATGAAGGAGGG - Intronic
901192284 1:7419830-7419852 TGGGGGGTGGAGAGGAAGAATGG - Intronic
901319597 1:8331534-8331556 TGGAGGCTGAAGAAGGAGGATGG + Intronic
901424350 1:9171981-9172003 GGGAGGCTAAAGTGGGAGGACGG + Intergenic
901469831 1:9448607-9448629 TGCAGGGTGAAGTGGGAGGAGGG - Intergenic
901641037 1:10693199-10693221 TGGGGGCTAAAGAGGCAGGTGGG + Intronic
901652161 1:10749231-10749253 TAGGGGGGAAAGATGGAGGGAGG - Intronic
901705872 1:11072662-11072684 TGGGGGGAAAAGAGGAGAGAAGG + Intronic
901724285 1:11228534-11228556 TTGGGAGTTAAGGGGGAGGAAGG + Intronic
901751661 1:11413813-11413835 GGAGGAGGAAAGAGGGAGGAGGG - Intergenic
901751680 1:11413876-11413898 GGAGGAGGAAAGAGGGAGGAGGG - Intergenic
901751687 1:11413897-11413919 GGAGGAGGAAAGAGGGAGGAGGG - Intergenic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
902036551 1:13462429-13462451 GGGAGGGTAAGGTGGGAGGATGG - Intergenic
902099213 1:13971891-13971913 TGGAAGGCAAAGGGGGAGGAAGG - Intergenic
902218088 1:14947274-14947296 AGGGTGGGGAAGAGGGAGGATGG + Intronic
902242122 1:15096166-15096188 TGTGGGGTAAGGGGGCAGGAGGG - Intronic
902553350 1:17232343-17232365 CAGGGGGTGAAGTGGGAGGATGG - Intronic
902785630 1:18730932-18730954 TGGGGGGAAATGGAGGAGGAAGG + Intronic
902972374 1:20063089-20063111 TGGAGGGTGAGGTGGGAGGATGG + Intronic
902981273 1:20125033-20125055 AGGGCGGGAAAGAGGGAGGAGGG + Intergenic
902999023 1:20251268-20251290 TGAGGGGTGGAGTGGGAGGAGGG - Intergenic
903179606 1:21598510-21598532 GGGGGTGGAAAGAGGGAGGGAGG + Intronic
903509456 1:23863745-23863767 GGGAGGCTAAAGTGGGAGGATGG + Intronic
903649908 1:24916127-24916149 TGTGGGGTGAAGTGGGAGTAGGG - Intronic
903687408 1:25141959-25141981 TCAGGGGTAAAGAGAGAGGTTGG - Intergenic
903737805 1:25541402-25541424 GGGGAGGAAAGGAGGGAGGAAGG + Intergenic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
903993089 1:27288036-27288058 AGGAGGGCAAAGAGGGAGGAAGG - Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904193594 1:28766935-28766957 TGGGGGGTGAGCTGGGAGGATGG - Intronic
904301503 1:29557471-29557493 TGGGAGGGAGAGAGGGAAGAAGG + Intergenic
904315362 1:29656540-29656562 TGGGAGGAAAAAAGGGAGGGAGG - Intergenic
904382568 1:30121236-30121258 TGGAGGGCAAAGAGGAAGCAAGG + Intergenic
904416931 1:30368728-30368750 TGGGATGTGAAGAGGGAGAAGGG - Intergenic
904521755 1:31101271-31101293 GGTGGGGTAGAGAGGGAGGAAGG + Intergenic
904644821 1:31957829-31957851 TGAGGGGTAGAAAGGGAAGAGGG - Intergenic
904888366 1:33759261-33759283 TGAGGGGGAGAGAGGTAGGAAGG + Intronic
905096718 1:35478268-35478290 TGTGGGGGTAAGAGGGAGGGGGG + Intronic
905136954 1:35807757-35807779 TGGGGTGGGAGGAGGGAGGAGGG + Intergenic
905137528 1:35811046-35811068 TGGTGGCTGAAGTGGGAGGATGG + Intronic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905352120 1:37355093-37355115 GGGAGGGAAAAGAGGAAGGAGGG + Intergenic
905452594 1:38066270-38066292 TGGGGGTAAATGAGGTAGGAAGG - Intergenic
905462452 1:38130578-38130600 TTGGGGGGAAAGGGGGAGGGAGG - Intergenic
905516061 1:38563013-38563035 TGGGGGGTAAGGAGAAAGGGTGG - Intergenic
905533836 1:38702971-38702993 TGGGGGGCAAAGAGAGGAGAGGG + Intergenic
905753411 1:40486393-40486415 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
905765522 1:40596902-40596924 TTGGGGGAAAAAAGGGAGCAAGG - Intergenic
906254658 1:44338990-44339012 GGGGGGGCAAGGAGGGAGGGAGG - Intronic
906324925 1:44839608-44839630 TGGGGAATGGAGAGGGAGGAAGG + Intronic
906331841 1:44891976-44891998 GGGAGGCTAAAGTGGGAGGATGG - Intronic
906378508 1:45316517-45316539 TGGAGGGTAATGAGAGAGGCTGG - Intergenic
906470893 1:46130130-46130152 TGGGAGGTGAGTAGGGAGGAGGG - Intronic
906532650 1:46532551-46532573 TGGGAGGAAGAGAGGGAGAAGGG - Intergenic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
906805718 1:48777040-48777062 AGGGGGGGAAAGGGGGACGAGGG + Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907052708 1:51340506-51340528 GGGGCGGTGATGAGGGAGGAGGG - Intronic
907091520 1:51729807-51729829 TGGGGGGTGAAGGGGGTGAAGGG + Intronic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
907474910 1:54699256-54699278 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
907527596 1:55062987-55063009 TGGGTGGGAGAGGGGGAGGATGG + Intronic
907665560 1:56431228-56431250 TGGGAGGGAGAGAGGGAGGGAGG + Intergenic
907977392 1:59445137-59445159 AGGGAGAGAAAGAGGGAGGAGGG + Intronic
908089340 1:60669992-60670014 TGTGGAGTAAAGAGGAAGGAGGG + Intergenic
908518034 1:64913618-64913640 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
908806207 1:67936075-67936097 TAGGAGGTAAAGAGGGATCATGG + Intergenic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909497030 1:76289879-76289901 TGAAGGGAACAGAGGGAGGAGGG + Intronic
909738755 1:79001176-79001198 GGGGGGGGAGGGAGGGAGGAAGG + Intronic
909799023 1:79781680-79781702 TCAGGAGTAAAGAGGAAGGAGGG - Intergenic
909947819 1:81683441-81683463 TGGGGGGAAGAGTGGGAGGGAGG - Intronic
910078148 1:83304860-83304882 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910230475 1:84981679-84981701 TGGGGGATAAAGGGGCAGTAGGG + Intronic
910363246 1:86436356-86436378 AGGGAGGTAGGGAGGGAGGAAGG - Intronic
910489486 1:87753099-87753121 AGGAGGGAAGAGAGGGAGGAAGG - Intergenic
910499293 1:87871090-87871112 TGGGAGGAAGAGAGGAAGGAAGG + Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
910937344 1:92495241-92495263 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
912050655 1:105524663-105524685 TGGGGGGAAAAAAGGCAGGGTGG + Intergenic
912065552 1:105736472-105736494 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912832502 1:112966223-112966245 AGGGAGGAAAAGAGGGAGGTGGG - Intergenic
912958512 1:114173958-114173980 TGCTGGGTAAAGAGGGAGGTGGG + Intergenic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
914362266 1:146945083-146945105 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
914394728 1:147254399-147254421 TGGGAGGAAGTGAGGGAGGAAGG + Intronic
914679848 1:149931428-149931450 TGGGTGATAAAGAGGAAGAAGGG + Intronic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
914815407 1:151059068-151059090 TGGGGGCTTAAGAGGAAAGAGGG + Exonic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915511464 1:156389044-156389066 GAGGGGGTTAAGAGGGAGGGAGG - Intergenic
915851642 1:159330324-159330346 TGGGGGGTAGATTGGGGGGATGG - Intergenic
915885431 1:159716499-159716521 TGGGAGGGAGAGAGGGAGGAAGG + Intergenic
916197500 1:162238198-162238220 TGGGGGAGAAGGAGGGAGAATGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916238086 1:162610841-162610863 AGGAAGGAAAAGAGGGAGGAAGG + Intergenic
916372600 1:164116471-164116493 TGGGGTGTGGGGAGGGAGGAGGG - Intergenic
917791947 1:178504591-178504613 TGACGGGTCAAGAGGGAGGAAGG + Intergenic
917813786 1:178687006-178687028 TGGAGAGTAGAGATGGAGGAAGG + Intergenic
917840496 1:178973681-178973703 TGAGGGGTAAGGAGGGATGAGGG + Intergenic
917904118 1:179572775-179572797 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
918094270 1:181321729-181321751 TGGGGGGAAAGGAGGCAGGACGG + Intergenic
918122230 1:181550038-181550060 TTGGGGGTAATTAGGGAGGAAGG + Intronic
918273311 1:182924826-182924848 GGTGGGGGAAGGAGGGAGGAAGG + Intronic
918373688 1:183887163-183887185 AGGGAGGAAAAGAGGGAGGGAGG - Intronic
918502843 1:185217576-185217598 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
918801498 1:188978391-188978413 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
918801522 1:188978456-188978478 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
918802008 1:188984792-188984814 AGGGTGGGAGAGAGGGAGGAAGG - Intergenic
919009178 1:191937502-191937524 TGGGGGGTTATGGGGGAGGTGGG + Intergenic
919653816 1:200178507-200178529 TGGAGTGTAAAGTGGGAGGCTGG - Intergenic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
920097187 1:203493953-203493975 TGGGGGGTGAAGCGGAAGGTGGG + Intergenic
920245726 1:204585941-204585963 TTGGGGGTTCAGAGGGAGGGCGG + Intergenic
920377812 1:205518793-205518815 TGGGTGGCACAGAAGGAGGAAGG - Intronic
920611749 1:207446843-207446865 AGGGGAGTATAAAGGGAGGATGG - Intergenic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921219035 1:212960347-212960369 TGAGGGGTAAAGTGGTAAGATGG + Intronic
921305395 1:213791585-213791607 TGGGAGGTAAAGAGGGAGGAAGG + Intergenic
921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG + Intronic
921850853 1:219930366-219930388 AGGAGGCTAAAGTGGGAGGAAGG + Intronic
922479386 1:225928449-225928471 AGGGGAGTGAAGAGGGAGGAAGG - Intergenic
922707648 1:227797762-227797784 TGGGAGGTGAGGTGGGAGGATGG + Intergenic
923052138 1:230396363-230396385 TGGGGAGCAAAGGGGGAGGAGGG - Intronic
923367061 1:233272990-233273012 TGGGGGAAAGAGTGGGAGGAGGG + Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923482491 1:234397541-234397563 AGGAGGGGAAAGAGGGAGGGGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923648734 1:235851397-235851419 TGGGGGGAAGAGTGGGAGGGGGG + Intronic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
923774412 1:236965866-236965888 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
923784494 1:237054297-237054319 GGAGGGGAGAAGAGGGAGGAAGG - Intronic
923821444 1:237447828-237447850 GGGAGGGGAAAGAGGGAGGGAGG - Intronic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
924665143 1:246063622-246063644 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
924728711 1:246692735-246692757 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1062989607 10:1803579-1803601 TGAGAGGTAAAGAGGGAAGGAGG + Intergenic
1063040481 10:2332605-2332627 TGGGGATTAAAGAAGGAGGATGG - Intergenic
1063081920 10:2775453-2775475 AGGGTGGAAAAGAGGCAGGAAGG - Intergenic
1063087399 10:2832181-2832203 TGGGGGCTTCAGAGGGAGCATGG - Intergenic
1063405261 10:5788387-5788409 TGTGGGGGAAAGAGGAAGGAGGG - Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1063917868 10:10902920-10902942 GGGAGGGAAAAGCGGGAGGAAGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064115356 10:12572870-12572892 TGGGAAGAAAAGTGGGAGGATGG - Intronic
1064142161 10:12799451-12799473 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1064409501 10:15092835-15092857 GGGGGGGAAGAAAGGGAGGAGGG + Intergenic
1064848814 10:19686760-19686782 TGGAGGGTAGGGAGTGAGGATGG + Intronic
1065494976 10:26318535-26318557 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065624235 10:27614402-27614424 TCGGGGGTGAAGGAGGAGGAAGG - Intergenic
1065689134 10:28315339-28315361 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1065834013 10:29640751-29640773 TGGGGTGGAAGGAGAGAGGAAGG - Intronic
1065867337 10:29925514-29925536 TGGAGCATAAAGCGGGAGGAAGG + Intergenic
1065874186 10:29982977-29982999 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066656595 10:37703490-37703512 TGGGGGCACAAAAGGGAGGATGG + Intergenic
1066761923 10:38763083-38763105 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1067147001 10:43701338-43701360 TTGGGGGTACAGAGGCTGGAAGG + Intergenic
1067292599 10:44955093-44955115 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1068051614 10:51957182-51957204 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1068555642 10:58455799-58455821 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1068789237 10:61009178-61009200 TGGGGGGCCAAGTTGGAGGATGG - Intergenic
1068945988 10:62729278-62729300 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1069260638 10:66390876-66390898 TAGGAGGTAAAGAGGAAGAAGGG - Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069391527 10:67940880-67940902 TGGGAGGTAAAAAGTGGGGAAGG - Intronic
1069426799 10:68295386-68295408 TGGAGGTTGAAGTGGGAGGATGG + Intronic
1069577487 10:69541219-69541241 TGGAGGGTTCAGTGGGAGGAGGG + Intergenic
1069620920 10:69836815-69836837 TGGGGTTTAAAGAGGAAGGCAGG - Intronic
1069646865 10:70006190-70006212 TGGGGGGGCAATAGGGAGTATGG + Intergenic
1070127897 10:73636558-73636580 TGGAGGGTGAGGTGGGAGGATGG - Intronic
1070361839 10:75698165-75698187 TGGGGTGGGAACAGGGAGGAAGG - Intronic
1070363624 10:75714822-75714844 AGGGAGGGAAAGAAGGAGGAAGG - Intronic
1070495225 10:77015336-77015358 TGTGGGGTCAAGGGGAAGGAGGG - Intronic
1070576291 10:77681514-77681536 TGTGGGGCAGAGAGGGAGGTAGG - Intergenic
1070655523 10:78268629-78268651 TGGGGGGTAAGGGGGTTGGAGGG - Intergenic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070953311 10:80447980-80448002 AGGAGGGAAAAGAGGGAGGGAGG - Intergenic
1071073973 10:81729588-81729610 GGGGGGGGAAAGAGAGAGGAAGG + Intergenic
1071160476 10:82740139-82740161 AGGAAGGGAAAGAGGGAGGAAGG - Intronic
1071497555 10:86179296-86179318 AGGGAGGGGAAGAGGGAGGAGGG - Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071744981 10:88407043-88407065 TGGGGGGAAGAATGGGAGGAGGG + Intronic
1072248900 10:93566634-93566656 AGGCGGGGAAAGAGGGAGGGAGG - Intergenic
1072378950 10:94847218-94847240 TGGGGTGGAGGGAGGGAGGAGGG - Intronic
1072453743 10:95559472-95559494 TGTGGGGTAAAGAGTTGGGAGGG - Intronic
1072482579 10:95823411-95823433 TGGGTGGGACAGGGGGAGGAGGG + Intronic
1072643637 10:97233941-97233963 TGGGGGGTGGAGTGGGGGGAAGG + Intronic
1072662803 10:97373011-97373033 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
1072691447 10:97574696-97574718 TGAGGGGTGAGGAGGAAGGAAGG + Intronic
1072987025 10:100149816-100149838 AGAGGGGCAAGGAGGGAGGATGG - Intergenic
1073093279 10:100963158-100963180 TGGGGGGGAAAGATGATGGAGGG + Intronic
1073485995 10:103819559-103819581 TGGGGGCAGAAGAGGGAGGAGGG + Intronic
1073857147 10:107690184-107690206 TGGGATCAAAAGAGGGAGGAAGG + Intergenic
1073925724 10:108512924-108512946 TGAGGGGTAATGTGTGAGGATGG - Intergenic
1073955807 10:108870030-108870052 GGGCGGGGAAAGAGGGAGGTGGG + Intergenic
1074110022 10:110416441-110416463 GGGAGGCCAAAGAGGGAGGATGG + Intergenic
1074377231 10:112950574-112950596 GGAGGGGAAAAGAGGGAGGAGGG - Exonic
1074740491 10:116481258-116481280 TGAGGGATAATGAGGGAGGTTGG - Intergenic
1074781357 10:116804521-116804543 CTGGGGGTAAAGGGAGAGGAAGG - Intergenic
1074869330 10:117564693-117564715 TGGAGAGAAAGGAGGGAGGAGGG + Intergenic
1074871186 10:117577405-117577427 AGGAGGGAAGAGAGGGAGGAGGG - Intergenic
1074894338 10:117762008-117762030 GCGGGGGTGAAGAGTGAGGAGGG + Intergenic
1075198096 10:120378545-120378567 TGGGTGGAAAGGAGGGAGGTAGG + Intergenic
1075788351 10:125065627-125065649 TGGGAGGTAAAGTTAGAGGAGGG + Intronic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075844699 10:125535826-125535848 TGGGGCGTAACGAGGGCAGAAGG - Intergenic
1076193774 10:128500568-128500590 TGGGGGGCAGAGGGGCAGGAGGG + Intergenic
1076217443 10:128707414-128707436 TTGGAGGTAAAGGGTGAGGATGG + Intergenic
1076252402 10:128994790-128994812 TGAGGGAGAAAGAGGGAGGGAGG + Intergenic
1076476456 10:130757037-130757059 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
1076498455 10:130915141-130915163 TGGGGTGTGAGGAGGCAGGACGG - Intergenic
1076571964 10:131438928-131438950 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1076624955 10:131816071-131816093 TGGCGGGGACACAGGGAGGAGGG - Intergenic
1076657745 10:132036141-132036163 TTCAGGGTAAAGCGGGAGGAAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077272241 11:1686797-1686819 AGGGAGGGAAAGAGGGAGGGGGG - Intergenic
1077272249 11:1686813-1686835 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1077376148 11:2205816-2205838 TGGGAGGTAAGGAGGCAGGGAGG - Intergenic
1077525136 11:3059629-3059651 GGGAGGCTGAAGAGGGAGGATGG + Intergenic
1078040378 11:7856110-7856132 TGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078579448 11:12527210-12527232 AGGAAGGCAAAGAGGGAGGATGG + Intronic
1078941700 11:16013638-16013660 ATGGGAGTAAAGAGGGAGGGAGG - Intronic
1079128748 11:17735654-17735676 TGAGGGGGAAAGAGGGAGGGGGG - Exonic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079540934 11:21573778-21573800 AGGGAGGGAAAGAGGGAGGAAGG + Intronic
1079637473 11:22762009-22762031 TGGGGGATAAAAAGGTGGGAGGG - Intronic
1079701949 11:23558991-23559013 TGGTAGTTAAAGAGGCAGGAAGG - Intergenic
1079766977 11:24406266-24406288 AGGGGGATGAAGAGGGAAGACGG - Intergenic
1079868714 11:25768096-25768118 AGGAAGGAAAAGAGGGAGGATGG + Intergenic
1079908820 11:26284035-26284057 TGGGTGGTATGGCGGGAGGAGGG + Intergenic
1080075208 11:28140066-28140088 TGGGAGGGAAGCAGGGAGGATGG + Intronic
1080252042 11:30244300-30244322 TGGTGGGTGGAGAGGGTGGAGGG + Intergenic
1080506034 11:32915022-32915044 GGGGGGCTAAGGTGGGAGGATGG - Intronic
1080539062 11:33249499-33249521 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
1081395912 11:42586062-42586084 TGGAAGGCAAAGAGGAAGGAGGG + Intergenic
1081613876 11:44579230-44579252 TGGGAGGTAGAGAGGGGGCAGGG + Intronic
1081701552 11:45155640-45155662 GGAGGGGTGGAGAGGGAGGAAGG + Intronic
1081714066 11:45236110-45236132 GCTGGGGAAAAGAGGGAGGAAGG - Intergenic
1082108929 11:48251618-48251640 TGGGGAGCGAAGAGGGGGGAAGG - Intergenic
1082623245 11:55450698-55450720 TGGGGCGAAGAGTGGGAGGAGGG - Intergenic
1083417792 11:62536515-62536537 TGAGGGGAAGAGAGGAAGGAGGG - Exonic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083615086 11:64022171-64022193 TGGGGGGTTTAGACAGAGGAGGG + Intronic
1083841730 11:65308672-65308694 AGTGGGGTGAAGAGCGAGGAGGG + Intergenic
1083934491 11:65863225-65863247 AGTGGGGAAAACAGGGAGGAGGG + Intronic
1084441481 11:69176598-69176620 AGAGGGGGCAAGAGGGAGGAAGG - Intergenic
1084441796 11:69178882-69178904 AGGGAGGCAAAGAGGAAGGAGGG + Intergenic
1084559331 11:69893917-69893939 TGGGCGGTGAAGACAGAGGAAGG - Intergenic
1084614605 11:70227208-70227230 TGGGGGTTAAAGGGTGAGGATGG - Intergenic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085326526 11:75610760-75610782 TGCTGGGTCAAGAGGGAGAATGG + Intronic
1085327758 11:75620364-75620386 GGGAGGCTAAAGTGGGAGGATGG + Intronic
1085983678 11:81757371-81757393 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1085989540 11:81825271-81825293 TGAGGGGGAAGGAGGGAGGAAGG + Intergenic
1086088450 11:82980823-82980845 TGGGAGGGAAGGAGGGAGGGAGG + Exonic
1086192935 11:84101941-84101963 TGGGGGGTAAAGTGTGAAGCTGG - Intronic
1086206225 11:84261236-84261258 TGGGAGGAAAAGAGAGAAGAAGG - Intronic
1086307157 11:85493773-85493795 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1086494226 11:87385574-87385596 TGGGGGGAAAAGAAAAAGGAAGG + Intergenic
1086826217 11:91502112-91502134 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1087037244 11:93767842-93767864 TGGAGGCTAAGGTGGGAGGATGG - Intronic
1087225237 11:95591798-95591820 GGAGGGGCTAAGAGGGAGGAAGG + Intergenic
1087274210 11:96144397-96144419 TGAGGGGAGAAGAGGGAGGCAGG + Intronic
1087349142 11:97008906-97008928 TGGAGGGTGAAGAAGGAAGATGG - Intergenic
1087378410 11:97372640-97372662 GGGGAGGTAAAGAAAGAGGAAGG + Intergenic
1087471459 11:98580844-98580866 GGGAGGGGAAAGAGGGAGGGAGG + Intergenic
1087474858 11:98622232-98622254 TGGGAGGAAGAGAGGGAGGAGGG - Intergenic
1087518821 11:99203036-99203058 AGGGAGGAAGAGAGGGAGGAAGG + Intronic
1087663683 11:101017311-101017333 TGGGGGGTAGAGAGAGAAAAAGG - Intergenic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087757501 11:102070136-102070158 AGGGAGGGAAAGAGGGAGGAAGG + Intronic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1087916245 11:103814952-103814974 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1087972731 11:104504918-104504940 AGAGGAGTAACGAGGGAGGAAGG + Intergenic
1088063388 11:105685140-105685162 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088320993 11:108554541-108554563 TGGGTGGTAAAGGTGGTGGAGGG + Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088449548 11:109966842-109966864 TGGGGGGTCACTAGGGATGATGG - Intergenic
1088455004 11:110024117-110024139 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1088462355 11:110093968-110093990 TGGGGGTGAAGGAGGGACGAGGG - Intronic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1088652641 11:111971973-111971995 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088713507 11:112528789-112528811 AGGGGGCAAAAGAGAGAGGAAGG - Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1089132833 11:116225448-116225470 TAAGCAGTAAAGAGGGAGGATGG - Intergenic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089848375 11:121476703-121476725 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1089852379 11:121510840-121510862 TGCAGGGTAGAGTGGGAGGAGGG + Intronic
1090243919 11:125202408-125202430 GGAGAGGTAAAGAGGAAGGATGG - Intronic
1090727862 11:129543898-129543920 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1091285803 11:134408236-134408258 AGTGGGGTGAAGAGGGAGGTGGG + Intronic
1091364709 11:135007961-135007983 TGGGGCGGAAAGAGGGCAGAGGG + Intergenic
1091374377 12:16279-16301 TGGGGGCTAGAGAGGAAGCAGGG - Intergenic
1091428949 12:416178-416200 GGGAGGTTAAAGTGGGAGGATGG - Intronic
1091439894 12:504562-504584 TGGGGGCTGAAGTGGAAGGATGG - Intronic
1091707428 12:2705479-2705501 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1091842019 12:3628137-3628159 TGGGGGAGAGGGAGGGAGGAAGG - Intronic
1091905718 12:4187491-4187513 TGGGGGCTGAGGTGGGAGGATGG - Intergenic
1092030641 12:5280941-5280963 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092092196 12:5812326-5812348 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1092179172 12:6433599-6433621 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1092181130 12:6447774-6447796 TGGGGTGTGGGGAGGGAGGAGGG - Intronic
1092242807 12:6845858-6845880 TGGGGGGTACAGAATGGGGAGGG - Intronic
1092254302 12:6917805-6917827 AGGGAGGTAAAGAGGAAGGATGG + Intronic
1093356621 12:18174901-18174923 TGGGGGAAAAAGAGGGAGAGGGG + Intronic
1093721075 12:22442921-22442943 TGGGGGGAAGAGTGGAAGGAGGG + Intergenic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1093977440 12:25438592-25438614 TGGGTGGGAATGAGGGAGGGTGG - Intronic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1094230219 12:28094103-28094125 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1094360952 12:29630295-29630317 TGGAAGGTAAAGAGGAAGCAGGG + Intronic
1094810336 12:34130765-34130787 TGGGGGGAAGAGTGGGAGGGAGG + Intergenic
1095087689 12:38075462-38075484 TGGGGTGCAGGGAGGGAGGAGGG + Intergenic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1095970047 12:47895394-47895416 TGGGAGGGAGAGAAGGAGGAGGG + Intronic
1096152423 12:49323052-49323074 AGGCGGGGAAAGAGGAAGGATGG - Intergenic
1096251833 12:50038400-50038422 AGGGGCTTAAATAGGGAGGAAGG - Intergenic
1096306063 12:50477082-50477104 TGGGGGGAGAAGAGGAGGGAAGG - Exonic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096961381 12:55581628-55581650 TGGAGGGTGGAGAGGGAGGAGGG - Intergenic
1097166686 12:57089779-57089801 GGGGGGGTGACGAGGGAGGCAGG + Intronic
1097225036 12:57471962-57471984 TGGGGGGCCCAGAGGGAGGTGGG - Exonic
1097806185 12:63967335-63967357 GGGAGGCTGAAGAGGGAGGATGG + Intronic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098307751 12:69118460-69118482 TGGAGGATGAAGAGAGAGGAGGG - Intergenic
1098467277 12:70801778-70801800 TGGGAGATAGAGAGGGAGGGAGG - Intronic
1098710766 12:73757589-73757611 TGGGGGGGAGGGAGGGAGGGAGG + Intergenic
1098980511 12:76951055-76951077 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100276893 12:93079746-93079768 TGGGGGGAAGAGGGGGAGAATGG + Intergenic
1100370702 12:93966697-93966719 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
1100962491 12:99978396-99978418 TGGGGAGTAAGGAGAAAGGAGGG - Intronic
1101024836 12:100590926-100590948 TGGGGGGAAGAGTGGGAGGGGGG + Intronic
1101059806 12:100959089-100959111 AGGGGGGTTGAGAGGGATGAGGG - Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101234676 12:102776462-102776484 TGGAGGGGAAAAAGGGAGGAAGG - Intergenic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101775310 12:107788156-107788178 TGGGTGGTAGAGAGGGAGCAAGG - Intergenic
1101916955 12:108903256-108903278 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102089743 12:110175971-110175993 TGGTGTGTAAAGAAGGAGGCTGG - Intronic
1102103499 12:110300102-110300124 GGGGAGGGAAAGGGGGAGGAAGG - Intronic
1102104177 12:110306501-110306523 TGGGAGGGAAAGAGGGGCGAGGG - Intronic
1102176939 12:110882965-110882987 GGGAGGGCAAAGTGGGAGGATGG - Intronic
1102451506 12:113045083-113045105 AGTGGGGGAAGGAGGGAGGAAGG + Intergenic
1102465659 12:113129660-113129682 TGTGGTGAAAGGAGGGAGGAAGG - Intronic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1102577162 12:113863060-113863082 TGGGGGGAGAGAAGGGAGGAGGG + Intronic
1102853983 12:116277604-116277626 TGGGGGAGGAAGAGGAAGGAGGG - Intergenic
1102893219 12:116578308-116578330 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1102991574 12:117319998-117320020 TGAGAGGTAAAGTGGAAGGAGGG + Intronic
1103119083 12:118365493-118365515 GGGAGGCTAATGAGGGAGGAGGG - Intronic
1103149675 12:118626208-118626230 AGGGAGGAAAAGAGGGAGGGAGG - Intergenic
1103366168 12:120385073-120385095 AGGAGGCTAAAGTGGGAGGAAGG - Intergenic
1103910144 12:124347789-124347811 TTGGGGGCAACGAGGGAGCAGGG + Intronic
1103956772 12:124581870-124581892 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
1104207108 12:126649723-126649745 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1104254442 12:127124886-127124908 AGGGGGGGACAGAGGGAGGGGGG + Intergenic
1104594774 12:130113601-130113623 TGGGGAGGAAAGAGGCAGGCTGG + Intergenic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104970315 12:132528005-132528027 AGGGGGACAAAGATGGAGGAGGG - Intronic
1105002666 12:132701428-132701450 GGGGGAGGAAAGAGGAAGGAAGG - Intronic
1105319842 13:19308465-19308487 TGTGGGGAAGAGTGGGAGGAGGG - Intergenic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105371543 13:19806029-19806051 AGGGAGGAAAAGAGGGAGGGAGG + Intergenic
1105694404 13:22873576-22873598 AGGGAGGGAAAGAGGGAGAAAGG - Intergenic
1105858020 13:24388578-24388600 TGGGAAGGAAGGAGGGAGGAAGG + Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1105900981 13:24752930-24752952 TGGGGGCTAACGAGGGAGGGTGG - Intergenic
1105908786 13:24840731-24840753 TTGGGGGTAAAGTAGGAGGGGGG + Intronic
1105935241 13:25092455-25092477 TGGAGGGTGCAGGGGGAGGAGGG - Intergenic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106354431 13:28966481-28966503 TGGGGGCTGAGGTGGGAGGATGG + Intronic
1106679139 13:31992427-31992449 GGGAGGCTAAAGAGGGAGGATGG - Intergenic
1107087601 13:36443069-36443091 TGGGGAATAAAGAGACAGGAAGG - Intergenic
1107337370 13:39369594-39369616 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1107377145 13:39816270-39816292 TGGGGGTCAAAGAGGAAGGAAGG - Intergenic
1107527291 13:41245880-41245902 ACAGGGATAAAGAGGGAGGAAGG - Intronic
1107581119 13:41787545-41787567 TGGAGGATGAAGAGGGAGGAAGG + Intronic
1107938242 13:45363017-45363039 TGGGGTGGAGACAGGGAGGATGG - Intergenic
1108568888 13:51729978-51730000 TGGGGGGCCGAGGGGGAGGATGG - Intronic
1108621234 13:52185906-52185928 TGGGGGCTGAGGCGGGAGGATGG - Intergenic
1108665707 13:52628336-52628358 TGGGGGCTAAGGCTGGAGGATGG + Intergenic
1108748954 13:53426602-53426624 TAGAGGGGAAAGAGAGAGGAGGG - Intergenic
1108992587 13:56680474-56680496 TGGGAGAGAAAGAGAGAGGAAGG - Intergenic
1109153364 13:58872923-58872945 TGGGAAGTAAAGAAAGAGGAAGG + Intergenic
1109281086 13:60356440-60356462 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1109391625 13:61702602-61702624 TGGAGGCTGAAGAAGGAGGATGG + Intergenic
1109552153 13:63917758-63917780 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110443540 13:75550617-75550639 TGGGGGTTGGGGAGGGAGGAGGG + Intronic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1110562144 13:76920655-76920677 TGGGGGAAAGAGTGGGAGGAGGG + Intergenic
1110756505 13:79181034-79181056 TGGAGGCTAAGGTGGGAGGATGG - Intergenic
1111165261 13:84449721-84449743 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
1111452590 13:88438657-88438679 TGGGAGGAAAAAAGGGAGGGAGG + Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111541917 13:89679691-89679713 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1111755033 13:92382211-92382233 TGGGGGGAAGAGTGGGAGGGTGG + Intronic
1111785938 13:92786827-92786849 TGTGGGGTAATGAGGAAGAAAGG + Intronic
1111844129 13:93488110-93488132 TGGGGTGAAAGGAGGGGGGAGGG - Intronic
1111988917 13:95095534-95095556 TAGGGGGAAGAGTGGGAGGAGGG + Intronic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112450259 13:99501552-99501574 TAGGGGGTCAAGAGGGAAGGAGG - Exonic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112649709 13:101381591-101381613 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1113040623 13:106100605-106100627 TGGGGGGTGGGGAGGCAGGAAGG + Intergenic
1113049999 13:106200202-106200224 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1113090471 13:106612780-106612802 GGGGGAGTAGAGAGAGAGGATGG - Intergenic
1113179815 13:107612152-107612174 TGGGAGGGAGAGAGGAAGGAAGG + Intronic
1113387822 13:109866758-109866780 AGGGAGGGAAAGAAGGAGGAAGG + Intergenic
1113420761 13:110170034-110170056 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1113612216 13:111655123-111655145 TGGGGAGTGAAGATGGAGGAAGG + Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113654613 13:112060091-112060113 TGAGGGCTAATGAGAGAGGATGG + Intergenic
1113673956 13:112195734-112195756 AGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1113680661 13:112242106-112242128 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1113780778 13:112975933-112975955 TGGGGTGGAAGGAGGGAGGGAGG - Intronic
1113935177 13:113990113-113990135 GGGAGGGCAAAGAGGAAGGAAGG - Intronic
1114317972 14:21524888-21524910 TGGGTGGTAAAGGTGGAAGAAGG + Exonic
1114318198 14:21525840-21525862 AGGGGGGTGGGGAGGGAGGAGGG + Intronic
1114339148 14:21724660-21724682 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114428511 14:22640341-22640363 TGGGAGGAAAGGAGGAAGGAAGG + Intergenic
1114483007 14:23047119-23047141 GGAAGGGGAAAGAGGGAGGAAGG - Exonic
1114516991 14:23306822-23306844 AGGGAGGGAGAGAGGGAGGAAGG - Exonic
1114728540 14:24965423-24965445 TGGGGGGTAAAGGTGGTGTATGG + Intronic
1114979904 14:28149647-28149669 TGGGGTGGGAGGAGGGAGGAGGG + Intergenic
1114993702 14:28319480-28319502 GGGGTGGAAAAGAGGGAGGGAGG + Intergenic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115165040 14:30438752-30438774 TGGGGAGCAGAGAGGGAGGATGG - Intergenic
1115399590 14:32941234-32941256 GGAGGGGAAAGGAGGGAGGAGGG - Intronic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115419793 14:33181251-33181273 TGGAAGGAAAAGAGGAAGGAGGG + Intronic
1115635995 14:35291094-35291116 GGGGGGCTAAGGTGGGAGGATGG - Intronic
1116223835 14:42122035-42122057 TGGGGGGAAGGGTGGGAGGAAGG + Intergenic
1116945884 14:50834812-50834834 TGGGGGCTAAGGTGGGTGGATGG + Intergenic
1117521183 14:56552851-56552873 TGGCAGGGAGAGAGGGAGGATGG - Intronic
1117771939 14:59142311-59142333 TGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1117834341 14:59786624-59786646 TATAGGATAAAGAGGGAGGATGG + Intronic
1117852031 14:59983676-59983698 TGGAGGGTAAAGATGTAGGTTGG + Intronic
1118033372 14:61839881-61839903 TGGAGGGGAAAGGGGGAGGGAGG + Intergenic
1118133013 14:62988892-62988914 TGGGTGATAAAGGGGGAAGATGG - Intronic
1118312381 14:64703675-64703697 TGGGGGGCAAGGGGTGAGGATGG - Intergenic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118600322 14:67467452-67467474 TGGGTGGGAAGGAGGGAGGGAGG + Intronic
1118693436 14:68361582-68361604 TGGGGGGTAAGGATGGAGAAAGG + Intronic
1118723852 14:68612866-68612888 GGGGAGGGAGAGAGGGAGGAAGG + Intronic
1118725432 14:68625575-68625597 GGGAGGCCAAAGAGGGAGGATGG - Intronic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1119184369 14:72629547-72629569 TGAGGGGTGAAGAGGAAGGAAGG - Intronic
1119286475 14:73458665-73458687 GGGGCGGTAAAGAGCGATGACGG - Intronic
1119375490 14:74188546-74188568 TGGGGGGAAACGGGGGTGGAGGG - Intronic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119774401 14:77239526-77239548 GTGGGGGTAAAAGGGGAGGATGG + Intronic
1119848319 14:77847192-77847214 TGGAGGGTAGAGAGTGAGGTGGG + Intronic
1119935126 14:78585331-78585353 TGGCTAGTACAGAGGGAGGAAGG + Intronic
1120841089 14:89085400-89085422 TGGGGGAGAGAGAGGGAGAAAGG - Intergenic
1120909734 14:89655386-89655408 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121366809 14:93320260-93320282 TGGGGGTTAGGGAGGGTGGAAGG - Intronic
1121447545 14:93988268-93988290 TGGGAGGAAAGGATGGAGGAGGG + Intergenic
1121612818 14:95293180-95293202 AGGGGGGGAAAGAAGGAGGGAGG - Intronic
1121659642 14:95625227-95625249 TGGGGGCTCAAGAGAGAGCATGG + Intergenic
1121797105 14:96744279-96744301 TGGGGGGTAGGGACGGAGCATGG + Intergenic
1121800190 14:96768628-96768650 TGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122129960 14:99599170-99599192 TGTTGGTTTAAGAGGGAGGATGG - Intronic
1122163432 14:99802919-99802941 TGGGTGCTAAAGTGGGAGGGAGG - Intronic
1122292407 14:100686862-100686884 TGGGGGCTGGAGAGGCAGGAGGG + Intergenic
1122316470 14:100828444-100828466 TGAGGGGGGAAGAGGGAGGAGGG - Intergenic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122380945 14:101306575-101306597 TGGACGGTATAGAGGTAGGAAGG + Intergenic
1122517994 14:102321977-102321999 GGGGTGGGGAAGAGGGAGGATGG - Intronic
1122623656 14:103073579-103073601 TGGGGTGTAAAGGTGGAGAAAGG - Intergenic
1122916332 14:104860709-104860731 TGGGGGGTGGAGATGGAGGGTGG - Intergenic
1123802699 15:23838152-23838174 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1124035999 15:26054107-26054129 TGCTGGGCATAGAGGGAGGATGG + Intergenic
1124147254 15:27139265-27139287 TGGGGGGTGCAGAGAGGGGATGG + Intronic
1124211936 15:27770829-27770851 AGGAAGGAAAAGAGGGAGGAAGG - Intronic
1124379440 15:29152416-29152438 TGGGGGTTAAATGGGGAGCAGGG - Intronic
1124618440 15:31259862-31259884 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1125132725 15:36302816-36302838 TGGGGGGTAAAGAGTAAAGAAGG + Intergenic
1126321684 15:47430791-47430813 GGGATGGTAAAGAGTGAGGAGGG - Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1126628778 15:50712656-50712678 GGGGGGGGAGGGAGGGAGGAAGG - Intronic
1126897507 15:53274948-53274970 AGGGTGGGAAGGAGGGAGGAAGG - Intergenic
1127541608 15:59944409-59944431 GGGAGGCTAAAGTGGGAGGATGG + Intergenic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1127674423 15:61227131-61227153 GGGGGGGTCAAGAAGGAGAAAGG + Intronic
1128110165 15:65071311-65071333 TGCGGAGTAGAGAGGGAGGTTGG + Intronic
1128176465 15:65560696-65560718 TGGGCGGTGAGGTGGGAGGATGG + Intronic
1128365004 15:66993321-66993343 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1128430645 15:67590402-67590424 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1128452157 15:67811936-67811958 AGAGGGGCATAGAGGGAGGATGG + Intergenic
1129108440 15:73324036-73324058 TGGGGGGTGTTGGGGGAGGAGGG - Intronic
1129238031 15:74235343-74235365 GTGGGGGTAGAGAGGGAGGCTGG + Intergenic
1129342258 15:74893647-74893669 TCGGGGCTAAAGAGGCAGGAAGG + Intronic
1129514516 15:76148853-76148875 TTGCGGGAAGAGAGGGAGGAGGG - Intronic
1129748327 15:78040692-78040714 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1129787799 15:78320923-78320945 CGGGGGGCAAATAGGGATGAGGG + Intergenic
1130031651 15:80319791-80319813 TGGGGTGTAAAGAGAGAAGTGGG - Intergenic
1130068320 15:80625151-80625173 GGGAGGCTAAAGCGGGAGGATGG + Intergenic
1130378407 15:83351028-83351050 TGGAAGGAAAGGAGGGAGGAAGG - Intergenic
1130649738 15:85755761-85755783 TGGTGGGGAACCAGGGAGGATGG - Intergenic
1130721006 15:86386056-86386078 GGGAGGGGAGAGAGGGAGGAGGG - Intronic
1130726934 15:86448754-86448776 TGGAGGATAAAGGGAGAGGAGGG + Intronic
1130904070 15:88227753-88227775 AGGTGGGTAAAGGGGGAGGGAGG - Intronic
1130995122 15:88899234-88899256 AGGGTGGGAAAGAGGGAGGGAGG + Exonic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131152041 15:90053451-90053473 TGGGGGGCTGAGTGGGAGGATGG - Intronic
1131160006 15:90099471-90099493 TGGGGGGAGAAGGGGGAGGCAGG + Intronic
1131460040 15:92611279-92611301 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
1131544434 15:93304077-93304099 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1131588565 15:93722507-93722529 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1131765881 15:95675414-95675436 TGGCGGGGAGAGTGGGAGGACGG - Intergenic
1131787373 15:95927458-95927480 TGGGGTGTGGAGAGGTAGGATGG - Intergenic
1131899020 15:97067685-97067707 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1132010153 15:98268094-98268116 AGAGTGGGAAAGAGGGAGGAGGG + Intergenic
1132075373 15:98815583-98815605 TGGGGGGTGATGAGGGAGGGAGG + Intronic
1132322776 15:100938560-100938582 TGTGGGGGAAGGAGGGAGGATGG - Intronic
1132452221 15:101974774-101974796 TGGGGGCTAGAGAGGAAGCAGGG + Intergenic
1132878997 16:2153007-2153029 CGTGTGGTGAAGAGGGAGGACGG + Exonic
1132989824 16:2786925-2786947 AGGGGGGTGAGGATGGAGGAGGG - Intronic
1133037739 16:3043809-3043831 TAGGGGATAAAGTGGGATGAGGG - Intergenic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133445212 16:5853702-5853724 TGGGGGATAGAGAGGCAGGGTGG + Intergenic
1133657820 16:7883407-7883429 TGGAGGTCAAAGTGGGAGGATGG + Intergenic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134203715 16:12220305-12220327 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
1134430827 16:14204213-14204235 GGGAGGCTGAAGAGGGAGGATGG - Intronic
1134430974 16:14206097-14206119 TGGAGGCTGAAAAGGGAGGAAGG + Intronic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1134860986 16:17560605-17560627 TGGAAGGAAAGGAGGGAGGAAGG + Intergenic
1134908144 16:17999720-17999742 TGGGGGTTAAGGTGGGGGGAGGG + Intergenic
1135088167 16:19491113-19491135 TGGGGGCTGAGGTGGGAGGATGG - Intronic
1135112354 16:19699990-19700012 GGGAGGCTGAAGAGGGAGGATGG + Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1135277781 16:21128307-21128329 TGGAGGCTAAGGAGAGAGGATGG + Intronic
1135435816 16:22425942-22425964 TGCAGGGACAAGAGGGAGGAAGG + Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135861415 16:26059255-26059277 TGGAGGGAAAGGAAGGAGGAAGG - Intronic
1135891780 16:26363825-26363847 TGGGAGGAAGAGAGGAAGGATGG - Intergenic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136043785 16:27600195-27600217 AGTGGGGTGAGGAGGGAGGAGGG + Intronic
1136063496 16:27743002-27743024 TGGGGGGTGTAGTGGGAGGAGGG - Intronic
1136126042 16:28181496-28181518 TGGGGGGTAACCAGGGAGAGTGG + Intronic
1136237730 16:28925008-28925030 TGGGGGGTGGAGAGGGATGATGG - Intronic
1136279575 16:29200177-29200199 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1136333476 16:29596351-29596373 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1136932336 16:34430646-34430668 TGGGGGGAAGAGAGGGAGGAAGG - Intergenic
1136972236 16:34981168-34981190 TGGGGGGAAGAGAGGGAGGAAGG + Intergenic
1137289030 16:47039075-47039097 TGGAGGCTGAAGCGGGAGGATGG - Intergenic
1137464486 16:48696010-48696032 TGGGGGGTGAAGTGAGGGGAGGG - Intergenic
1137495049 16:48963052-48963074 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1137524481 16:49222733-49222755 AGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1137637792 16:50002239-50002261 AGGGTGGAAAAGAGGGAGGGAGG - Intergenic
1138533478 16:57647366-57647388 AGAGGGGGAAACAGGGAGGAGGG + Intronic
1138544122 16:57706056-57706078 TGGGAGGCAAAATGGGAGGATGG - Intronic
1138567875 16:57846597-57846619 GGGGGAGAAAGGAGGGAGGATGG - Intronic
1138585439 16:57967104-57967126 TGAGAGGTAGAGCGGGAGGAGGG - Intronic
1138991616 16:62397122-62397144 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139317483 16:66086174-66086196 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139611960 16:68065524-68065546 TGGAGGCTGAAGTGGGAGGATGG + Intronic
1139711550 16:68780150-68780172 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1139766862 16:69237946-69237968 TGGGGAGAAAAGAAGGAGGTAGG - Intronic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1139837819 16:69853777-69853799 TGAAGGGTAAGGAGGGAGGGGGG + Intronic
1139974460 16:70797861-70797883 TGGAGGGCAAAGAGGGAGCAAGG - Intronic
1140280200 16:73546818-73546840 TGGGGGGTGAGGGGGGAGGGAGG + Intergenic
1140338095 16:74130676-74130698 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1140484683 16:75284160-75284182 AGGAGGGTGAAGTGGGAGGATGG - Intergenic
1140647760 16:77051740-77051762 TGGGGGGAAGAGTGGGAGGAGGG + Intergenic
1140733321 16:77875831-77875853 AGGGAGGTTAGGAGGGAGGAAGG + Intronic
1140754663 16:78056559-78056581 TGGGAGGCTAAGCGGGAGGATGG - Intronic
1140786145 16:78344005-78344027 TGTGGGGTGATGTGGGAGGAAGG - Intronic
1140869408 16:79092841-79092863 TGGGGGGTTATGAGGGCTGAGGG - Intronic
1140905877 16:79408664-79408686 GGAGGGGAAAACAGGGAGGAAGG - Intergenic
1140944635 16:79756500-79756522 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1141427126 16:83951837-83951859 AGGAAGGGAAAGAGGGAGGAAGG - Intronic
1141427131 16:83951853-83951875 AGGGAGGGAAAGAGGGAGGAAGG - Intronic
1141427161 16:83951947-83951969 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141427202 16:83952055-83952077 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141540241 16:84714421-84714443 GGGAGGCTAAAGAGGGAGGATGG - Intronic
1141682941 16:85554776-85554798 GGGGGGGGAGGGAGGGAGGACGG + Intergenic
1141713928 16:85716327-85716349 TTGGGGGAGAAGAGGGAGGGAGG + Intronic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142097410 16:88249330-88249352 GGGAGGCTAAAGTGGGAGGATGG - Intergenic
1142251449 16:88993779-88993801 GGGGGAGGGAAGAGGGAGGAGGG - Intergenic
1142252609 16:88999633-88999655 GGGGCGGGACAGAGGGAGGAGGG + Intergenic
1142377308 16:89712524-89712546 TGGGGGGGGAGGAGGGAGTAAGG + Intronic
1142398423 16:89846265-89846287 TGGGAGGCCAAGTGGGAGGATGG - Intronic
1143102743 17:4513319-4513341 TGGGGGGGAAGGTGGGAGGTGGG - Intronic
1143125847 17:4640537-4640559 AGGGAGGAAAAAAGGGAGGAGGG + Intronic
1143161524 17:4874854-4874876 TGGGCGGCACTGAGGGAGGAAGG - Intronic
1143214713 17:5215948-5215970 GGGAGGCGAAAGAGGGAGGATGG + Intronic
1143402631 17:6656285-6656307 AGGGAGGAAAAAAGGGAGGAGGG - Intergenic
1143504561 17:7356537-7356559 TGGGAGGGACAGAGGGAGGGAGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1143704514 17:8687490-8687512 GGAGGGGTAAAGAGAGGGGAGGG - Intergenic
1144063194 17:11601363-11601385 TGGGAGGGAGAGAGGGAGGGAGG + Intronic
1144315989 17:14062048-14062070 TGGGGAGTAAAGATGGAAAAGGG + Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144355413 17:14441296-14441318 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1144408450 17:14975445-14975467 TGGGGTGGAAGGTGGGAGGAAGG - Intergenic
1145079071 17:19879673-19879695 AAGGGGGAAAAGAGGGAGGTGGG - Intergenic
1145280362 17:21463448-21463470 TGAGGGAGAAAAAGGGAGGAGGG - Intergenic
1145287807 17:21519459-21519481 TGAGGGGTAGAAAGTGAGGATGG - Intergenic
1145389823 17:22446925-22446947 TGAGGGGTAGAAAGTGAGGATGG + Intergenic
1145397526 17:22507031-22507053 TGAGGGAGAAAAAGGGAGGAGGG + Intergenic
1145908989 17:28531948-28531970 TGGAAGGGAAAGAGGGAGGGAGG + Intronic
1146011001 17:29194312-29194334 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
1146012282 17:29205608-29205630 GGAGGGGCAAAGAGGGAGAATGG - Intergenic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1146422234 17:32698341-32698363 AGGGGGGAAGAGAGGGAGGGAGG - Intronic
1146454059 17:32995758-32995780 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1146688482 17:34857114-34857136 TGGGGAGGAACGAGGGTGGAAGG + Intergenic
1146910452 17:36645404-36645426 TGGGGGGAAATGGAGGAGGAGGG - Intergenic
1146918360 17:36692610-36692632 TGGGGGGAAGGGTGGGAGGAAGG - Intergenic
1147140890 17:38460128-38460150 TGTGGGGGAATGAGGAAGGAGGG - Intronic
1147212988 17:38882926-38882948 TGTGGGGTAAGGACTGAGGAGGG + Intronic
1147383947 17:40071068-40071090 GGTGGGGGAAAGAGGGAAGAAGG - Intronic
1147428513 17:40357441-40357463 TGCGGGGTAAGGAGGGGGCACGG - Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147527065 17:41235797-41235819 GGGAGGGAAAAGAGGGAGCAGGG + Intronic
1148031029 17:44621205-44621227 TGGGGGTCAAAAAGTGAGGAGGG - Intergenic
1148105244 17:45115293-45115315 AGGGGGGGAAGGTGGGAGGACGG - Intronic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148334496 17:46832386-46832408 AGGGGGGAAAAGAGAGAGGGGGG + Intronic
1148638259 17:49165627-49165649 GTGGGGGGAAAGAGAGAGGAAGG - Intronic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149514717 17:57271851-57271873 AGGAGGGGAAAGAGTGAGGAGGG + Intronic
1149532389 17:57406027-57406049 TTGGTGGTAAAGTGGGAGGTGGG - Intronic
1149553279 17:57555589-57555611 AGGGGGTTCAGGAGGGAGGAAGG - Intronic
1149658145 17:58320855-58320877 TAGGGGGGAAACTGGGAGGATGG - Intronic
1149983670 17:61331207-61331229 TGGGGGCTAGAGTGGGAGGGGGG + Intronic
1149999382 17:61423957-61423979 TGTGGGGTACAGAGGGAATATGG + Intergenic
1150293093 17:63993082-63993104 AGGGAGGGAATGAGGGAGGAAGG + Intergenic
1150298286 17:64027021-64027043 TGAGGGATAAAGAAGGATGATGG - Intergenic
1150370258 17:64631259-64631281 TGGGGGGGAGAGAGGGGGGGGGG + Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150475265 17:65470305-65470327 AGGGGGGGAGAGAGAGAGGAAGG - Intergenic
1150559548 17:66282789-66282811 TGGAGGCTAAAGAGGGTGGAGGG - Intergenic
1150645739 17:66976495-66976517 AGGGAGGGAAAGAGGGAGGATGG - Intronic
1150655795 17:67038597-67038619 AGTGGGGTAAGGACGGAGGAAGG - Intergenic
1150715913 17:67572474-67572496 GGGGGGGTAAAGAAGAAGGGGGG + Intronic
1151048889 17:70953532-70953554 TGGGGGAAAGAGTGGGAGGAGGG + Intergenic
1151129918 17:71886104-71886126 TTGGGGGTAGAGTGGGAGGGTGG + Intergenic
1151157567 17:72137121-72137143 TGGAGAGTGAAGAGGGAGGAAGG + Intergenic
1151241687 17:72763181-72763203 TGGGAGGCAATGAGGGAGAAGGG - Intronic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1151398003 17:73837355-73837377 TGGAGTGGGAAGAGGGAGGAGGG + Intergenic
1151544484 17:74784409-74784431 TGGAGGGGAAGGAAGGAGGATGG + Intronic
1151624293 17:75267072-75267094 TGGATGGTAAGGAGGGAGCAAGG - Intronic
1151698543 17:75730613-75730635 AGGGAGGAAAAGAGGGAGGGAGG - Intronic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1151779691 17:76236958-76236980 TGGGAGGTTTAGAGGGAGGAAGG + Intronic
1152044943 17:77929624-77929646 TGGGGGCCAAGGAGGAAGGAGGG - Intergenic
1152091457 17:78249864-78249886 AGGGAGGCATAGAGGGAGGAGGG + Intergenic
1152108759 17:78345435-78345457 TGGGGGCTTCAGAGGGAGCACGG + Intergenic
1152267577 17:79305220-79305242 TGGGGGGGAAAGGGAGAGGTGGG + Intronic
1152423260 17:80205263-80205285 AGGGGAGGAAGGAGGGAGGAAGG - Intronic
1152708100 17:81855790-81855812 TGGGGAGTGGAGAGGGAAGAGGG + Intronic
1152823294 17:82448217-82448239 TGGTGGGTAGCGATGGAGGACGG + Intronic
1152844831 17:82593370-82593392 AGGGAGGGAAAGAGGAAGGAAGG + Intronic
1152853523 17:82650529-82650551 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
1153320813 18:3772430-3772452 TGGGGGGGAGGGAGGGAGGGAGG - Intronic
1153466795 18:5397181-5397203 AGGGGGCTAAAGAGGAAGGAGGG - Exonic
1153564268 18:6404091-6404113 TGGGGGGAAGGGTGGGAGGAGGG + Intronic
1153571680 18:6479453-6479475 TAGGGTGGAAAGAGGTAGGAGGG + Intergenic
1153952455 18:10068852-10068874 GGAGGGGTAAGGAGTGAGGATGG + Intergenic
1154031293 18:10756308-10756330 TGGAGGATGAAGAGGAAGGATGG + Intronic
1154239209 18:12636995-12637017 TGGGGGGAAGAGAGAGAGGGAGG + Intronic
1155539124 18:26848727-26848749 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
1155551781 18:26972705-26972727 GGGAGGGTAAAGATGGAGGCAGG + Intronic
1155576396 18:27252485-27252507 TGCGTGGTAAACTGGGAGGAGGG + Intergenic
1155730965 18:29157506-29157528 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1155813783 18:30276329-30276351 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1155878760 18:31118363-31118385 TGGGGGGAAGAGTGGGAGGAGGG - Intergenic
1156229103 18:35136743-35136765 TGGGGGCAAAGGAGAGAGGAAGG - Intronic
1156686098 18:39648718-39648740 TGGGAGGGAGGGAGGGAGGAAGG - Intergenic
1157304792 18:46509091-46509113 TGCTGGGAAAAGCGGGAGGATGG + Intronic
1157311994 18:46559790-46559812 TGAGGGGTCATGAGGTAGGAGGG - Intronic
1157340546 18:46774007-46774029 GGGAGGGTGAAGAGGGGGGAAGG - Intergenic
1157378960 18:47193427-47193449 TGGGTGGCAAAGATGGGGGAAGG - Intergenic
1157415653 18:47500629-47500651 TGGAGTGTACAGAGGGGGGAAGG + Intergenic
1157583185 18:48785161-48785183 AGGAGGGAAAAGAGAGAGGAAGG - Intronic
1157785192 18:50475280-50475302 TGGGAGGTAACGAGGAAGGTGGG - Intergenic
1157966244 18:52211493-52211515 TAGGAGGTAAAGAAGGAGGAGGG + Intergenic
1158103842 18:53861531-53861553 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1158442822 18:57492386-57492408 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1159350974 18:67272058-67272080 TAGGGGGTAAAGTGTGAGTATGG - Intergenic
1159516591 18:69466780-69466802 AGGGAGGGAAAGAGGGAGGGAGG + Intronic
1159527894 18:69617435-69617457 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1160181169 18:76638038-76638060 TGGGAGGGAAACAGAGAGGATGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160465858 18:79075254-79075276 TGGAGGCTAAAGCAGGAGGATGG - Intronic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1160854699 19:1211493-1211515 TGGGGTGGAAAGGGGGAGGGAGG - Intronic
1160872085 19:1282231-1282253 TGAAGGGGAAGGAGGGAGGAGGG + Intergenic
1160941407 19:1621972-1621994 TGGGGGGTCAGGCAGGAGGAGGG + Intronic
1161030786 19:2056836-2056858 TGGGAGGGAAGGAGAGAGGAGGG - Intergenic
1161253097 19:3291744-3291766 GGAGGGGGAGAGAGGGAGGAGGG + Intronic
1161273402 19:3402875-3402897 TGAGGGGGAGAGAGGGAAGAGGG + Intronic
1161412337 19:4123658-4123680 AGGGGGGTCACGGGGGAGGACGG - Intronic
1161493724 19:4576321-4576343 TGGAGGGGAGAGTGGGAGGAGGG - Intergenic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161642943 19:5435698-5435720 GGAGGGGGAGAGAGGGAGGAGGG - Intergenic
1161802908 19:6425713-6425735 TGGGGGGTCGAGAGAGAAGAAGG - Intergenic
1161846929 19:6717064-6717086 CGAGGGGGAGAGAGGGAGGAGGG + Intronic
1161905179 19:7151225-7151247 AGGGAGGGAAAGAGGAAGGAAGG - Intronic
1162338983 19:10080052-10080074 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1162433392 19:10642827-10642849 AGGGAGGGAAAGAGGGAGGCAGG - Intronic
1162565722 19:11445136-11445158 TGGGGAGTGCAGAGGCAGGAGGG - Intronic
1162578527 19:11513591-11513613 TGGGGGGAGGAGAGGGAGGGAGG + Intronic
1162872749 19:13598656-13598678 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1162936599 19:13984440-13984462 TGCGGGGTGAGGAGGGAGGTTGG + Intronic
1163004762 19:14390136-14390158 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1163005310 19:14393688-14393710 AGAGGGATAAAGAGGGAGGTGGG + Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163023958 19:14498789-14498811 GGGAGGCCAAAGAGGGAGGATGG - Intergenic
1163143975 19:15368602-15368624 TGGGGAGGACAGAGGGAGCAGGG - Intronic
1163378527 19:16949051-16949073 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1163629187 19:18408400-18408422 TGGGGGTTAAAGAGGCAGGAAGG - Intergenic
1163682042 19:18688340-18688362 TGGGTGGAAAGCAGGGAGGAGGG + Intronic
1163730194 19:18944552-18944574 TGGGGGGGAGGGAGGAAGGAAGG + Intergenic
1163752334 19:19085157-19085179 TGAGGGGTAAAGAGGAACTACGG + Intronic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1164393569 19:27845562-27845584 TGGGTGGTTAGGAGAGAGGAGGG + Intergenic
1164411437 19:28009183-28009205 AGGGGAGCAAAGAGGGAGGCTGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164441779 19:28284774-28284796 TGGGAGGAAAGGAGGGTGGAAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164458264 19:28426923-28426945 TGGAGGGTAGAAGGGGAGGAGGG + Intergenic
1164516427 19:28940365-28940387 AGGGGAGCAAAGAGGGAGGCTGG + Intergenic
1164573220 19:29388874-29388896 TGGGGGGGAAAGAAGGAGGGAGG + Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164592189 19:29513121-29513143 GGGGGGATAAGGAGGAAGGAGGG + Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG + Intronic
1164771852 19:30815881-30815903 TGGGAGGGAAAGAAGGAGGGAGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165102113 19:33445049-33445071 TGTGGGCTAAAGGGGGAGGCAGG - Intronic
1165209634 19:34223658-34223680 AGTGGGGTAAAGAGAGACGAAGG - Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1165331392 19:35142795-35142817 TGGGAGGGAAGGAGGGAGGAAGG + Intronic
1165810643 19:38609796-38609818 TAGGGGGAAAACAGGGAGGGAGG - Intronic
1165830056 19:38726046-38726068 TGGGAGGCCAAGTGGGAGGATGG + Intronic
1166062417 19:40334951-40334973 AGGGGGGTAGGGAGGGAGGGAGG + Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166346586 19:42170069-42170091 TGGGGGGAAAAGGAGGAGGAGGG + Intronic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166374677 19:42320989-42321011 GGGAGGGCAAAGAGAGAGGATGG - Intronic
1166467375 19:43044311-43044333 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
1166504114 19:43360979-43361001 TGTGGGGCAAAGACGGAGGCTGG - Intronic
1166506343 19:43373779-43373801 TGTGGGGCAAAGACGGAGGCTGG + Intergenic
1166707250 19:44914812-44914834 AGGGAGGTAGGGAGGGAGGAGGG + Intronic
1166885939 19:45960949-45960971 TGGGAGGGAGAAAGGGAGGAAGG + Intronic
1166948086 19:46409251-46409273 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1167059548 19:47135308-47135330 TGGGGGGTGGAGGGGAAGGAGGG - Intronic
1167195099 19:48023116-48023138 AGGGAGGAAAAGAGAGAGGAAGG + Intronic
1167317592 19:48774406-48774428 GGGGGGCTGAAGTGGGAGGAAGG - Intergenic
1167324091 19:48813350-48813372 TGGGGAGAAAAGAGGGGGGAAGG + Intronic
1167393615 19:49212640-49212662 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167574081 19:50309441-50309463 TGGGGGGCAGAGAGAGATGAAGG - Intronic
1167929163 19:52849797-52849819 GGAAGGGTAAAGAGGTAGGATGG + Intronic
1167952165 19:53036587-53036609 GGGGGTGTAAACAGGGAAGAGGG - Intergenic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
1168362111 19:55750521-55750543 TGGGGGGAAGAGAGGGAGGGGGG - Intergenic
1168489088 19:56792657-56792679 AAGGGGGTAATGAGGAAGGAGGG + Intronic
1168502153 19:56902058-56902080 TGAGGGGAAGAGAGGGAGGGGGG + Intergenic
924990741 2:310733-310755 AGCCGGGTAAAGATGGAGGAGGG + Intergenic
925507706 2:4586778-4586800 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
925875352 2:8307152-8307174 TGATGGGTACAGAGGGAGTAGGG - Intergenic
926269441 2:11354261-11354283 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
926433877 2:12818388-12818410 TGGGAGGGAAGGAGGGAGGGAGG - Intergenic
926459136 2:13106661-13106683 TGGGAGGTAAAGAAAGACGAAGG - Intergenic
926846461 2:17146540-17146562 TGGGGGGTGAAGAGAGAGAAAGG + Intergenic
926869104 2:17392441-17392463 TGGAGGGTGAAGAGGAAGCAAGG - Intergenic
927231673 2:20830077-20830099 TGGAGGGTGAAGAGGAAGCAAGG - Intergenic
927327903 2:21827591-21827613 TGGGGGAAAGAGAGGGAGGGTGG - Intergenic
927482238 2:23463441-23463463 TGAGGGCTAATGAGGGAGGAGGG + Intronic
927877882 2:26670826-26670848 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
927974411 2:27327134-27327156 TGGGGGGAAATGAGAGTGGAGGG + Intronic
928205085 2:29278243-29278265 TGGGGAGCAAGGAGTGAGGAAGG + Intronic
928591447 2:32819861-32819883 TGTGGGGTAAGGAGGAAGCACGG - Intronic
929027658 2:37620183-37620205 TGGGGGGTGGAGTGGGAGAATGG - Intergenic
929190997 2:39139577-39139599 GGGGGGATAAAGAGAAAGGAAGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929609161 2:43257095-43257117 TGGTGGGTGGAGAGGGGGGATGG + Intronic
929642064 2:43591439-43591461 TGGAGGGTAAAGAGGGAGGTGGG - Intronic
930018440 2:46986510-46986532 TGGGGGGGAAAGAGGCAGAGAGG + Intronic
930167773 2:48220165-48220187 AGGTGGCTAAAGAGGGAGCAAGG + Intergenic
930253803 2:49065854-49065876 TGGGAGGTTAATAGGGAGGCAGG + Intronic
930530556 2:52583150-52583172 CGGAGGGTAAAGAGGAAGCAAGG + Intergenic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
930654188 2:53992034-53992056 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
930752197 2:54945047-54945069 GGGGAGGCAGAGAGGGAGGAGGG - Intronic
930781579 2:55229251-55229273 TGGGGGATAGAGAGTAAGGAAGG + Intronic
930966696 2:57337249-57337271 TGGAGAATAAAGAGGTAGGATGG + Intergenic
931307261 2:61041888-61041910 TGGCAGGTAAAAAGGAAGGACGG + Intronic
931419884 2:62117083-62117105 GTGGGGGCAAAGAGGGAGGCAGG - Intronic
931420837 2:62125915-62125937 TCGGGGGTGAAGTGGGGGGAAGG - Intronic
931470559 2:62534633-62534655 AGGGGGGAAAAGAGGGAGGGTGG - Intergenic
932071612 2:68626361-68626383 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932130554 2:69183505-69183527 TGGGGGTTGAGGTGGGAGGATGG - Intronic
932265191 2:70361640-70361662 TGGGGGTCAAAGGTGGAGGAAGG - Intergenic
932303557 2:70685814-70685836 TGGGGGAGGAAGAGGGAGGTGGG - Intronic
932416905 2:71579076-71579098 TGTGGGGTGGAGAGGGAGGCTGG - Intronic
932418309 2:71586778-71586800 TGGGAGGGAGAGAGGAAGGATGG + Intronic
932626771 2:73302717-73302739 TTGGGGCAAAAGAGAGAGGAAGG + Intergenic
933109467 2:78379157-78379179 AGGGGGGAAAGGAGGGAGGGAGG + Intergenic
933120915 2:78536867-78536889 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
933788308 2:85862343-85862365 TGGAGGGTAAATGGGGAGCAGGG + Intronic
934124181 2:88870619-88870641 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
934325234 2:92007701-92007723 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
934609099 2:95721519-95721541 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
935178732 2:100671848-100671870 TGGAGGCTGAAGTGGGAGGATGG - Intergenic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
935436747 2:103043849-103043871 TGGGGGGAAGAGGGGGAGGGTGG + Intergenic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
935789568 2:106578366-106578388 TGGGGGGTAAAGAGGAGGGCAGG - Intergenic
936259091 2:110942980-110943002 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
936286037 2:111182142-111182164 AGGAGGCTCAAGAGGGAGGAGGG - Intergenic
936542420 2:113363100-113363122 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
936568436 2:113597250-113597272 TGGGGGCTAGAGAGGAAGCAGGG + Intergenic
936679817 2:114757220-114757242 AGGGTGGGGAAGAGGGAGGAAGG + Intronic
936883072 2:117279379-117279401 TGAGGGATAATGAGGGAGGTTGG - Intergenic
936976032 2:118223681-118223703 TGGGGGGTTTACAAGGAGGACGG + Intergenic
937034537 2:118769840-118769862 AGAGGGGGAAAGAGGGAGGAAGG + Intergenic
937293769 2:120797719-120797741 GGGAGGGGAGAGAGGGAGGAGGG + Intronic
937293775 2:120797735-120797757 AGGAGGGGAGAGAGGGAGGAGGG + Intronic
937372435 2:121309333-121309355 AGGGAGGCAAAGAGGGAGGGAGG + Intergenic
937693685 2:124784166-124784188 TGGGAGGGAAGAAGGGAGGATGG + Intronic
937697683 2:124826406-124826428 TGGGAGGTAAAGAGAGAAGGTGG + Intronic
937990258 2:127658292-127658314 TGGAGGCTGAAGTGGGAGGATGG + Intronic
938509922 2:131930351-131930373 TGAGGGGAAAAGTGGGAGGGGGG + Intergenic
938917062 2:135952552-135952574 TGGGGGGCAGAGGGGGATGAGGG - Intronic
939055577 2:137360744-137360766 TGGGGTGTACAGAGGCAGGCAGG - Intronic
939158882 2:138561864-138561886 GAGGGGGTAGAGAGGGAGGGGGG - Intronic
939292903 2:140218575-140218597 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
939846613 2:147254647-147254669 TCTGGGGTAAACAGGGAGGAAGG + Intergenic
939992605 2:148889423-148889445 TGGGCTATATAGAGGGAGGAAGG + Intronic
940822446 2:158372135-158372157 TGGAGGATATAGAGGGAGTAAGG - Intronic
941038174 2:160590477-160590499 GGGAGGGTGAAGGGGGAGGAGGG - Intergenic
941199102 2:162487468-162487490 TGGGGGGTGAGTGGGGAGGAGGG + Intronic
941339305 2:164286966-164286988 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
941367156 2:164622005-164622027 TGGGGGGTTGATAGGGAGCAAGG + Intergenic
942439950 2:176022579-176022601 GGGGGGCTAAGGTGGGAGGATGG + Intergenic
942449130 2:176098403-176098425 TGGGGGGGAGAGAGGGAGTGAGG - Intergenic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
942609674 2:177730217-177730239 TGGGGTGTGGGGAGGGAGGAAGG - Intronic
942618074 2:177815554-177815576 TGGGAGGGAAAGAAGGAGGAAGG - Intronic
942825309 2:180168799-180168821 TGGGAGGTAAAGGGGAAGCAAGG + Intergenic
942893596 2:181021607-181021629 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
942913693 2:181277257-181277279 AGAGGGGTAAAAAGGGAGAAAGG - Intergenic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
942998203 2:182291150-182291172 TGGAGGGTCTAGAAGGAGGATGG - Intronic
943202771 2:184850083-184850105 GTGGGGGTAAAAAGTGAGGATGG + Intronic
943356481 2:186862286-186862308 TGGGAGGGAGAGAGAGAGGAGGG + Intergenic
943384741 2:187187154-187187176 TGGGGTGGAGGGAGGGAGGAGGG + Intergenic
943409246 2:187525448-187525470 AGAGAGGGAAAGAGGGAGGAAGG - Intronic
943446271 2:187991961-187991983 TGGGAGGCATAGAGGGAGGGAGG + Intergenic
943604961 2:189966182-189966204 TGGGGGGGAAAGGGTGAGAAGGG + Intronic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
943868095 2:192955320-192955342 TGTGGGAGAATGAGGGAGGAAGG - Intergenic
944235238 2:197436282-197436304 TGAGAGGGAAAGAGGGAGCAAGG - Intergenic
944867841 2:203879978-203880000 TCGGGGGTGAAGAGGAGGGAGGG + Intergenic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
945128630 2:206541517-206541539 TGGAGGGGAAAGAGGGACAAAGG + Intronic
945223092 2:207504508-207504530 TGGGGAGAAAAGAGGGACTAAGG + Intergenic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
945238352 2:207653583-207653605 AGGGGAGGAGAGAGGGAGGATGG + Intergenic
945283710 2:208061414-208061436 TGAGGGGGAAAGGGGGAGGCTGG - Intergenic
945712406 2:213315284-213315306 AGGGTGGTAAAGAGGGAGGTGGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946036276 2:216744925-216744947 TGGGAGCTAGAGAGTGAGGAAGG + Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
946357182 2:219195247-219195269 TGGGGGGTGGGGAGGTAGGAGGG - Intronic
946524646 2:220505246-220505268 AGGAGTGTAAGGAGGGAGGAAGG + Intergenic
946686968 2:222280298-222280320 AGGGAGGGAAGGAGGGAGGAGGG + Intronic
946768610 2:223063727-223063749 TGGGAAGTCAAGAGTGAGGAGGG - Intronic
946809273 2:223506090-223506112 TGGAAGGTAAAGGGGGAAGATGG - Intergenic
946820539 2:223624789-223624811 TGGGGGGAAGAGTGGGAGGAGGG - Intergenic
947006053 2:225512640-225512662 TGGGAGGAAGGGAGGGAGGAAGG - Intronic
947010278 2:225558456-225558478 TGGGCTTTAAAGATGGAGGACGG - Intronic
947029932 2:225782570-225782592 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
947030044 2:225782988-225783010 AGGAAGGTGAAGAGGGAGGAGGG - Intergenic
947377803 2:229514681-229514703 TGTTGGGGAAAGAGGGTGGAGGG - Intronic
947926492 2:233926353-233926375 TGGAGGGTAAAGAGGAATTAGGG + Intronic
947996631 2:234533534-234533556 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948103146 2:235391339-235391361 GGGGAGGTAGAGAGGGAGGCTGG - Intergenic
948199090 2:236116744-236116766 TGGGGGGAAGAGTGGGAGGGGGG - Intronic
948237527 2:236401755-236401777 TGCGGGGAAGAGAGGGGGGAAGG + Intronic
948386323 2:237583231-237583253 TGGAGGCTAAGGTGGGAGGATGG + Intronic
948443733 2:238015912-238015934 GGCGGGGTAAAGAGGGAGTGGGG + Intronic
948485548 2:238278733-238278755 TGCCGGGTAAAGAGGGCAGAGGG + Intronic
948570868 2:238916426-238916448 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
948770822 2:240250542-240250564 GGAGGGCTGAAGAGGGAGGAGGG + Intergenic
1168744113 20:221470-221492 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1168955083 20:1828973-1828995 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1168966640 20:1902634-1902656 TGGGGAGAAAAGCAGGAGGAGGG + Intronic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169195235 20:3679240-3679262 AGGGAGGGAAAGAGGGAGGTGGG + Intronic
1169216254 20:3796404-3796426 GGGGGGGGAAGGAGGGAGGGAGG - Exonic
1169505758 20:6209384-6209406 AGGGAGGGAAAGAGGGAGGAAGG - Intergenic
1169584627 20:7067302-7067324 TGGGGGGAAGAATGGGAGGAGGG + Intergenic
1169990549 20:11498291-11498313 AGGGAGGAAAAGAGAGAGGAAGG + Intergenic
1170041233 20:12041837-12041859 TGGGGCCTAAAGAGGGTGGAGGG - Intergenic
1170151434 20:13231025-13231047 TGGTAGGCGAAGAGGGAGGAAGG - Intronic
1170155897 20:13269091-13269113 TGGGGGGCAAAGAGGGCGTGTGG + Intronic
1170612991 20:17929381-17929403 TGAGGGGCAGCGAGGGAGGAGGG + Intergenic
1170631749 20:18072333-18072355 AGGGAGGGAAGGAGGGAGGAGGG - Intergenic
1171779956 20:29409706-29409728 TGGAAGGGAAAGAGGGAGGGAGG - Intergenic
1172022091 20:31921823-31921845 TGGGGTGGAAGGAGGGGGGAGGG + Intronic
1172134117 20:32675720-32675742 TGGAGGGGAAAGAGGGAGATAGG + Intergenic
1172485008 20:35292578-35292600 TGGGAGGAAGAGAGGGAGGCAGG - Intergenic
1172537950 20:35688746-35688768 AGGGAGGAAAAGAGGGAGGGAGG + Intronic
1172537954 20:35688763-35688785 GGGAGGGAAAAGAGGGAGAAAGG + Intronic
1172545011 20:35753919-35753941 TGGGAGGCCAAGGGGGAGGATGG + Intergenic
1172632260 20:36386361-36386383 AGGAAGGTAGAGAGGGAGGAGGG + Intronic
1172663087 20:36580703-36580725 GGGGGGCTGAAGTGGGAGGAAGG + Intronic
1172687787 20:36770021-36770043 TGGGGTGCAGGGAGGGAGGAGGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172835382 20:37869915-37869937 TGGGAGGGGAAGGGGGAGGATGG - Intronic
1172939107 20:38642613-38642635 TGGGAGGGAAGGAGGGAGGGAGG - Intronic
1173550222 20:43927764-43927786 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1173581768 20:44152030-44152052 TTGGTGGTGGAGAGGGAGGAAGG - Intronic
1173594106 20:44247738-44247760 TGGGAGGGAAAGAGGCAGAATGG - Intronic
1173716916 20:45216155-45216177 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1173976824 20:47193322-47193344 TGGGGGCCAAGGTGGGAGGATGG + Intergenic
1174065756 20:47864328-47864350 TGGGAGGGAAGGAGAGAGGAAGG - Intergenic
1174187609 20:48717781-48717803 AGGGGGGTAAAGTGGGAAGAGGG + Intronic
1174221539 20:48959514-48959536 AGGGAGGGAAAGAGGGAGGGTGG - Intronic
1174692038 20:52515967-52515989 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1175176023 20:57112575-57112597 TGAGGGGTTAAGAGGGAGCTGGG + Intergenic
1175499862 20:59442102-59442124 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1175563849 20:59956549-59956571 TGGGGGGAAGAGTGGGAAGAGGG - Intergenic
1175872968 20:62217056-62217078 GGGAGGGGAAAGAGGGAGGGAGG - Intronic
1175903045 20:62367424-62367446 GGGGGGGGAAGGAGAGAGGAGGG + Intergenic
1176057144 20:63154843-63154865 AGGGAGGGAAAGGGGGAGGAGGG - Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1177304301 21:19292857-19292879 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1177348846 21:19908661-19908683 GGGGTGGTAAAAAGGGAGTAAGG + Intergenic
1177379226 21:20316520-20316542 TGCGGGAAAAAGAGGGAGAAAGG + Intergenic
1177457192 21:21355508-21355530 AGGGAGGGAGAGAGGGAGGAGGG + Intronic
1178439896 21:32590309-32590331 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1178532947 21:33390256-33390278 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1178808580 21:35860146-35860168 AGGGAGGGAAAGAGGGAGGGAGG + Intronic
1178906967 21:36644413-36644435 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
1179077053 21:38132313-38132335 TGGGGGGAAAAAAAGAAGGAGGG + Intronic
1179291409 21:40021057-40021079 TGGGGGGGTGTGAGGGAGGATGG + Intronic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1179635605 21:42706773-42706795 TGGGGGGTGAAGGGGATGGAGGG - Intronic
1179798571 21:43799723-43799745 GGGGGCGTTAGGAGGGAGGATGG + Intronic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1179919140 21:44498004-44498026 TGGAGGGGGCAGAGGGAGGAGGG + Exonic
1179925007 21:44529450-44529472 TGGGGGGCAAAAGGGGATGAGGG + Intronic
1179958213 21:44752660-44752682 TGGGAGGGAGAGAGGAAGGAAGG + Intergenic
1180203254 21:46240025-46240047 TGGTGGCTAAAGAGGGAAGTGGG + Intronic
1180875742 22:19174529-19174551 TTGGGGGTACAAAGGGAGCACGG - Intergenic
1180973851 22:19833463-19833485 TGGGAGGCCAAGACGGAGGATGG + Intronic
1181087161 22:20446264-20446286 TGGGGGGAAAAGGGGGTGTATGG + Intronic
1181396998 22:22629812-22629834 TGGGCGGGGCAGAGGGAGGAGGG + Intergenic
1181461593 22:23089081-23089103 TGGGAGGTGAGGAGGGAGGGAGG + Intronic
1181499743 22:23309171-23309193 TGGGCGGGGCAGAGGGAGGAGGG + Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181779691 22:25183820-25183842 TGGGAGGGAGGGAGGGAGGAAGG - Intronic
1181819196 22:25462556-25462578 AGGGGGAGGAAGAGGGAGGAAGG - Intergenic
1181963272 22:26638362-26638384 AGGGAGGGAAAAAGGGAGGAAGG + Intergenic
1181969477 22:26679478-26679500 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1182377743 22:29860424-29860446 AGGAAGGAAAAGAGGGAGGAAGG - Intergenic
1182383003 22:29909093-29909115 TGGAGGCTAAATTGGGAGGATGG - Intronic
1182477441 22:30583860-30583882 TGTGGGGCAGAGAGGCAGGAAGG + Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1182962413 22:34488193-34488215 AGGAAAGTAAAGAGGGAGGAAGG - Intergenic
1182969238 22:34556121-34556143 TGGGGGGAAGAGTGGGAGGAGGG - Intergenic
1183042623 22:35193614-35193636 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183085436 22:35483885-35483907 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1183464359 22:37972159-37972181 GGGTGGGGAAAGAGGGAGGGAGG + Intronic
1183517918 22:38278272-38278294 TGGAGGATAGAGAGGGAGGTGGG + Intergenic
1184116341 22:42424857-42424879 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1184241045 22:43211387-43211409 TGCGGGGGAGACAGGGAGGAGGG + Intronic
1184318619 22:43720634-43720656 AGGGAGGAAAAGAGAGAGGAAGG + Intronic
1184537112 22:45094696-45094718 AGGGGGGGGAAGAGGGAGGAAGG - Intergenic
1184803486 22:46776685-46776707 TGGGGAGGAGAGAGAGAGGAAGG + Intronic
1184863805 22:47191711-47191733 AGGGGGGGAGAGAGGGAGAAAGG + Intergenic
1185019353 22:48365288-48365310 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1185100951 22:48840586-48840608 AGTGGGGTGTAGAGGGAGGAGGG - Intronic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1185202469 22:49516670-49516692 TGGGAGGGAGAGAGGGAGGAGGG + Intronic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
949299508 3:2567445-2567467 TGAGGGGGAAAGAGGCTGGAAGG - Intronic
949533523 3:4978940-4978962 TGGGAGGGAACGGGGGAGGACGG - Intergenic
949680282 3:6505709-6505731 TGGGGCCTATAGAGGGTGGAGGG + Intergenic
949759951 3:7459346-7459368 TGGGGAGCAGAGAGGGAGGAAGG + Intronic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950062377 3:10082709-10082731 TGGGGGTTAGAGAGGCAGGATGG - Intronic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950122119 3:10488816-10488838 TGGGGGGTGAGGTGAGAGGAAGG - Intronic
950279176 3:11691688-11691710 TTGGGGGTGAAGAGAGAGAAAGG - Intronic
950308311 3:11934057-11934079 AGGGGGCTAAGGCGGGAGGATGG - Intergenic
950582134 3:13869488-13869510 AGGGAGGGAAAGAGAGAGGAAGG + Intronic
950598709 3:14011292-14011314 TTGGGGGAAAAGAGGGGGAAAGG - Intronic
950623946 3:14230670-14230692 TGTGGGGTCAAGAGGGAAAACGG - Intergenic
950769604 3:15301065-15301087 TGTTGGGAAAAGAGGTAGGAGGG - Intronic
950823754 3:15792574-15792596 TGGGGGGTTGAGTGGGAGGTGGG + Intronic
950837735 3:15936626-15936648 TGGGGGGGTAAGTGGGTGGAAGG - Intergenic
951002169 3:17575209-17575231 TGGGGGCTGAGGTGGGAGGATGG + Intronic
951022022 3:17791610-17791632 TGGGAGGGAGAGAGGGAGGGAGG - Intronic
951269762 3:20609314-20609336 TGAGGGGAAGAGAGGGAGGGGGG + Intergenic
951525975 3:23653162-23653184 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
951926761 3:27916164-27916186 TGAGGGGTAATGTTGGAGGAAGG - Intergenic
952014056 3:28936146-28936168 AGGGAGGAAAAGAGGAAGGAAGG - Intergenic
952043101 3:29283483-29283505 TGGGGGGTAAAGAGAGAGAGTGG + Intronic
952345124 3:32476638-32476660 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952467737 3:33608528-33608550 TGGGGAGGAAAGTGGGAGGAAGG + Intronic
952752307 3:36834719-36834741 TGGGAGGAAGAGAGGGAGAAAGG + Intronic
952786193 3:37157557-37157579 AGAGGGGAAAAGAGGAAGGAGGG + Intronic
952860492 3:37808390-37808412 TGGGGGAGAAAGATGCAGGATGG + Intronic
953023524 3:39131140-39131162 TGGGGGCTGAAGGAGGAGGAAGG + Intronic
953098850 3:39806648-39806670 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
953170193 3:40500164-40500186 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
953256059 3:41291516-41291538 AGGGAGGGAAAGAGGAAGGAAGG + Intronic
953352204 3:42223792-42223814 TGGGGGGAAGAGAGGGAGGTGGG - Exonic
953357423 3:42266629-42266651 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
953904375 3:46861148-46861170 AGGGGGGCAAGGAGGCAGGAGGG - Intronic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
954126718 3:48535477-48535499 TGGGAGGTAGACAGGGAGGGAGG + Intronic
954163499 3:48738718-48738740 TGGGGAGCAAAGAGGGAGACCGG + Intronic
954544318 3:51419866-51419888 TGAGGAGTAAAGAGGGAGAAAGG + Exonic
954582296 3:51709454-51709476 TGGGGGCTAGGGAGGGAGGCCGG + Intronic
954675892 3:52315246-52315268 TGGGGGCCCAAGAGGGAGGCTGG + Intergenic
954698987 3:52441914-52441936 TGGGAGGGAGAGAGGGAGGGAGG + Intronic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955231406 3:57102163-57102185 AGGGGGCTGAAGTGGGAGGATGG + Intronic
955234592 3:57128530-57128552 CGGGGGGCAAAGTGGGTGGAGGG - Intronic
955525732 3:59817951-59817973 TGGGGGGAAGAAAGAGAGGAAGG + Intronic
955960207 3:64332856-64332878 TGGGGTGGATAAAGGGAGGACGG + Intronic
955977245 3:64490494-64490516 TGGGGGGAAGAGAGAGAAGAAGG + Intergenic
956159672 3:66335899-66335921 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
956933088 3:74068321-74068343 TGGAGGCTAAGGTGGGAGGATGG + Intergenic
957086046 3:75678138-75678160 AGGGGGGGAAGGTGGGAGGAGGG - Intergenic
957859704 3:85930585-85930607 TGGGGGTTTGAGAGGGAGGTAGG - Intronic
958002816 3:87772727-87772749 TGGGGGGAAGAGAGGTAGGGGGG - Intergenic
958089715 3:88861300-88861322 TGGGAGGAAGAGTGGGAGGAGGG + Intergenic
958117109 3:89234763-89234785 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
958117152 3:89234932-89234954 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
959185253 3:103038647-103038669 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
959389670 3:105758943-105758965 TGGGGCGTGAAGGGGGTGGAGGG + Intronic
959434774 3:106301020-106301042 AGGAGAGAAAAGAGGGAGGAGGG - Intergenic
960230165 3:115216663-115216685 TGGAGGCTAAGGTGGGAGGATGG - Intergenic
960271565 3:115680047-115680069 TGGGAAGGAAGGAGGGAGGAAGG - Intronic
960273419 3:115699357-115699379 TGGTGGGGGAAGAGGAAGGAAGG - Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960681953 3:120257954-120257976 TGAGGGGGAAAAAGTGAGGAGGG + Intronic
961159421 3:124710322-124710344 TGGCAGGGACAGAGGGAGGAAGG + Intronic
961422411 3:126816853-126816875 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
961554099 3:127685782-127685804 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
961927535 3:130497095-130497117 TAGGGGGTAGAGAGGGATTAGGG - Intergenic
962013505 3:131417268-131417290 TGGGGGAAAGAGTGGGAGGAGGG + Intergenic
962054654 3:131857742-131857764 TGGGAGGTAGAGAGGCATGAAGG - Intronic
962227630 3:133628828-133628850 AGAGGGGTAAAGAGAGAGAAGGG + Intronic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
962492052 3:135903888-135903910 TGGAAGGAAAAGAGGGAGGCTGG - Intergenic
962607560 3:137045129-137045151 TGTAGGATAAAGAGGAAGGAGGG + Intergenic
962619917 3:137167997-137168019 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962619926 3:137168021-137168043 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962619935 3:137168045-137168067 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
963584409 3:147166011-147166033 TGAGGGGCAAAGAGTGAGAAAGG - Intergenic
963837015 3:150067977-150067999 TTGGGGGTAAAGGAGAAGGAGGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963924294 3:150935285-150935307 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
964184420 3:153925231-153925253 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
964190457 3:153994394-153994416 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
964307910 3:155360762-155360784 TGGGAGGTAGAGAGGAAGAAAGG - Intergenic
964330203 3:155593811-155593833 TGAGGGGTAAAGAAAGAGAAAGG + Intronic
964592048 3:158376063-158376085 AGGGGGGTCGAGAGGGAGGGAGG - Intronic
964600658 3:158497396-158497418 TGGGGGGAAGAGTGGGAGGGGGG - Intronic
964808786 3:160640264-160640286 TGATGAGTAAAGAGGCAGGAAGG - Intergenic
964915826 3:161839945-161839967 TGGGGGGAAGAGTGGGGGGAGGG - Intergenic
965039051 3:163482723-163482745 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
965132673 3:164722103-164722125 TGGGGAGTAAGGATGGAGGGTGG - Intergenic
965211634 3:165797288-165797310 AGGGGGGGAGGGAGGGAGGAAGG - Intronic
965421019 3:168458363-168458385 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
965857474 3:173105748-173105770 AGGGAGGAAAAGAGGGAGGGAGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966117199 3:176479556-176479578 TGGGGGGAAGAGTGGGAGGGAGG - Intergenic
966127999 3:176602711-176602733 TGGAGGGGAAAAAGTGAGGATGG + Intergenic
966251777 3:177874179-177874201 TGTGGGTTAGTGAGGGAGGATGG + Intergenic
966461506 3:180181717-180181739 AGGGAGGGAAGGAGGGAGGATGG - Intergenic
966713145 3:182989668-182989690 GGAGGGGTTAAGAGGGAGGAAGG + Intergenic
966886492 3:184380279-184380301 TGGGGAGGAGGGAGGGAGGAGGG - Exonic
966892502 3:184417451-184417473 CGGGGGGCGGAGAGGGAGGAGGG + Intronic
967768773 3:193311546-193311568 GGGGAGGGAAAGAAGGAGGAAGG + Intronic
967884119 3:194321840-194321862 TGGGGTGTACAGCGGGGGGAGGG + Intergenic
967932223 3:194698394-194698416 TGGGGGATAAAGTGGGGGGCTGG + Intergenic
968115635 3:196087220-196087242 TGGGGGCTGAAGTGGGAGGATGG + Intergenic
968339268 3:197941366-197941388 GGGAGGGGAGAGAGGGAGGAAGG - Intronic
968359755 3:198138743-198138765 TGGGGAGAGACGAGGGAGGAGGG - Intergenic
968570065 4:1334624-1334646 AGTGTGGTAAAGAGGGAGGCAGG + Intronic
968601513 4:1512099-1512121 TGAGAGGGAATGAGGGAGGAAGG + Intergenic
968960781 4:3742467-3742489 GGGGGTGTGAAGGGGGAGGAAGG - Intergenic
968986985 4:3880832-3880854 TGGGGAGGAGAGAGGAAGGAAGG + Intergenic
969081979 4:4626187-4626209 AGGAGGCTAAAGTGGGAGGAGGG - Intergenic
969132830 4:5004282-5004304 AGGGGAGAAAAGAGGAAGGATGG + Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969180738 4:5438743-5438765 TGGGGTGTGGGGAGGGAGGAGGG - Intronic
969481408 4:7448863-7448885 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481466 4:7449024-7449046 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481535 4:7449202-7449224 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969495313 4:7523037-7523059 AGGGGAGGAAGGAGGGAGGAGGG - Intronic
969504291 4:7574598-7574620 AGGGAGGCAAGGAGGGAGGAAGG + Intronic
969523403 4:7691978-7692000 TGGGGGGCAAGCAGGGAGGGAGG - Intronic
969584593 4:8084597-8084619 TGAGGGATGAAGAGGCAGGAAGG - Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969728846 4:8941310-8941332 TGGGGAGGAGAGAGGAAGGAAGG - Intergenic
969823703 4:9740216-9740238 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970297160 4:14642210-14642232 TGGGAGGGAGGGAGGGAGGAAGG + Intergenic
970297182 4:14642277-14642299 AAGGAGGCAAAGAGGGAGGAAGG + Intergenic
970522357 4:16898691-16898713 AGGGAGGGAAAGAGGGAGGGAGG + Exonic
970754654 4:19410808-19410830 TTTGGGGAAAAGAAGGAGGAAGG + Intergenic
970831273 4:20343193-20343215 TGGGGGATGAAGAGAGAGGCTGG - Intronic
970998918 4:22300793-22300815 TGGAGAATAAAGAGGGAAGAAGG - Intergenic
971029550 4:22621547-22621569 GGGAGGGTAAAGATGGAGGCAGG + Intergenic
971182619 4:24343888-24343910 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
971898649 4:32628866-32628888 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
972028031 4:34411989-34412011 AGTGGGCTAAAGGGGGAGGAAGG - Intergenic
972273254 4:37532958-37532980 TGGGGGGAACAGTGGGAGGGGGG + Intronic
972335674 4:38105586-38105608 TGGGGGGTGGAGAGGGAGGGAGG - Intronic
972381582 4:38524799-38524821 TTGGGGGCAAAGAGTCAGGAAGG + Intergenic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
972778645 4:42266223-42266245 TGGGGGGAAGATAGGGAGGAGGG - Intergenic
973015116 4:45128476-45128498 TGGGGGGTAAAGGGGTGGGCGGG + Intergenic
973061783 4:45735451-45735473 AGGGAGGGAAAGAGAGAGGAAGG - Intergenic
973287114 4:48431164-48431186 TGGAGGGGAAAGAGTGAGGGAGG - Intergenic
973554059 4:52064422-52064444 TGGAGGGAAAGGAAGGAGGAGGG - Intronic
973596036 4:52490766-52490788 AGGGAGGGAATGAGGGAGGAAGG + Intergenic
974200220 4:58627651-58627673 TGGGGGGTGGAGAGGGTGGGAGG + Intergenic
974330229 4:60468268-60468290 TGGGGTGGAAGGAGGGGGGAGGG + Intergenic
974536197 4:63178975-63178997 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
975063241 4:70030534-70030556 GGGAGGCTAAAGTGGGAGGATGG + Intronic
975430270 4:74281716-74281738 AGGGAGGGAAAGAGAGAGGAAGG - Intronic
975481461 4:74885226-74885248 TGGTGGGTAAAGAGGGTGCGTGG + Intergenic
975486847 4:74943224-74943246 TGAGGGGTAAGGAGGGATGGAGG - Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976114255 4:81710194-81710216 TGGGGGGTGAGGGGGGAGGTGGG - Intronic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976476684 4:85492083-85492105 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976873161 4:89821273-89821295 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
977290563 4:95160602-95160624 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
977307299 4:95341561-95341583 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
977370401 4:96127136-96127158 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
977873092 4:102116977-102116999 TGGGGGGTGGGGAGTGAGGATGG - Intergenic
978582644 4:110247759-110247781 TGGAGGTTGAAGTGGGAGGATGG - Intergenic
978726115 4:111971749-111971771 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
978808500 4:112825188-112825210 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
979220173 4:118214117-118214139 TGGTAGGTAAAGAGACAGGAAGG + Intronic
979506456 4:121502741-121502763 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979506466 4:121502765-121502787 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979548624 4:121964984-121965006 TGGGGAGAAAGGAGGGAGAATGG - Intergenic
979698513 4:123640848-123640870 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
979781114 4:124652023-124652045 TGTGGGGTACACAGGGAGCAGGG - Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980086701 4:128398209-128398231 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
980395334 4:132206989-132207011 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980430421 4:132686739-132686761 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980509496 4:133766717-133766739 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
980563032 4:134502051-134502073 GGGGGGGAAAAGGGGGAGGAAGG - Intergenic
980968738 4:139549523-139549545 AGGGAGGCAAAAAGGGAGGAAGG - Intronic
980971630 4:139572743-139572765 GGGAGGGTAGAGAGAGAGGAAGG - Intronic
981056293 4:140365595-140365617 TGGAGGAGAAAAAGGGAGGAAGG - Intronic
981347198 4:143689877-143689899 TGGGGGGAAGAGTGGGAGGGGGG + Intronic
981622089 4:146712810-146712832 TTCAGGGTAAAGAGAGAGGATGG + Intronic
981654519 4:147098275-147098297 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
981760247 4:148186759-148186781 TGGGGGGAAGAGTGGGAGGGGGG - Intronic
981799876 4:148643037-148643059 TGGGGTGGAATGAGGGAGGAAGG + Intergenic
981837169 4:149067466-149067488 GGGGGGGAATAGAGGGAGGGAGG + Intergenic
981850098 4:149219390-149219412 TGTGGGGAAAAGCGGGAGAAGGG - Intergenic
982084224 4:151817633-151817655 TGAGGGATAATGAGGGAGGTTGG + Intergenic
982326101 4:154129392-154129414 TGGGGGGTATAGAGGAAGATGGG + Intergenic
982448368 4:155521953-155521975 TCGGGGACTAAGAGGGAGGATGG - Intergenic
982593620 4:157349436-157349458 AGCGGGGGAAGGAGGGAGGAAGG - Intronic
982679610 4:158413200-158413222 TGGGGGGAAGAGTGGGAGGGAGG - Intronic
982967338 4:161929107-161929129 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
983175208 4:164580148-164580170 TGGGGGGAAGAGTGGGAGGGAGG - Intergenic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
983522837 4:168728851-168728873 TGGGGGGAAGAGTGGGAGGAGGG - Intronic
983707436 4:170678220-170678242 TGAGGGATAATGAGGGAGGTTGG - Intergenic
984675555 4:182543236-182543258 TGGAGGGAAGGGAGGGAGGAAGG + Intronic
984735402 4:183103211-183103233 GGGAGGGTGAAAAGGGAGGAAGG + Intronic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985093409 4:186387453-186387475 TGGGGGGAAGAGAGGGAGGGGGG + Intergenic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985168817 4:187126736-187126758 AGGGGGGAAAGAAGGGAGGAAGG - Intergenic
985756632 5:1723376-1723398 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
985851589 5:2392474-2392496 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986263127 5:6166569-6166591 TGGGTTGAAAAGAGGGATGAGGG - Intergenic
986313378 5:6571142-6571164 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313391 5:6571177-6571199 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313415 5:6571247-6571269 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313470 5:6571414-6571436 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313483 5:6571449-6571471 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313496 5:6571484-6571506 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313520 5:6571554-6571576 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313548 5:6571633-6571655 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313561 5:6571668-6571690 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313574 5:6571703-6571725 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986344022 5:6817792-6817814 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986490746 5:8286981-8287003 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
986548580 5:8926835-8926857 TGGGGGGTCAGGAGGAAGTAGGG + Intergenic
986704931 5:10447006-10447028 AGGGGTGTAAAGAGAGAGAAAGG + Intronic
986831618 5:11585838-11585860 TGGGGGGTGAGGAGAAAGGAGGG + Intronic
987047755 5:14123562-14123584 TGGGGGGAAAGGAGTGGGGAAGG + Intergenic
987069132 5:14319330-14319352 TGTGAGGTAAAGAGTGAGGCTGG + Intronic
987388182 5:17350252-17350274 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
987747118 5:21989551-21989573 TGGGGGGTACAGAGTGAGTCAGG - Intronic
987896099 5:23949391-23949413 TGGGAGGGGAAGGGGGAGGAAGG - Intergenic
988052157 5:26044274-26044296 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
988196061 5:28007560-28007582 TGAAGGGGTAAGAGGGAGGAGGG + Intergenic
988463598 5:31465759-31465781 AGGGAGGAAGAGAGGGAGGAGGG - Intronic
988609502 5:32711698-32711720 TGGGGAGGAAAGAGGAAGGGTGG + Exonic
988802924 5:34713640-34713662 TTGGGAGTCAAGAGGAAGGAAGG - Intronic
988902731 5:35751311-35751333 TGGGGGGAAGAGTGGGAGGGGGG + Intronic
989056591 5:37371362-37371384 TGAGGAGGAAGGAGGGAGGAGGG + Intergenic
989111857 5:37914164-37914186 TGGGGGGCAGAGGGAGAGGAGGG + Intergenic
989191540 5:38674330-38674352 TGTGGGGGAAAGAGAGAGAATGG + Intergenic
989248654 5:39282065-39282087 AGGGGGGGAGGGAGGGAGGAAGG - Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989665210 5:43846250-43846272 AGGAGGGGAAAGAGGGAGGGAGG - Intergenic
989969917 5:50511299-50511321 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
990673159 5:58155184-58155206 TGGGGGGAAGTGTGGGAGGAGGG + Intergenic
990690247 5:58355743-58355765 TGAGGGGGAAGGAGGAAGGAAGG - Intergenic
990762312 5:59143157-59143179 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
990775631 5:59302524-59302546 TGGGGGGAAGAGTGGGAGGGGGG - Intronic
990846177 5:60142211-60142233 TGGGAGGGAGAGAGGGAGGGAGG + Intronic
991646783 5:68808276-68808298 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
991767297 5:69999315-69999337 TGGGGGGTACAGAGTGAGACAGG - Intergenic
991846533 5:70874393-70874415 TGGGGGGTACAGAGTGAGACAGG - Intergenic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992081026 5:73234319-73234341 TGGGCGGTGATGGGGGAGGAGGG - Intergenic
992118678 5:73567442-73567464 TGGGACGTAATGAGGGAGAAGGG + Intronic
992208761 5:74456717-74456739 TGGGGGAGAAAGAGAGAGAAAGG + Intergenic
992286046 5:75236676-75236698 TGTGAGGCAAAGATGGAGGAAGG - Exonic
992523816 5:77585818-77585840 TGGGGGGAAGAAAGGGAGGAGGG + Intronic
992605087 5:78447894-78447916 AGGAGGGAGAAGAGGGAGGAGGG - Intronic
992605100 5:78447928-78447950 AGAGGGGGAAGGAGGGAGGAAGG - Intronic
992737796 5:79741115-79741137 GGGAGGCCAAAGAGGGAGGATGG - Intronic
993481188 5:88426324-88426346 TGGGGAGAAGGGAGGGAGGAAGG + Intergenic
993627591 5:90244209-90244231 TGGGGTGGGAGGAGGGAGGAGGG + Intergenic
993965306 5:94352920-94352942 TGGGGGGAAGAGTGGGAGGGGGG + Intronic
993972957 5:94442398-94442420 TGAGTGGTAAAGAGAGAAGAAGG + Intronic
994012014 5:94915920-94915942 TGGGGAGCTAAGTGGGAGGAAGG + Intronic
994158565 5:96530168-96530190 TGGGAGGGAGGGAGGGAGGAAGG + Intronic
994513694 5:100742256-100742278 TGGGGGAAAAGGAGGGAGGGGGG + Intergenic
994913697 5:105945667-105945689 AGGGAGGGAAAGAGGGAGGGAGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995717939 5:115098715-115098737 TGGTAGGGAATGAGGGAGGATGG + Intergenic
995991590 5:118246645-118246667 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996151850 5:120047618-120047640 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
996702015 5:126459346-126459368 TGGAGGCTAATGTGGGAGGATGG - Intronic
996871862 5:128201215-128201237 TGGGGGGTGAAGGGGAGGGAAGG - Intergenic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
997291865 5:132742910-132742932 TGGAAGGGAAAGAGGGAGGGAGG - Intergenic
997425319 5:133799025-133799047 AGGGGAGGAGAGAGGGAGGAAGG + Intergenic
997516158 5:134491381-134491403 TGGGGGAGAAAAAGGAAGGAAGG - Intergenic
997554847 5:134787025-134787047 AGGAGGCTCAAGAGGGAGGACGG - Intronic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
997653937 5:135541817-135541839 AGGGGGGAAACGAGGCAGGAGGG + Intergenic
997761403 5:136451642-136451664 TGGGGGGAAGAGTGGGAGGGTGG + Intergenic
997898395 5:137740689-137740711 TGGGGGGTCAGGGGGGATGATGG + Intergenic
998167703 5:139853781-139853803 TGGGGGGTTGGGAGGGAGGTGGG + Intronic
998171990 5:139877907-139877929 TGGAGGGTCAAGAGGCAAGAAGG + Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998305278 5:141069939-141069961 TGGAGGCTAAGGTGGGAGGATGG + Intergenic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
999124083 5:149233709-149233731 TGGGTGATAAAGAGGCAGAAAGG + Intronic
999760225 5:154694359-154694381 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
999812809 5:155144005-155144027 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
999872329 5:155765416-155765438 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
999982682 5:156972961-156972983 TGTGGGGAAGAGTGGGAGGAGGG - Intergenic
999985429 5:157000030-157000052 TGGGGGGAGAAGTGGGAGGAGGG - Intergenic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1000686927 5:164262099-164262121 TGGGGACCAAAGAGGGAGGGAGG - Intergenic
1000907427 5:166979312-166979334 GGGGCGGGTAAGAGGGAGGAGGG + Intergenic
1000997523 5:167974101-167974123 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997575 5:167974255-167974277 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997591 5:167974308-167974330 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1001003810 5:168031798-168031820 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1001279208 5:170374295-170374317 TGAGGGGTAGGGAGGGAGAATGG + Intronic
1001312122 5:170618529-170618551 AGGGAGGAAAGGAGGGAGGAGGG + Intronic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002289788 5:178192389-178192411 TGGAGGTTAACGTGGGAGGATGG + Intergenic
1002539025 5:179893912-179893934 AGGGAGGCAAGGAGGGAGGAGGG + Intronic
1002664690 5:180814465-180814487 TGGTGGGTAAAGAGAGAAAAGGG - Intronic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002917660 6:1542026-1542048 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917709 6:1542170-1542192 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1003028920 6:2583639-2583661 TGAGGGGAAGAGTGGGAGGAGGG - Intergenic
1003277107 6:4662272-4662294 TGGGGGCTGAGGTGGGAGGATGG + Intergenic
1003392609 6:5726756-5726778 TGGGGCTTAAAGAGGGCAGAGGG - Intronic
1003523950 6:6882998-6883020 AGGGGGGAAGAGAGGAAGGAAGG + Intergenic
1003673473 6:8181405-8181427 AGGGAGGGAAAGAGGGGGGAGGG - Intergenic
1003739063 6:8914011-8914033 TGGGGGCTATTGAGGGTGGAGGG + Intergenic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1003872218 6:10412460-10412482 AGGGAGGGAAAGAGGGAGGGAGG + Intronic
1004035505 6:11919072-11919094 GGAGGGGTAAAGAGGGATGAGGG + Intergenic
1004141968 6:13026546-13026568 TGGCTTGTAGAGAGGGAGGAAGG + Intronic
1004733287 6:18380108-18380130 TGGAGGGTATAGAGGGTGGCAGG + Intergenic
1004853576 6:19725916-19725938 TGGGGGGAAAAGTGGGAGGGGGG + Intergenic
1005073129 6:21881073-21881095 TGGGGGGAAGAGTGGGAGGAGGG + Intergenic
1005140955 6:22631056-22631078 AGGGGGGTAGGGAGGTAGGAGGG - Intergenic
1005800843 6:29422079-29422101 TGGGGTGTAGAGTGGGAGGGGGG + Intronic
1005850440 6:29816806-29816828 TGGTGGGGAAAGATGCAGGATGG + Intergenic
1005857288 6:29872216-29872238 TGGTGGGGAAAGATGCAGGATGG + Intergenic
1005863048 6:29916066-29916088 TGGTGGGGAAAGATGCAGGATGG + Intergenic
1005926222 6:30447864-30447886 GGGTGGGGAAACAGGGAGGAAGG + Intergenic
1006172852 6:32105076-32105098 TGGGTGGTGAAGTGGGAGCAGGG - Intronic
1006308811 6:33242619-33242641 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1006722569 6:36167115-36167137 TGGGGGGAAGAGCGGGAGGGAGG + Intergenic
1006723221 6:36174159-36174181 TGGGGGGGAAGGAGGGAGGGAGG + Intergenic
1006727705 6:36211591-36211613 TGGAGGGTAAAGAGGGACAAAGG + Intronic
1006771192 6:36554272-36554294 TGGGGGCTGAGGTGGGAGGATGG + Intergenic
1006960226 6:37921957-37921979 TGGAGGCTAAGGTGGGAGGATGG + Intronic
1007169169 6:39850342-39850364 TGGGGGGTAAAGGGGAAGTCAGG - Intronic
1007395497 6:41575541-41575563 TAGGGGGTGTAGGGGGAGGAAGG + Intronic
1007432362 6:41784061-41784083 TGAGGGGGAAAGAAGGAGAAAGG + Intronic
1007492409 6:42233638-42233660 AGGGAGGGAAAGAGGAAGGAAGG - Intronic
1007823429 6:44579318-44579340 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1007872164 6:45052988-45053010 AGGGAGGTAAAAAGGGAGGGAGG + Intronic
1007957418 6:45930137-45930159 TGGGGGGTAGGTGGGGAGGAGGG - Intronic
1008418612 6:51271717-51271739 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1008435085 6:51466615-51466637 CGGAGGGATAAGAGGGAGGAGGG - Intergenic
1008713179 6:54254768-54254790 GGGGGGGAAGGGAGGGAGGAAGG - Intronic
1008899070 6:56590769-56590791 TGGGAGGTCAAGAGGGTGGAGGG - Intronic
1008920716 6:56842821-56842843 TGAGCGGTAGAGAGGGGGGAAGG - Intronic
1009245039 6:61227050-61227072 TGTGGGGTGAAGAGGGGGGAGGG + Intergenic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1010153332 6:72762298-72762320 AGGGAGGTGAAAAGGGAGGAGGG + Intronic
1010331632 6:74629963-74629985 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1010386365 6:75284853-75284875 AGGGAGGGAGAGAGGGAGGAGGG + Exonic
1010484786 6:76397100-76397122 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1011841203 6:91501105-91501127 AGGGAGGAAAAGAGGGAGGGAGG - Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012323861 6:97888910-97888932 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1012872842 6:104692139-104692161 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1013053860 6:106564132-106564154 TGGGGAGAAAAGAGGGAGAGGGG - Intronic
1013133467 6:107257296-107257318 TGGGGGCTGAGGTGGGAGGATGG + Intronic
1013350571 6:109302087-109302109 GGTGGGGTATAGGGGGAGGAAGG + Intergenic
1014021734 6:116598814-116598836 TGGGGGCTAAGGTGGGAGGATGG - Intergenic
1014030193 6:116692876-116692898 TGGGGTGGGAGGAGGGAGGAGGG - Intronic
1014054477 6:116997825-116997847 TGGAGGGGAAAGAGGGAGGTAGG - Intergenic
1014436579 6:121427389-121427411 TGGGAGGAAAAGAGGGAGGTGGG + Intergenic
1014436592 6:121427474-121427496 TGGGAGGGAAAGAGGGAGATGGG + Intergenic
1015028536 6:128567129-128567151 AGGGGGGAAAGGAGGGAGGGAGG - Intergenic
1015479520 6:133692385-133692407 TGGAGGCTAAAGTGGGAGGATGG + Intergenic
1015517821 6:134101839-134101861 TGGGAAGGAAAGAGGGAGGGAGG + Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015631520 6:135236533-135236555 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1015890499 6:137965354-137965376 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1016056026 6:139578596-139578618 TGGGGGGTACAGGGTGGGGAGGG + Intergenic
1016480090 6:144471213-144471235 AGGGTGGGAAGGAGGGAGGAGGG + Intronic
1016534229 6:145092684-145092706 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1016828846 6:148413756-148413778 TAAGGGGAGAAGAGGGAGGAAGG - Intronic
1016995574 6:149960573-149960595 TGGGGGGTCAGGAGGAAGGGAGG - Intergenic
1017041049 6:150308967-150308989 AGGGAGGAAAAGAGGAAGGAAGG + Intergenic
1017041111 6:150309213-150309235 AGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1017334066 6:153234493-153234515 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1018017408 6:159724897-159724919 AGGGGGGAAGAGAGGGAGGGAGG + Intronic
1018088697 6:160327166-160327188 TGGGAGGAAAAGATGGAGGGAGG - Intergenic
1018352537 6:162975825-162975847 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1018577110 6:165270550-165270572 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018844723 6:167547561-167547583 TGAGGAGTAAGGAAGGAGGAGGG - Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019138707 6:169929459-169929481 TGGGGAGTCAACAGTGAGGATGG + Intergenic
1019138735 6:169929613-169929635 TGGGGAGTCAACAGTGAGGATGG + Intergenic
1019138748 6:169929675-169929697 TGGGGAGTCAACAGTGAGGATGG + Intergenic
1019138763 6:169929757-169929779 TGGGGAGTCAACAGTGAGGATGG + Intergenic
1019142629 6:169957746-169957768 AGGGGGGTGAAAAGGAAGGAAGG - Intergenic
1019260233 7:77907-77929 TGGGGAGAGACGAGGGAGGAGGG + Intergenic
1019332956 7:469960-469982 GGGTGGGTGAAGAGGGAGGTGGG - Intergenic
1019356990 7:585594-585616 TGTGGAGAAAGGAGGGAGGAGGG + Intronic
1019578576 7:1749233-1749255 TGGGGGACAAGGAGGGAGGGAGG + Intergenic
1019704230 7:2489958-2489980 GGGGGGTGAAAGGGGGAGGAAGG - Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019928657 7:4209273-4209295 GGGAGGGCAGAGAGGGAGGAGGG + Intronic
1019936836 7:4263070-4263092 TGGGGGGTGATGAGGTAGAAGGG - Intronic
1019968833 7:4523912-4523934 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
1019968843 7:4523944-4523966 AGGGAGGTAAAGAGGAAGGGAGG + Intergenic
1020990004 7:15184533-15184555 AGGGAGGTAAAAAGGAAGGAAGG + Intergenic
1021079087 7:16341932-16341954 TGGGGAGCAAAGAGGGAAGGAGG - Intronic
1021121196 7:16797560-16797582 TGGGGAGGAGAGAAGGAGGATGG + Intronic
1021171128 7:17399097-17399119 GAGGGGCTAAAGTGGGAGGATGG - Intergenic
1021204289 7:17760884-17760906 TGGAGGCTCAAAAGGGAGGAAGG + Intergenic
1021329944 7:19324020-19324042 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1022003510 7:26246961-26246983 TGAGGTGTAGAGAGTGAGGACGG - Intergenic
1022188077 7:27988477-27988499 GGGAGGCTAAAGCGGGAGGATGG - Intronic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022327023 7:29341607-29341629 TGGGAGGGAGAGAGGGAGGGGGG + Intronic
1022529297 7:31057208-31057230 TGCGGGGAGAAGAGGGAGGTAGG - Intronic
1022541789 7:31144413-31144435 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1022633216 7:32105640-32105662 GGGAGGATGAAGAGGGAGGATGG - Intronic
1022661728 7:32374059-32374081 TAGGCAGGAAAGAGGGAGGAGGG + Intergenic
1023159208 7:37281225-37281247 TGGGGGGAAGAGCGGGAGGGGGG + Intronic
1023184969 7:37523779-37523801 GGAGGGGGAAAGAGGAAGGAGGG - Intergenic
1023288554 7:38644734-38644756 TGGGGGGAAGAGTGGGAGGAGGG - Intergenic
1023346676 7:39278106-39278128 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1023569966 7:41561624-41561646 TGGTGGGAAGAGAGAGAGGAAGG + Intergenic
1023700723 7:42889334-42889356 TAAGAGGAAAAGAGGGAGGAGGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024439775 7:49403746-49403768 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1024507031 7:50170423-50170445 AGGGAGGGAAAGAGGGAGGAAGG + Intergenic
1024615672 7:51109502-51109524 TGGGGGGCAAGGAGGGAGATGGG - Intronic
1025190314 7:56891186-56891208 TGGGAGGAAGAGAGGAAGGAAGG - Intergenic
1025681625 7:63685734-63685756 TGGGAGGAAGAGAGGAAGGAAGG + Intergenic
1026112077 7:67466396-67466418 GGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1026178235 7:68016417-68016439 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026589150 7:71680713-71680735 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1026683525 7:72488786-72488808 GGGAGGCTGAAGAGGGAGGATGG - Intergenic
1026857225 7:73762707-73762729 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1026902464 7:74044713-74044735 AGTGGGGGAGAGAGGGAGGAAGG - Intronic
1026928637 7:74210596-74210618 TGGGAGGGAGAGAGGGAGGCGGG - Intronic
1027182458 7:75950405-75950427 TGGGGAGTTAGAAGGGAGGAGGG + Intronic
1027295922 7:76770039-76770061 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1027539705 7:79452833-79452855 TGGGGGCTAAAGGGAGGGGAGGG - Intronic
1027607491 7:80318292-80318314 AGGAGGCTAAAGTGGGAGGAGGG + Intergenic
1027688962 7:81317673-81317695 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1027717909 7:81697015-81697037 TGGGGGGAAGAGTGGGAGGGTGG + Intergenic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1028016445 7:85719636-85719658 TCGGGGGCGAAGTGGGAGGATGG + Intergenic
1028246844 7:88489641-88489663 GGAGGAGGAAAGAGGGAGGAGGG - Intergenic
1028284436 7:88978779-88978801 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1028343576 7:89752857-89752879 TGGAGGGGAAAGAGAGAGGGAGG - Intergenic
1028449323 7:90963182-90963204 TGGGGGCCAAGGTGGGAGGATGG + Intronic
1028743797 7:94305528-94305550 GGGAGGCTAAAGTGGGAGGATGG + Intergenic
1028936387 7:96469023-96469045 TGGAGGGTAACGTGGGTGGAGGG - Intergenic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029200039 7:98833321-98833343 TGGGGAGGATGGAGGGAGGAGGG + Intergenic
1029249082 7:99223305-99223327 AGGGAGGGAAAGAGGAAGGAAGG + Intergenic
1029264686 7:99328844-99328866 AGGAGGCTAAAGTGGGAGGATGG + Intronic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029628868 7:101737809-101737831 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
1029654324 7:101914383-101914405 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1029654332 7:101914403-101914425 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029931926 7:104381539-104381561 AGGGAGGGAAAGAGGAAGGAAGG - Intronic
1030022870 7:105293040-105293062 TGGGAGGCCAAGGGGGAGGAGGG + Intronic
1030076264 7:105739555-105739577 TGGAGTGAAAAGATGGAGGAGGG + Intronic
1030166769 7:106563010-106563032 AGGGAGGAAAAGAGGAAGGAAGG + Intergenic
1030340803 7:108377651-108377673 TGGTGAGTAATGAGAGAGGATGG - Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1031120870 7:117720182-117720204 GGGAGGGTAAAGAGAGAGAAGGG - Intronic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031955029 7:127934288-127934310 TGGAGTATAAAGAGTGAGGAGGG + Intronic
1032081455 7:128860508-128860530 AGGGGGGCAGAGAGTGAGGATGG - Intergenic
1032140251 7:129322694-129322716 GGGAGGGTGAAGTGGGAGGATGG - Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032232066 7:130083361-130083383 CGGAGGGTAAAGAGGTAGAAAGG - Intronic
1032316572 7:130843756-130843778 TGAGGGACAAAGAGGAAGGAGGG - Intergenic
1032370200 7:131341648-131341670 TGGGGTGTGATGGGGGAGGATGG + Intronic
1032400715 7:131622517-131622539 TGGGGGCTGAGGTGGGAGGATGG + Intergenic
1032540124 7:132695883-132695905 TGGGGTGTGGGGAGGGAGGAGGG + Intronic
1032575444 7:133048527-133048549 GGAGGGGTAAAGAGGCAGAAGGG + Intronic
1032675823 7:134129115-134129137 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1032911692 7:136439635-136439657 TGGGGGGTAGAGTGGGGGGAGGG - Intergenic
1033137652 7:138798249-138798271 TGGGAGGGAAAGAAGGAGGAGGG + Intronic
1033573046 7:142652604-142652626 TGGGGGGTGGAGTGGGGGGAGGG + Intergenic
1034062824 7:148108674-148108696 TGGTGGGTACAGAGGCTGGAAGG + Intronic
1034065882 7:148136095-148136117 TGGAGGGAACGGAGGGAGGAAGG + Intronic
1034128628 7:148696769-148696791 TGGGGGGTAAAGATGGAGGAAGG + Intergenic
1034362653 7:150514205-150514227 TGTGGGGTAGAGAGGAAGGTGGG + Intergenic
1034520726 7:151617273-151617295 AGGGAGGGAAAGAGGGAGGGGGG + Intronic
1034605325 7:152307371-152307393 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1034607371 7:152329661-152329683 TGGAGGGGAAGGAGGGAGAAAGG + Intronic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035326500 7:158069496-158069518 TGGGGGGTAAAGAATGGAGAAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035690203 8:1554914-1554936 TAGGGGCAAAAGAGGGAGAAAGG + Intronic
1036089924 8:5654426-5654448 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036109555 8:5882735-5882757 TGGGGGGAAAAGATGGGGGGAGG + Intergenic
1036192211 8:6680675-6680697 TGGGGGGAAAGAAGGAAGGAAGG - Intergenic
1036192260 8:6680821-6680843 TGGGGGGAAAGAAGGAAGGAAGG - Intergenic
1036290125 8:7480395-7480417 GTGGGGGAAAAGAGGGAGGGAGG + Intergenic
1036331351 8:7831127-7831149 GTGGGGGAAAAGAGGGAGGGAGG - Intergenic
1036396209 8:8373552-8373574 TGGGGGCTGAGGTGGGAGGATGG - Intronic
1036447840 8:8838473-8838495 TGTGGGGTATAGGGGGAAGAAGG - Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1037226549 8:16599135-16599157 TGGGGTGTGAAGTGGGAAGAAGG - Intergenic
1037358599 8:18049415-18049437 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1037429341 8:18793172-18793194 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
1037572958 8:20173999-20174021 GGGAGGCTAAAGTGGGAGGATGG - Intronic
1037671177 8:21016557-21016579 AGAGAGGGAAAGAGGGAGGAAGG - Intergenic
1037770816 8:21798373-21798395 AGGGAGGGAAAGAGGGAGGGAGG + Intronic
1037930234 8:22875467-22875489 TGAGGGGGAAGGTGGGAGGAGGG - Intronic
1037990249 8:23316733-23316755 TGGGGAGAAAAGCGGGAGGGAGG - Intronic
1037993285 8:23335804-23335826 TGGGGTGTGAAGACAGAGGAAGG + Intronic
1038012456 8:23486026-23486048 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038232434 8:25714853-25714875 AGGGGAGGAAAGGGGGAGGAAGG - Intergenic
1038296052 8:26291721-26291743 GGGGGGGTAGAGAGGGCGGATGG - Intronic
1038314630 8:26473588-26473610 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1038319636 8:26514693-26514715 TTGGGGGTGGAGACGGAGGACGG + Intronic
1039260520 8:35766326-35766348 AGGGAGAGAAAGAGGGAGGAAGG - Intronic
1039352970 8:36782361-36782383 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1039534452 8:38295455-38295477 TGGGGGCTGAGGTGGGAGGATGG + Intronic
1039555258 8:38470531-38470553 TGGAGGCTGAAGAAGGAGGATGG + Intergenic
1039635982 8:39166193-39166215 TGGGGGGAAGAGTGGGAGGTGGG - Intronic
1040090234 8:43391216-43391238 TGGGGTGTGGGGAGGGAGGAGGG - Intergenic
1040672256 8:49705799-49705821 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1041135892 8:54758471-54758493 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041203448 8:55473874-55473896 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1041364380 8:57085476-57085498 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1041444184 8:57931899-57931921 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041444236 8:57932079-57932101 GGGGGGGCAGGGAGGGAGGAAGG + Intergenic
1041638280 8:60168243-60168265 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1041769155 8:61454316-61454338 AGGGGGGAAAGGAGAGAGGAGGG - Intronic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1042463054 8:69093290-69093312 GGGGTGGGAAAGATGGAGGAGGG + Intergenic
1042589893 8:70387695-70387717 TGGGGGATAGAGGGGGAGGGCGG + Intronic
1042615811 8:70647757-70647779 TGGAGGGTGAAGTGGAAGGAAGG + Intronic
1042715294 8:71765722-71765744 TGGGAGCAAGAGAGGGAGGAAGG + Intergenic
1043058110 8:75466493-75466515 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1043209586 8:77494206-77494228 AGAGAGGGAAAGAGGGAGGAAGG - Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1043888561 8:85631063-85631085 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1043963491 8:86445333-86445355 TGGGAGGGAGAGAGGGAGGAAGG - Intronic
1044266575 8:90188888-90188910 GGGGGGCTGAAGCGGGAGGATGG + Intergenic
1044372814 8:91433259-91433281 GGGTGGCAAAAGAGGGAGGAGGG + Intergenic
1044480809 8:92685735-92685757 TGGGGTGAAAAGGGGGAGGCAGG - Intergenic
1044665327 8:94628787-94628809 CGGGGGCTAACGTGGGAGGATGG - Intergenic
1044781048 8:95743802-95743824 GGGAGGCTAAAGTGGGAGGACGG + Intergenic
1045062935 8:98424412-98424434 GGGGAGGGAGAGAGGGAGGAAGG + Intronic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045233071 8:100324556-100324578 ATGGGGGTAAAGTGGGAGTAGGG - Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045544713 8:103118223-103118245 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045671549 8:104559449-104559471 TCGGGGGAAAAGAGTGAGGAGGG + Intronic
1045780410 8:105856011-105856033 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1045783166 8:105891625-105891647 TGGAGGCTAAAGTGGGACGATGG + Intergenic
1045842424 8:106595613-106595635 TGGGGGGAAAATAGGAAGAAAGG + Intronic
1045881444 8:107045599-107045621 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1045891076 8:107158401-107158423 GGGAGGGTAAAGGGAGAGGAAGG - Intergenic
1046157217 8:110308419-110308441 GGGGAGGCAAAGAGGGAGGATGG + Intergenic
1046437587 8:114212248-114212270 AGGGAGGGAAAGAGGGAGAAAGG + Intergenic
1046518877 8:115299343-115299365 TGGGAGGTAGAGAGAAAGGAAGG - Intergenic
1046527504 8:115399070-115399092 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047219674 8:122909591-122909613 TGGGGGGGAGAGGAGGAGGAGGG - Intronic
1047240787 8:123086190-123086212 GGTGTGGTAAGGAGGGAGGAGGG - Intronic
1047487250 8:125342633-125342655 AGGGAGGGAAAGAGGGAGGGAGG - Intronic
1047782626 8:128122644-128122666 AGGGAGGGAAAGAGGGAGGGAGG - Intergenic
1047879012 8:129171827-129171849 AGGGAGGGAAAGAGGGAGGAAGG - Intergenic
1047928122 8:129701019-129701041 TCGGGGGCAAAGAGGGAGAAGGG - Intergenic
1047940626 8:129824834-129824856 TGGGTGGGACAGTGGGAGGAAGG - Intergenic
1048060359 8:130913320-130913342 TGGGGGGTTAGGAGGGAGGTGGG - Intronic
1048165596 8:132059029-132059051 AGAGAGGGAAAGAGGGAGGAAGG - Intronic
1048526132 8:135204695-135204717 TGGAAGGTAAAGAGGAAGCAAGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049055521 8:140233603-140233625 TGGTGGGGAGAGAGGGAGGGAGG - Intronic
1049231716 8:141488246-141488268 TGGGGGAACAAGAGGGAGCAGGG - Intergenic
1049311794 8:141937418-141937440 AGGGAAGGAAAGAGGGAGGAGGG - Intergenic
1049938049 9:518374-518396 TGGGGGTCAAGGAGGGAGAAGGG - Intronic
1050096249 9:2069928-2069950 TGGGGGGGAAGGAGGGAGTGGGG - Intronic
1050273403 9:3970951-3970973 TGGAAGGAAAAGAGGGAGAAAGG + Intronic
1050517003 9:6455279-6455301 TGGGGTGGAGAGAGGGGGGAGGG - Intronic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1050753349 9:8967894-8967916 TGGGGTGGAGGGAGGGAGGAGGG - Intronic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1051128205 9:13829414-13829436 TGTGGGGAAAAGGGGGAGGAGGG + Intergenic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1051216408 9:14802974-14802996 AGGGAGGGAAAGAGGAAGGAAGG - Intronic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051711643 9:19936376-19936398 TGGAGGCTGAAGAAGGAGGATGG - Intergenic
1052346225 9:27412541-27412563 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1052417218 9:28191548-28191570 AAGGGGGTTAAGAGGGAGGGAGG - Intronic
1052529414 9:29661433-29661455 TGTGAGGAAAAGTGGGAGGAGGG - Intergenic
1052540230 9:29802242-29802264 AGGGGGGAAAAAAAGGAGGAGGG - Intergenic
1052617270 9:30857016-30857038 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1052903767 9:33817125-33817147 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
1053535324 9:38919966-38919988 TGGTGGGGAAATAGGAAGGAAGG + Intergenic
1053540619 9:38970082-38970104 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1053610505 9:39708629-39708651 TGGGGGGAAAAGTGGGAGGGGGG + Intergenic
1053868544 9:42466654-42466676 TGGGGGGAAAAGTGGGAGGGGGG + Intergenic
1054243018 9:62633766-62633788 TGGGGGGAAAAGTGGGAGGGGGG - Intergenic
1054557142 9:66668284-66668306 TGGGGGGAAAAGTGGGAGGGGGG - Intergenic
1054625520 9:67393824-67393846 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1054630807 9:67443984-67444006 TGGTGGGGAAATAGGAAGGAAGG - Intergenic
1054868866 9:70030842-70030864 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1054981249 9:71209366-71209388 TGGGGGGAGAAGAGGGGGTAGGG + Intronic
1055028932 9:71752481-71752503 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
1055555907 9:77473350-77473372 GGGAGGCTAAAGTGGGAGGATGG + Intronic
1055569840 9:77605446-77605468 GGGGGAGAAAAGTGGGAGGAAGG - Intronic
1055675392 9:78653926-78653948 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1055904523 9:81277322-81277344 TGGGGGATGAAGAGGTAGCATGG - Intergenic
1055905130 9:81284861-81284883 TGGGGGGAAGAGTGGGAGGGGGG - Intergenic
1056065859 9:82933895-82933917 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1056069295 9:82969274-82969296 TGGTGGGTACAGAGGGACGTGGG - Intergenic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056408121 9:86296432-86296454 TGGGGGATAGAGGGGGAGGGAGG + Intronic
1056803211 9:89708434-89708456 TGGAGGGTAAAGAAGGAGGTGGG - Intergenic
1056883387 9:90417780-90417802 TGGGGGGTATGGAGAGAGAATGG - Intergenic
1057144502 9:92749056-92749078 TGGCAGGTAGACAGGGAGGAGGG + Intronic
1057211609 9:93203729-93203751 TGGGTGTGGAAGAGGGAGGAAGG + Intronic
1057226742 9:93296706-93296728 GGGAGGATAGAGAGGGAGGAAGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057417769 9:94880469-94880491 TGGGGGCTGAGGTGGGAGGATGG - Intronic
1057519769 9:95751741-95751763 CGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1057550512 9:96048423-96048445 TGGGGGGGAGAGGGGAAGGAGGG + Intergenic
1057565023 9:96159966-96159988 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1057572285 9:96213893-96213915 TGGGGGGAGAAGGGGGAGAATGG - Intergenic
1057950960 9:99368748-99368770 TGGGAGGAAAGGAGGAAGGAAGG + Intergenic
1058084492 9:100733946-100733968 TGTGGGGAAGAGTGGGAGGAGGG - Intergenic
1058107419 9:100988549-100988571 TAGAGAGTAAAGAGAGAGGAGGG + Intergenic
1058121126 9:101140135-101140157 TGGGGAGTAGAGAGGGATGTAGG - Intronic
1058612145 9:106788856-106788878 TGAGGGATAATGAGGGAGGTTGG - Intergenic
1058622690 9:106899988-106900010 TGGGGGGAAGAGTGGGAGGGGGG - Intronic
1058663637 9:107289075-107289097 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1059668453 9:116471591-116471613 TGGGCAGTAAAGGGGGTGGAGGG + Intronic
1059700992 9:116775496-116775518 AGGGAGGAAAAGAGGAAGGAAGG + Intronic
1059803537 9:117774335-117774357 GGGAGGCTAAAGTGGGAGGATGG - Intergenic
1059876916 9:118645350-118645372 TGGGAGGGGAAGAGGGAGAAAGG - Intergenic
1059903471 9:118954766-118954788 TGGGGGGAAGTGATGGAGGATGG + Intergenic
1060045805 9:120339178-120339200 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1060090779 9:120740915-120740937 GGGAGGCTAAAGCGGGAGGATGG + Intergenic
1060479754 9:124011385-124011407 TGGGGGGGAGGCAGGGAGGAGGG - Intronic
1060643234 9:125256737-125256759 TGGAGGCTGAAGTGGGAGGATGG + Intergenic
1060720936 9:125976874-125976896 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1060754679 9:126204122-126204144 TGTGGGGACAAGAGGAAGGAAGG - Intergenic
1060935938 9:127516031-127516053 GGGGGGTTGAAGTGGGAGGATGG + Intronic
1061021095 9:128015363-128015385 TGGAGGCTGAAGTGGGAGGATGG - Intergenic
1061030280 9:128077641-128077663 TGGCGGGTAGAGAGATAGGAAGG + Intronic
1061060270 9:128246743-128246765 AGGGAGGAAAGGAGGGAGGATGG - Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061440524 9:130600116-130600138 AGAGGGGGAAAGAGGGAGGGAGG - Intronic
1061525123 9:131154372-131154394 TGGGGGGAAAGGAGAGAGGGCGG - Intronic
1061789004 9:133048780-133048802 TGGGGTAAAATGAGGGAGGAGGG + Intronic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062245939 9:135566086-135566108 TGGGGGCTATAGGAGGAGGAAGG + Intronic
1062255864 9:135620201-135620223 TAGGGGGAAAAGGGGGAGAAGGG - Intergenic
1062328238 9:136023039-136023061 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1062517948 9:136945467-136945489 TGGGGGGGGTAGAGGGAGGCAGG + Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1062588643 9:137263273-137263295 TGGGAGGGAAGGAGGGAGGGAGG - Intronic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1062744458 9:138202564-138202586 TGGGGAGAGACGAGGGAGGAGGG - Intergenic
1203365134 Un_KI270442v1:249516-249538 AGGGAGGGAAAGAGGGAGAAAGG + Intergenic
1203608540 Un_KI270748v1:76003-76025 AGGGGGGTGGAGAGGGAGAAAGG + Intergenic
1185660206 X:1721811-1721833 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1185700656 X:2228083-2228105 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1185734253 X:2485471-2485493 AGGGAGGAAAAGAGGGAGGGAGG + Intronic
1185751106 X:2609871-2609893 TGGAGGGGAAAGAAGGAGGAAGG + Intergenic
1185777559 X:2817092-2817114 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1185808008 X:3078419-3078441 TGGAGGCCAAAGAGGGAAGATGG - Intronic
1185814500 X:3142416-3142438 TGGGGGAGGAAGAGGAAGGAGGG + Intergenic
1185918131 X:4058871-4058893 TGGGAGGAAGAGAGGGAGGGAGG + Intergenic
1185933296 X:4227477-4227499 TGGGGGGAAGAGAGGGAGGGGGG + Intergenic
1185989791 X:4881053-4881075 TGGGGGCTGAGGTGGGAGGATGG - Intergenic
1186020100 X:5245333-5245355 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1186061917 X:5718180-5718202 CGAGGGGGGAAGAGGGAGGAGGG + Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186479802 X:9888039-9888061 TGACGAGTCAAGAGGGAGGAGGG - Intronic
1186490018 X:9964217-9964239 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1186509230 X:10117743-10117765 TGTGGGGTCCAGAGTGAGGATGG + Intronic
1186673668 X:11793482-11793504 TTGGGGGACAAGAGGGAGGCAGG - Intergenic
1186838443 X:13460948-13460970 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1186925546 X:14329806-14329828 TGAAAGGGAAAGAGGGAGGAGGG - Intergenic
1187049113 X:15678643-15678665 TTGGGGGTGAAGAAGGAGGGAGG + Intergenic
1187223941 X:17357811-17357833 TGGGGGGTTGAGGGGGAGGTGGG - Intergenic
1187430549 X:19220271-19220293 TGGGGGGAAGAGTGGGAGGTGGG - Intergenic
1187521917 X:20021501-20021523 TGGGAGGTGAGGAGTGAGGAAGG - Intronic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1187635465 X:21223098-21223120 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1187708998 X:22035296-22035318 TGGGGAGGAAAGAGAGGGGAAGG - Intronic
1188277286 X:28215998-28216020 AGGGAGGGAAAGAGGGAGGAAGG - Intergenic
1188277295 X:28216025-28216047 GGGGGGGGAAGGAGGGAGGGGGG - Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188433135 X:30129561-30129583 TGGGGGGAAGAGGGGGAAGAGGG + Intergenic
1188489659 X:30723816-30723838 GGGAGGGTGAGGAGGGAGGATGG - Intronic
1188550402 X:31358112-31358134 TGAGGGGGAATGAGGGAAGAGGG - Intronic
1188563606 X:31499198-31499220 TGGGGAGTAGGGAGAGAGGAAGG + Intronic
1188605482 X:32023923-32023945 TGGGGACTACAGAGGAAGGAGGG + Intronic
1188699190 X:33237180-33237202 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1188742595 X:33804594-33804616 TGGGGGGTTGAGGGGGAGGTGGG - Intergenic
1188833198 X:34926535-34926557 TTTGGTGTAAAGAGTGAGGAAGG + Intergenic
1189017805 X:37302442-37302464 TGGGAGGCAAGGAGGAAGGAAGG + Intergenic
1189456685 X:41197283-41197305 AGGGAGGTAAAGAGGGAGAGAGG - Intronic
1189946414 X:46184589-46184611 TGGGAGGCACAGAGGGATGAAGG + Intergenic
1190010252 X:46778519-46778541 TGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190101587 X:47526370-47526392 GGGGGGGGAGAGAGGGAGGGAGG - Intergenic
1190953136 X:55165515-55165537 AGGGAGGGAAAGAGGAAGGAAGG - Intronic
1190958439 X:55220630-55220652 TGGGCTGGAACGAGGGAGGAAGG + Exonic
1190981401 X:55459374-55459396 TGGTGGGGAAAGAGGGAGTCAGG + Intergenic
1190987297 X:55513806-55513828 TGGTGGGGAAAGAGGGAGTCAGG - Intergenic
1191822097 X:65321890-65321912 AGGGGTGTAGGGAGGGAGGAAGG + Intergenic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192082287 X:68060072-68060094 TGGGTAATGAAGAGGGAGGAGGG - Intronic
1192213973 X:69145079-69145101 TGGGGGGTGAGGAGGAGGGAGGG + Intergenic
1192430345 X:71107477-71107499 AGGGAGGGAAAGAGGGAGGGAGG + Exonic
1192433514 X:71128124-71128146 TGGGGTGTACTGAGTGAGGAAGG + Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1193253039 X:79315638-79315660 TGGGGGGTAGAGTGGGAGGGGGG - Intergenic
1194129450 X:90062540-90062562 TGGGGGGAAGGGAGGGAGGGAGG + Intergenic
1194293873 X:92105243-92105265 TGAGGGATAATGAGGGAGGTTGG + Intronic
1194430637 X:93799754-93799776 AGAGGGGTAAAGAGAAAGGAGGG - Intergenic
1194433060 X:93835854-93835876 TGAGGGGTGAAGAGACAGGAAGG - Intergenic
1194673483 X:96765300-96765322 TGGAGGCTAAGGTGGGAGGATGG - Intronic
1194775949 X:97964750-97964772 TGCGGAGCAAAGAAGGAGGAGGG - Intergenic
1194865125 X:99055513-99055535 TGGGGGGTGGATGGGGAGGAAGG + Intergenic
1194893102 X:99405123-99405145 TGGAGGGTTGAGAGGGTGGAAGG - Intergenic
1195105073 X:101595790-101595812 TGGGGGGAAGAGAGAGAGGCAGG + Intergenic
1195160224 X:102163534-102163556 TGGGAGGAAGAGAGAGAGGAGGG + Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195505844 X:105656094-105656116 TGGGGGGTTGGGAGGGAGGTAGG - Intronic
1195506989 X:105669019-105669041 GTGGGGTTAAAGAGGGTGGAAGG + Intronic
1195541960 X:106072428-106072450 TGAGGGGTAAGGTGGGAGGAAGG + Intergenic
1195575743 X:106448701-106448723 TGGGGATTAAAGTGTGAGGAGGG + Intergenic
1195675313 X:107503222-107503244 TGGGGGTTAAACAGAGAGGCAGG - Intergenic
1195913568 X:109913829-109913851 TGGGGTGTGAAGAGGGGGGAGGG + Intergenic
1196124342 X:112082967-112082989 CGAGAGGGAAAGAGGGAGGACGG + Intergenic
1196390488 X:115202949-115202971 TGGGAGGAAAAGAGGGAATAAGG + Intronic
1196423611 X:115547246-115547268 AGGGAGGGAAAGAGGGATGAAGG + Intergenic
1196675194 X:118412841-118412863 TGGGAGGAAGAGTGGGAGGAGGG - Intronic
1196738090 X:118998453-118998475 TGGGGGGAAAAGTGGGAAGGGGG + Intronic
1196941301 X:120778690-120778712 TGGGGGGAACAGGGGGAGGGAGG + Intergenic
1197070328 X:122289007-122289029 TGGGGGGAAGAGTGGGAGGGGGG + Intergenic
1197462456 X:126759164-126759186 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197780388 X:130153398-130153420 TGGAGGGTAAAGTGGGAGGGAGG + Intronic
1198051392 X:132956341-132956363 TAGGGGGGAAAGCGGGGGGAGGG + Intronic
1198327179 X:135585398-135585420 AGTGGGGGAAGGAGGGAGGATGG + Intergenic
1198421400 X:136473184-136473206 AGGGAGGAAAAGAGGAAGGAAGG + Intergenic
1198436434 X:136621342-136621364 TGGTGGGTAGAGGGGGAGGTGGG - Intergenic
1198519935 X:137442327-137442349 TGGAGGGGACAGAGGGAGGCAGG - Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1198809959 X:140525076-140525098 TGGGGGGATAGGATGGAGGATGG - Intergenic
1199008073 X:142725755-142725777 TGGGGGGAAGAGTGGGAGGAGGG + Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199617659 X:149670699-149670721 TGGTGGGGAGAGAGGAAGGAGGG - Intergenic
1199624984 X:149732550-149732572 TGGTGGGGAGAGAGGAAGGAGGG + Intergenic
1199737062 X:150694130-150694152 TGGGGGGTTGGGAGTGAGGACGG + Intronic
1199868054 X:151872084-151872106 TTGAGGGTGAAGAGGTAGGAAGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1199992048 X:152992974-152992996 TGGGAGGTGAGGAGGGAGGTAGG + Intronic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200078507 X:153564114-153564136 TGGGGGCTAGAGAGGGTGGGAGG - Intronic
1200090516 X:153633796-153633818 TGTGGGGCCAACAGGGAGGAGGG + Intergenic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200401713 X:156023881-156023903 TGGGGGCTAGAGAGGAAGCAGGG + Intergenic
1200817464 Y:7548377-7548399 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1201146181 Y:11066744-11066766 TGAGAGGGAAGGAGGGAGGAGGG + Intergenic
1201234159 Y:11893990-11894012 GGGGAGGTAAAAGGGGAGGATGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201512222 Y:14777626-14777648 TGAGGGGGGAAGAGGGAGGGAGG + Intronic
1202013969 Y:20380564-20380586 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1202019469 Y:20449798-20449820 TGGAGGGGAAAGAGGGAGACTGG - Intergenic
1202035464 Y:20629145-20629167 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1202134316 Y:21646138-21646160 TGGAGGCTAAGGAGGGAGAATGG - Intergenic