ID: 1011686794

View in Genome Browser
Species Human (GRCh38)
Location 6:89830024-89830046
Sequence CTGGGAAACCAGAGAGTCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011686784_1011686794 1 Left 1011686784 6:89830000-89830022 CCCCCGAGTGGAGGTCGGCTGCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1011686787_1011686794 -2 Left 1011686787 6:89830003-89830025 CCGAGTGGAGGTCGGCTGCCCCT 0: 1
1: 0
2: 0
3: 14
4: 77
Right 1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1011686785_1011686794 0 Left 1011686785 6:89830001-89830023 CCCCGAGTGGAGGTCGGCTGCCC 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 172
1011686786_1011686794 -1 Left 1011686786 6:89830002-89830024 CCCGAGTGGAGGTCGGCTGCCCC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011686794 Original CRISPR CTGGGAAACCAGAGAGTCGG AGG Exonic
900309887 1:2028601-2028623 ATGGGAAACCAGAGGGTGTGGGG + Intronic
901461436 1:9394225-9394247 TTTGGAGGCCAGAGAGTCGGTGG - Intergenic
902465336 1:16613792-16613814 CGGGGAAACCAGCGATTTGGAGG - Intergenic
902571328 1:17348810-17348832 CTGGGAAAGCAGGGAGAGGGAGG - Intronic
903513430 1:23893646-23893668 CTGGGACAAGAGAGAGTAGGTGG - Intronic
903950024 1:26991348-26991370 ATGGGAACTCAGAGAGTTGGAGG - Intergenic
904565134 1:31424324-31424346 TTGGGAAAACAGAGATTCTGTGG - Intronic
906195418 1:43927607-43927629 CAGGGAAAACAGAGACTTGGAGG - Intronic
907786466 1:57617723-57617745 ATGGGAAAACAGAGAATCAGAGG + Intronic
910245324 1:85132662-85132684 CTGGGAAAGGAGGGAGTGGGGGG - Intronic
911397698 1:97333137-97333159 CTTGAAAACCAGGGAGGCGGAGG - Intronic
918013119 1:180605888-180605910 CTGGGAAATCAGAGATGCAGAGG - Intergenic
920211049 1:204328478-204328500 CAGGGAAACCCGAGAGGCAGAGG - Intronic
921121639 1:212142551-212142573 TTGGGAAACCAAAAAGTCAGGGG + Intergenic
921157832 1:212452156-212452178 CTGGGAAACCTGAGACTCTGAGG - Intergenic
921939782 1:220827739-220827761 CCAGGAAACCAGAGACTAGGGGG + Intergenic
924934904 1:248759360-248759382 ATGGGAAACCCAAGACTCGGGGG - Intergenic
1064908110 10:20370043-20370065 GAGAGAAACCAGAGAGTGGGTGG + Intergenic
1066193667 10:33078487-33078509 ATAGAAAACCAGAGTGTCGGGGG - Intergenic
1068724720 10:60288492-60288514 CTGGGAAAACAGCCAGTAGGAGG + Intronic
1070266565 10:74908713-74908735 CTGGAAAAGCAGAGAATCAGGGG - Intronic
1070825069 10:79386123-79386145 CAGGGAAAGCAGGGAGTCTGGGG - Exonic
1071501320 10:86206287-86206309 CTGGGAGACCTGAGAGTGGGTGG - Intronic
1073793894 10:106967159-106967181 TTGCCAAACCAGAGAGTCTGAGG + Intronic
1075719698 10:124577477-124577499 CTGGGGAACCTGAAAGCCGGAGG - Intronic
1076048492 10:127313711-127313733 AAGGGAAACCAGGGAGGCGGGGG - Intronic
1076132926 10:128026185-128026207 CTGGCCAACCAGAGAGGCGCTGG - Intronic
1083016110 11:59455932-59455954 CTGAGAAATCAGAGAGTCTGGGG - Intergenic
1083247590 11:61441435-61441457 CTCTTAAACCAGGGAGTCGGAGG + Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085681258 11:78577265-78577287 CTGGGGAACAAGACAGTCTGGGG + Intergenic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1089032212 11:115344194-115344216 GTGGGAAACCAGAGAGGGCGGGG - Intronic
1092738632 12:11607726-11607748 CTGGGAAACCAGAAAATCTGTGG + Intergenic
1094212672 12:27909023-27909045 CTGGCAAGCAAGAGAGTCAGTGG + Intergenic
1096495596 12:52037549-52037571 CTTGGAAACTGGGGAGTCGGGGG + Intronic
1096503297 12:52078559-52078581 CTGGGGCATCAGAGAGTTGGAGG + Intergenic
1096914163 12:55013758-55013780 CTGGGAAAGCAGCCAGTAGGGGG + Intergenic
1097370349 12:58771199-58771221 CTTGAAAACCAGATAGTCGTAGG - Intronic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1101033366 12:100681320-100681342 CAAGGAAACCAGTGAGTCTGGGG - Intergenic
1101212572 12:102549275-102549297 CTAGGAAACGAGTGAGACGGTGG + Intergenic
1101858485 12:108463621-108463643 CTGGGAAGGCAGAGAGGAGGTGG - Intergenic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1107832833 13:44389708-44389730 TTTGTAAACCAGAGAGTCAGTGG + Intronic
1110579249 13:77099698-77099720 CTTGGAAACCACAGAAACGGTGG + Intronic
1112720960 13:102244364-102244386 CTAGGAAACCAGAGAGGATGTGG - Intronic
1114657831 14:24326543-24326565 CTGGGAGTCTAGAGAGTCAGGGG - Intronic
1116121054 14:40722815-40722837 CAGGGAAACCAGTGAGACAGGGG + Intergenic
1118198519 14:63650499-63650521 CTTTGAAACCAGAGGGTGGGTGG + Intergenic
1119410154 14:74425585-74425607 CTGGGGTACCAGGGAGTCTGAGG + Intronic
1121283116 14:92713679-92713701 CTGGGAAACCAGGGATTGGAAGG + Intronic
1122353251 14:101109530-101109552 CTGGAAAACCAGAGATTCGCAGG + Intergenic
1122768788 14:104087880-104087902 GTGGGAAACAAGAGACTTGGAGG + Intronic
1122931007 14:104933113-104933135 CTCGGAAATCAGAGAGCAGGCGG - Exonic
1126981460 15:54248861-54248883 CTGGGAAAACACAGAGTGAGAGG + Intronic
1127064270 15:55221114-55221136 CTGTGAAACCAGACAGGCTGTGG + Intronic
1127868359 15:63049190-63049212 CCGGGAAACCACAGGGTCGACGG - Intronic
1130093183 15:80838074-80838096 CTGGACAAGCAGAGAGTCTGGGG - Intronic
1131075717 15:89493783-89493805 CTGGGAAACCAGGGAGCGAGAGG - Intronic
1131654412 15:94440764-94440786 CAGGGCAATCAGAGAGTGGGTGG + Intronic
1133311250 16:4847952-4847974 CGGGGACACCAGGGGGTCGGGGG - Intronic
1135227347 16:20673198-20673220 CTGAGAAACAAGAGAGACTGAGG - Intronic
1137056182 16:35747686-35747708 ATGGGGAGCCAGAGAGTCAGGGG - Intergenic
1138979871 16:62254614-62254636 CTGGGAAGCCAGGGTGTCTGAGG + Intergenic
1139751928 16:69114188-69114210 CTGGGAAACCTGAGGCTCAGAGG - Intronic
1141069012 16:80936497-80936519 CTGGGAACCCAGATTGTCAGAGG - Intergenic
1142046724 16:87930278-87930300 GTGGGAAAGCAGAGGGCCGGGGG + Intronic
1143032768 17:3976934-3976956 CCGGGAACCCAGAGAGGTGGAGG + Intergenic
1144182297 17:12763485-12763507 CTGGGAAACCATGGAGTGGCTGG + Exonic
1144268344 17:13593454-13593476 TTCGGAAACAAGAGAGTAGGAGG + Intronic
1144581655 17:16462656-16462678 CTGGAAAACCAGAGAGACAAAGG - Intronic
1145079042 17:19879478-19879500 CTGGGAAGCCATAGATTCAGGGG + Intergenic
1145101650 17:20082068-20082090 CTGGAAAACAAGAGTGGCGGTGG - Intronic
1146256336 17:31393053-31393075 CTGCGTCACCAGAGAGTGGGAGG + Intronic
1147927790 17:43955917-43955939 CAAGGATACCAGAGAGTAGGGGG + Intronic
1148335398 17:46837615-46837637 ATGTGAACCCAGAGAGTCTGGGG + Intronic
1149330544 17:55576867-55576889 CTGGGAGCACAGAGAGTAGGAGG + Intergenic
1150721512 17:67617938-67617960 CTGGGAGACATGAGATTCGGGGG + Intronic
1152570995 17:81121218-81121240 CAGGGAGTCCAGGGAGTCGGGGG + Exonic
1153942634 18:9990999-9991021 CTGGGAAGCCAGGGACTAGGCGG - Intergenic
1155065163 18:22263231-22263253 CTAGGAACCCAGAGAATTGGTGG - Intergenic
1155928659 18:31684608-31684630 ATGGGAGGCCAGAGAGTCGGGGG + Exonic
1157051937 18:44176365-44176387 CTGGGCACCCAGAGTGTGGGTGG - Intergenic
1158865491 18:61634472-61634494 CTGGGAAGCCAGAAAGTCTTGGG - Intergenic
1160757207 19:764074-764096 CTGGGAAACCATCCAGTCTGAGG + Exonic
1161963530 19:7535486-7535508 CTGGGAAATCAAGGAGTCGAAGG - Intronic
1165091956 19:33392360-33392382 CTGGGATTCCACAGAGTCCGGGG - Intronic
1166636132 19:44453095-44453117 GGGGGAAACCAGAGAGTCTCTGG + Intergenic
1167357129 19:49010954-49010976 CAGGGAAGCCAGAGAGGAGGCGG - Intronic
927928703 2:27030386-27030408 CTGGGAGACCAGTGAGAGGGTGG - Intergenic
928518153 2:32063447-32063469 GTGGGAAAGCCGAGAGGCGGGGG + Intergenic
929808626 2:45169792-45169814 GTGGGAAAGCAGAGAGAAGGAGG - Intergenic
930676631 2:54208267-54208289 CTGAGAAATCAGAGAGACAGAGG - Intronic
931150190 2:59564655-59564677 GTGGGAAATCAGAGAGTGGGAGG + Intergenic
931689090 2:64820001-64820023 CTCGGAAGCCAGAGAGTGAGTGG + Intergenic
934763999 2:96870232-96870254 CCGGGCACCCAGAGAGGCGGAGG - Intronic
934896509 2:98124424-98124446 CTGGGAGGCCAGAAAGTCGGTGG + Intronic
935006121 2:99079098-99079120 ATGGGAAAAGAGAGAGTGGGTGG + Intronic
935763246 2:106341062-106341084 CTGGGAAAACTGAGAGCCAGAGG + Intergenic
937764907 2:125649632-125649654 CAAGGAAACCATAGAGTTGGAGG + Intergenic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
945020207 2:205563426-205563448 CTTGGAAACCAGAGAGTCCTGGG - Intronic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
947527194 2:230885981-230886003 CTTGGAAACCAGAGCCTGGGCGG + Intergenic
947706698 2:232282099-232282121 CTGGAAAGACAGAGAGTAGGAGG - Intronic
948927986 2:241111643-241111665 CTGGGGAGCCTGTGAGTCGGGGG - Intronic
1169309150 20:4520382-4520404 CTGGGAAACCAGGGATTCTGTGG + Intergenic
1169949889 20:11032224-11032246 CTGGGAAACCAGTGGGATGGTGG + Intergenic
1172759108 20:37309487-37309509 CTGGGAAGACAGACAGCCGGTGG + Intronic
1173338391 20:42131952-42131974 CTGGGAAAACAGAGTGTGAGGGG + Intronic
1174090201 20:48040542-48040564 CTGGGAAATCAGAGAGGAGACGG + Intergenic
1175291627 20:57879731-57879753 TTGGGACCCCAGAGAGTGGGAGG + Intergenic
1178150317 21:29786655-29786677 CTGTGAAACCAGAAAGTCTTGGG + Intronic
1178221194 21:30662048-30662070 ATGGGAAACCAGAGAGCAAGGGG - Intergenic
1180057189 21:45365068-45365090 CTGGGACCCCAGAGAGTAGGAGG - Intergenic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1183061693 22:35340186-35340208 CTGGGAGTCCAGGGAGTCCGGGG + Intronic
1183315245 22:37133495-37133517 CTGGGAAGGCAGTGAGTCAGGGG - Intronic
1183538815 22:38417952-38417974 ATGGGAAATCAGAGAGTAAGGGG + Intergenic
1184473957 22:44710789-44710811 CTGAGAAGCCACAGAGTAGGTGG + Intronic
1184864307 22:47193871-47193893 ATTGGAAACTAGAGAGTAGGAGG + Intergenic
1184989244 22:48156052-48156074 CTGGGAATCCAGAGAGACCTGGG + Intergenic
950437083 3:12986583-12986605 CTGGTGAACCCGAGAGTGGGAGG + Intronic
952946805 3:38483259-38483281 CAGGGAAACGAGACAGTCCGAGG - Exonic
953971000 3:47346712-47346734 CTGGGAAACCATAAATTGGGAGG - Exonic
959351781 3:105274483-105274505 CCTGGAAACCAGAGAGTGTGAGG - Intergenic
959721180 3:109491153-109491175 CTAGAAAGCCAGAGAGTCAGTGG + Intergenic
962589374 3:136873189-136873211 CTGCAAAACCACAGAGTCAGAGG + Intronic
966377062 3:179307138-179307160 TTGGGAAACCAGAGAATCGAAGG - Intergenic
969246013 4:5933469-5933491 CTGGGAAAGCCCAGAGTCAGGGG - Intronic
969428384 4:7138968-7138990 TTGGGAAACCAGAGGCTCAGAGG - Intergenic
969618469 4:8267205-8267227 CTGGGAAGCCAGAGACTTAGAGG + Intergenic
970978034 4:22063881-22063903 CTTGGAAAGCAGAGAATCTGGGG + Intergenic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
976557815 4:86469007-86469029 CTGGGAAAGCAAAGACTCAGAGG + Intronic
982132400 4:152242326-152242348 CTGAGAAACAAGGGGGTCGGGGG + Intergenic
982301252 4:153881375-153881397 CTGTGAAAGCAGAGAATAGGTGG + Intergenic
982413148 4:155102076-155102098 CTGGGGAAATAGAGAGTCTGAGG + Intergenic
982803583 4:159735160-159735182 CTGTGAACCCAGAAAATCGGAGG + Intergenic
985109380 4:186533605-186533627 CTGGGAAAGCAGAGTGGTGGAGG - Intronic
985708543 5:1415261-1415283 CTGAGAAACCAGAGAGCTGGAGG + Intronic
986627630 5:9737514-9737536 AGGGGAAGACAGAGAGTCGGTGG - Intergenic
987383275 5:17306265-17306287 CTGGCAAACCCGGGAGGCGGGGG + Intergenic
988681708 5:33489963-33489985 TTGGGAACACAGAGAGTGGGGGG - Intergenic
991659256 5:68933847-68933869 CTGGGAAACAAGATAGTTGGAGG - Intergenic
993228757 5:85204532-85204554 CTGGGAAAGCAGTGGGTTGGTGG + Intergenic
995882795 5:116861430-116861452 CTGGGAAACCAGAGATTCTGTGG - Intergenic
1002641656 5:180633393-180633415 CTGGCAAAGCAAAGACTCGGTGG - Intronic
1004657699 6:17680212-17680234 ATGGGAAACCAAAGAGCCTGTGG + Intronic
1004714880 6:18207375-18207397 CTGGGAAACAAGAGAGGTTGGGG - Intronic
1004991406 6:21142367-21142389 CTGGGACACCATAGAATCTGGGG + Intronic
1006192269 6:32216945-32216967 CTGTGAAACCAGAGGGGCAGAGG + Exonic
1006505481 6:34486178-34486200 CTGGGAACCCAGGGAGAGGGAGG + Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1006824942 6:36928011-36928033 CAGGGAAACCAGAGACACTGAGG - Intronic
1010344355 6:74794435-74794457 CAGGGAACCCAGAGAGTCCACGG - Intergenic
1010628584 6:78169047-78169069 CTGGGAAATCCAAGAGACGGTGG - Intergenic
1010752895 6:79634657-79634679 CTGGGAAGCCAGAGAATAGAGGG + Intronic
1011010181 6:82694938-82694960 CTGGGAATCCAGAGTGTAGGAGG + Intergenic
1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG + Exonic
1017791676 6:157805228-157805250 CTGGGACACCAATGAGTCAGAGG - Intronic
1019083514 6:169452982-169453004 CTGGGAGACCAGGGAGGCTGGGG - Intergenic
1019223145 6:170490792-170490814 CGGTGAAACCAGAGACTCGCAGG + Intergenic
1019290055 7:245938-245960 CTCGGAAACCAGAGGGTGGGCGG + Intronic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1023281236 7:38572735-38572757 CTGGGAGACCAGAGGGTCAGAGG - Intronic
1023480959 7:40634115-40634137 CTTGGAACACAGAGAGTTGGAGG + Intronic
1025150466 7:56542732-56542754 GTGGGAACCCAGAGAAACGGTGG - Intergenic
1025233936 7:57220948-57220970 CTGGAAACCCAGGGAGGCGGCGG + Intergenic
1029425092 7:100489793-100489815 CTAGGAGACCAGAGAGGTGGGGG + Intronic
1031475379 7:122215007-122215029 CTGAGAAACCAGAGAGTGAGAGG + Intergenic
1032515298 7:132502265-132502287 CTAGGAAACCAGTGAGTCAAAGG + Intronic
1036154804 8:6331529-6331551 ATAGGAAACCAGAGAGTATGGGG - Intergenic
1039757223 8:40536651-40536673 CTGGGCAAGCAGAGAGGTGGGGG - Intronic
1041285429 8:56256311-56256333 CTGGGAAACCATAGAGTAAATGG - Intergenic
1042104661 8:65313618-65313640 CTGGGACACCCGGGAGGCGGAGG - Intergenic
1045186261 8:99841630-99841652 CTGGGAAACCACACAGTCCCAGG - Intronic
1047971518 8:130088471-130088493 CTGAGAACACAGAGAGGCGGCGG + Intronic
1052827534 9:33187883-33187905 CCGGGAACCCAGAGAGACAGAGG + Intergenic
1053294052 9:36900667-36900689 CTGGGAAACCAGGGTGGCTGAGG - Intronic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1061120530 9:128639532-128639554 CAGTGAAACCAGAGAGACTGGGG + Intronic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1189329884 X:40137710-40137732 CTGGCAAGCCAGAGAGTCTTGGG - Intronic
1191075055 X:56443980-56444002 CAGGGAAACCAGTGAGTCATAGG + Intergenic
1192111127 X:68366113-68366135 CTGGGTACCCAGAGAGACTGGGG - Intronic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1193845592 X:86466467-86466489 GTGGGAGACCTGAGATTCGGAGG - Intronic
1197401609 X:125998722-125998744 CTTGGAAACCAGGGAGTAGTTGG + Intergenic