ID: 1011687415

View in Genome Browser
Species Human (GRCh38)
Location 6:89834713-89834735
Sequence AATTTTGAGGCCAGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14207
Summary {0: 1, 1: 51, 2: 464, 3: 2794, 4: 10897}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011687415_1011687425 28 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data
1011687415_1011687423 26 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687423 6:89834762-89834784 AGCACTGAAGGGCTTTTTGGTGG No data
1011687415_1011687424 27 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687424 6:89834763-89834785 GCACTGAAGGGCTTTTTGGTGGG No data
1011687415_1011687421 15 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687421 6:89834751-89834773 AATCAGCAGGAAGCACTGAAGGG No data
1011687415_1011687420 14 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687420 6:89834750-89834772 AAATCAGCAGGAAGCACTGAAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1011687415_1011687422 23 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687422 6:89834759-89834781 GGAAGCACTGAAGGGCTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 221
1011687415_1011687418 2 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687418 6:89834738-89834760 TTTTTTATCCTGAAATCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011687415 Original CRISPR AATTTTGAGGCCAGGCGCAG TGG (reversed) Intronic