ID: 1011687416

View in Genome Browser
Species Human (GRCh38)
Location 6:89834721-89834743
Sequence AAAAAACAAATTTTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3593
Summary {0: 1, 1: 2, 2: 72, 3: 511, 4: 3007}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011687416_1011687424 19 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687424 6:89834763-89834785 GCACTGAAGGGCTTTTTGGTGGG No data
1011687416_1011687421 7 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687421 6:89834751-89834773 AATCAGCAGGAAGCACTGAAGGG No data
1011687416_1011687422 15 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687422 6:89834759-89834781 GGAAGCACTGAAGGGCTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 221
1011687416_1011687418 -6 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687418 6:89834738-89834760 TTTTTTATCCTGAAATCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 306
1011687416_1011687425 20 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data
1011687416_1011687423 18 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687423 6:89834762-89834784 AGCACTGAAGGGCTTTTTGGTGG No data
1011687416_1011687420 6 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687420 6:89834750-89834772 AAATCAGCAGGAAGCACTGAAGG 0: 1
1: 0
2: 1
3: 29
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011687416 Original CRISPR AAAAAACAAATTTTGAGGCC AGG (reversed) Intronic