ID: 1011687417

View in Genome Browser
Species Human (GRCh38)
Location 6:89834726-89834748
Sequence AGGATAAAAAACAAATTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 1062}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011687417_1011687421 2 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687421 6:89834751-89834773 AATCAGCAGGAAGCACTGAAGGG No data
1011687417_1011687423 13 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687423 6:89834762-89834784 AGCACTGAAGGGCTTTTTGGTGG No data
1011687417_1011687422 10 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687422 6:89834759-89834781 GGAAGCACTGAAGGGCTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 221
1011687417_1011687420 1 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687420 6:89834750-89834772 AAATCAGCAGGAAGCACTGAAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1011687417_1011687424 14 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687424 6:89834763-89834785 GCACTGAAGGGCTTTTTGGTGGG No data
1011687417_1011687425 15 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011687417 Original CRISPR AGGATAAAAAACAAATTTTG AGG (reversed) Intronic