ID: 1011687419

View in Genome Browser
Species Human (GRCh38)
Location 6:89834746-89834768
Sequence CAGTGCTTCCTGCTGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011687419_1011687422 -10 Left 1011687419 6:89834746-89834768 CCTGAAATCAGCAGGAAGCACTG No data
Right 1011687422 6:89834759-89834781 GGAAGCACTGAAGGGCTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 221
1011687419_1011687423 -7 Left 1011687419 6:89834746-89834768 CCTGAAATCAGCAGGAAGCACTG No data
Right 1011687423 6:89834762-89834784 AGCACTGAAGGGCTTTTTGGTGG No data
1011687419_1011687425 -5 Left 1011687419 6:89834746-89834768 CCTGAAATCAGCAGGAAGCACTG No data
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data
1011687419_1011687424 -6 Left 1011687419 6:89834746-89834768 CCTGAAATCAGCAGGAAGCACTG No data
Right 1011687424 6:89834763-89834785 GCACTGAAGGGCTTTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011687419 Original CRISPR CAGTGCTTCCTGCTGATTTC AGG (reversed) Intronic