ID: 1011687425

View in Genome Browser
Species Human (GRCh38)
Location 6:89834764-89834786
Sequence CACTGAAGGGCTTTTTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011687415_1011687425 28 Left 1011687415 6:89834713-89834735 CCACTGCGCCTGGCCTCAAAATT 0: 1
1: 51
2: 464
3: 2794
4: 10897
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data
1011687417_1011687425 15 Left 1011687417 6:89834726-89834748 CCTCAAAATTTGTTTTTTATCCT 0: 1
1: 0
2: 5
3: 86
4: 1062
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data
1011687419_1011687425 -5 Left 1011687419 6:89834746-89834768 CCTGAAATCAGCAGGAAGCACTG No data
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data
1011687416_1011687425 20 Left 1011687416 6:89834721-89834743 CCTGGCCTCAAAATTTGTTTTTT 0: 1
1: 2
2: 72
3: 511
4: 3007
Right 1011687425 6:89834764-89834786 CACTGAAGGGCTTTTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011687425 Original CRISPR CACTGAAGGGCTTTTTGGTG GGG Intronic