ID: 1011690435

View in Genome Browser
Species Human (GRCh38)
Location 6:89862017-89862039
Sequence CTACCATGCCTGGCCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 935
Summary {0: 1, 1: 2, 2: 26, 3: 144, 4: 762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011690428_1011690435 18 Left 1011690428 6:89861976-89861998 CCTGCCTCGGCCTCTCAAAGTGC 0: 2380
1: 93440
2: 229088
3: 235883
4: 155983
Right 1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG 0: 1
1: 2
2: 26
3: 144
4: 762
1011690430_1011690435 14 Left 1011690430 6:89861980-89862002 CCTCGGCCTCTCAAAGTGCTGGG 0: 3465
1: 125828
2: 269574
3: 211978
4: 127563
Right 1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG 0: 1
1: 2
2: 26
3: 144
4: 762
1011690432_1011690435 8 Left 1011690432 6:89861986-89862008 CCTCTCAAAGTGCTGGGATTATA 0: 1280
1: 39682
2: 334961
3: 254257
4: 135745
Right 1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG 0: 1
1: 2
2: 26
3: 144
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011690435 Original CRISPR CTACCATGCCTGGCCAAAGC TGG Intronic
901024550 1:6272195-6272217 GCACCATGCCTGGACATAGCAGG + Intronic
901328457 1:8384806-8384828 CTGCCATTCCTGCCCACAGCAGG - Intronic
901527296 1:9831681-9831703 CCACCACGCCTGGCCCAAGGAGG - Intergenic
901707833 1:11089668-11089690 CCACTGTGCCTGGCCAGAGCTGG - Intronic
901882993 1:12204885-12204907 CCACCTTGCCTGGCCAGACCAGG - Intronic
902018496 1:13327676-13327698 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902312264 1:15590214-15590236 CCACCACGCCTGGCCCAATCTGG - Intronic
902342375 1:15792375-15792397 CCACCGTGCCTGGCCCAGGCTGG - Intergenic
902832564 1:19026670-19026692 CCACCATGCCTGGCCTAAGTGGG + Intergenic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903040142 1:20523318-20523340 CCACCATGCCTGGCCTCAGCTGG + Intergenic
903270763 1:22186827-22186849 CCACCATGCCTGGCCTCACCTGG + Intergenic
903307725 1:22425060-22425082 CCACCATGCCTGGCCCATGAGGG - Intergenic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903599831 1:24529263-24529285 CCACCATGCCTGGCCACACCTGG - Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
903638140 1:24834778-24834800 CTCTCATGCCGAGCCAAAGCTGG - Intronic
903921788 1:26804812-26804834 CTCTCATGCCGGGCCAAAGCTGG - Intergenic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904646546 1:31971862-31971884 CTACCATGCCCAGCCTAAACTGG - Intergenic
904656410 1:32051544-32051566 CTGCCATGCCTGGTCATAGGTGG + Intronic
904717048 1:32476286-32476308 CCACCATGCCTGGTCATAGGGGG + Intronic
904844662 1:33401037-33401059 CCACCATGCCTGGCCCAAGATGG - Intronic
905089428 1:35416849-35416871 CCACCATGCCTGGCCTCAGTTGG + Intronic
905672111 1:39798664-39798686 CCACCATGCCTGGCCAGAGCAGG - Intergenic
905968478 1:42120007-42120029 ATACCATGGAAGGCCAAAGCAGG + Intergenic
906095370 1:43219804-43219826 CCACCATGCCTGGCTAGAGATGG - Intronic
906179201 1:43803923-43803945 CTTTCCAGCCTGGCCAAAGCAGG + Intronic
906237934 1:44223029-44223051 CTGACTTGCCTGCCCAAAGCAGG - Intronic
906406483 1:45546460-45546482 CCACCGTGCCCGGCCAAGGCTGG + Intergenic
906432458 1:45766080-45766102 CCACCATGCCCAGCCAAAGCAGG - Intergenic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908286657 1:62611855-62611877 CCACCATGCCTGGCCAGATAAGG - Intronic
908645005 1:66268380-66268402 CCACCATGCCTGGCCGAAGAGGG - Intronic
910414917 1:86987359-86987381 CCACCATGCCTGGCCCAACTAGG + Intronic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911330208 1:96518345-96518367 CCACCATGCCTGGCCCAGGTTGG - Intergenic
913178051 1:116292962-116292984 CCACCATGTCTGGCCTAAGATGG + Intergenic
913270401 1:117087578-117087600 CCACCATGCCTGGCCATATTAGG + Intronic
914407786 1:147393305-147393327 CCACCGTGCCCGGCCAAGGCAGG + Intergenic
914413691 1:147457362-147457384 CCACCATGCCTGGCCTGAGATGG - Intergenic
915139560 1:153758818-153758840 CCACCATGCCTGGCCAGGCCTGG - Intronic
915211214 1:154310998-154311020 CCACCGTGCCCGGCCAAAGATGG + Intergenic
915232369 1:154455196-154455218 CTACCATGCCCGGCCCAAAGAGG + Intronic
915705313 1:157838061-157838083 CCACCACGCCTGGCCTAATCTGG + Intronic
916408416 1:164520811-164520833 CCACCGTGCCTGGCCAGAGAAGG - Intergenic
916726434 1:167527665-167527687 CTTTCATGTCTGACCAAAGCTGG + Intergenic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
917692554 1:177484156-177484178 CCACCATGCCTGTCCGATGCTGG - Intergenic
919104188 1:193128590-193128612 CCACCATGCCTGGCCTAGGCTGG + Intronic
919585043 1:199427229-199427251 CCACCACGCCTGGCCACAGTCGG - Intergenic
919694322 1:200558240-200558262 CTACCATCCCTGGCCAAGGATGG + Intronic
919768938 1:201144909-201144931 CCACAATGCCTGGCCATTGCCGG + Intronic
919824468 1:201493709-201493731 CAACCAGGCCTGGCCAATGAGGG + Intronic
919959729 1:202454644-202454666 CTACCATACCTGGCCAAGAAGGG - Intronic
920371948 1:205484716-205484738 CCACCATGCCTGGTCATAGCTGG - Intergenic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920584589 1:207145386-207145408 CCACCATGCCTGGCCATACTTGG + Intergenic
920824548 1:209413252-209413274 CTGCCAGGCCTGGCCAACGATGG + Intergenic
921012238 1:211153366-211153388 CCACCACGCCCAGCCAAAGCAGG + Intergenic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921405717 1:214777046-214777068 CCACCATCACTGGGCAAAGCTGG - Intergenic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922295027 1:224242618-224242640 CCACCATGCCTGGCCAATTTTGG + Intronic
922407638 1:225332705-225332727 CCACCATGCCCAGCCAAAGCAGG - Intronic
922490548 1:226013236-226013258 CTACCATGCCCAGCCAAGGCTGG - Intergenic
922954896 1:229590924-229590946 CCACCATGCGTGGCCTCAGCTGG + Intergenic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
924113775 1:240725987-240726009 CCACCACCCCTGGCCAATGCAGG + Intergenic
924852737 1:247846895-247846917 CTACCACGCCTGGCTAAATTTGG - Intergenic
1063701192 10:8386931-8386953 CCACCATGCCTGGCCTATGCAGG + Intergenic
1064007704 10:11711700-11711722 CCATCACGCCTGGCCTAAGCTGG + Intergenic
1064078164 10:12286913-12286935 CCACCATGCCTGACCATAGGTGG + Intergenic
1064266728 10:13831293-13831315 CCACCATACCTGGCCAATCCTGG - Intronic
1064358192 10:14638901-14638923 CCACCGTGCCTGGACAAAGTAGG - Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064751647 10:18536547-18536569 CTGCCATGCCTGGCCAGAACTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065153365 10:22845165-22845187 CATCCATGCCTGGCCAATGCAGG - Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065349986 10:24786762-24786784 ACACCATGCCTGGCCAAGGCAGG + Intergenic
1065655036 10:27939583-27939605 CCACCATGCCTGGCTAATGTAGG - Intronic
1065831486 10:29618518-29618540 CCACCATGCCTGGCCCAGCCTGG + Intronic
1065840207 10:29695990-29696012 CTCTCATGCCGGGCCAAAGCTGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066045435 10:31590871-31590893 CTACCATGCCCGGCCTAAAAGGG - Intergenic
1066085162 10:31969122-31969144 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067826633 10:49578767-49578789 CCACCATGCCCAGCCAGAGCAGG - Intergenic
1068879161 10:62030416-62030438 CCACCACGCCCGGCCAATGCAGG + Intronic
1069689375 10:70339831-70339853 CCACCATGCCTGGCCGATGTTGG - Intronic
1069696835 10:70392702-70392724 CCACCATGCCTGGCCACATCTGG - Intergenic
1070169938 10:73925354-73925376 CCACCATGGCTGGCCTAAGAAGG + Intergenic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071590361 10:86866649-86866671 CCACCATGCCCGGCCAACTCAGG + Intronic
1071699176 10:87910709-87910731 CCACCATGCCTGGCCACTGTGGG + Intronic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072999523 10:100276540-100276562 CTCTCAAGCCGGGCCAAAGCTGG + Intronic
1073086859 10:100896600-100896622 CCACCGCACCTGGCCAAAGCTGG + Intergenic
1073153144 10:101325534-101325556 ACACCAGGCCTGGCCAGAGCAGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075368200 10:121912031-121912053 CCACCATGCCCGGCCAAGCCCGG + Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1076711930 10:132341141-132341163 CCACCATGCCTGGCTAATGTTGG - Intronic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1077813996 11:5667484-5667506 CCACCACACCTGGCCAAATCTGG + Intronic
1078208762 11:9253138-9253160 CTACCATACCTGGCCACAACAGG + Intronic
1078255510 11:9655315-9655337 ACACCATGCCTGGCCTAAGCAGG + Intergenic
1078341297 11:10499501-10499523 CCATCATGTCTGGCCAAACCTGG + Intronic
1078457150 11:11484303-11484325 CCACCATGCCTGGCCTCACCTGG - Intronic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1079297982 11:19251594-19251616 CTACCACTCCTGGCCTAAGATGG + Intergenic
1079324280 11:19478192-19478214 CCACCATGCCTGCCAAAAGGAGG - Intronic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080591220 11:33724513-33724535 GCACAATGCCTGGCCAAAGATGG + Intronic
1080936440 11:36868816-36868838 CCACCATGCCCAGCCTAAGCAGG - Intergenic
1081616738 11:44595780-44595802 CTACCATGTCTGGCCAGAAGGGG - Intronic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1083865298 11:65450433-65450455 CTCTCATGCCGGGCCAAAGCCGG + Intergenic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1084388600 11:68860613-68860635 CTACCATGCCTGGCTAATTTTGG - Intergenic
1084627627 11:70320722-70320744 CCACCATGCCTGGCCTTAGATGG + Intronic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1085116879 11:73937630-73937652 CTCTCATGCCGGGCCAAAGCTGG - Intergenic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085369700 11:75989334-75989356 CTACCATGCCCGGCCACTTCTGG + Intronic
1085575485 11:77599166-77599188 CCACCATGCCTGGCCACACCTGG + Intronic
1085754326 11:79191165-79191187 CTCTCATGCCGGGCCAAAGCTGG + Intronic
1085758068 11:79218001-79218023 CCACCATGCCTGGCCAGGGTAGG + Intronic
1086073946 11:82830338-82830360 CCACCGTGCCTGGCCAGCGCAGG - Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087104423 11:94395930-94395952 CCACCATGCCCGGCCATTGCTGG - Intronic
1087214593 11:95481856-95481878 CTCTCATGCCTAGCCGAAGCTGG + Intergenic
1087251340 11:95903825-95903847 CCACCATGCCTGGCCTAATGAGG - Intronic
1087985778 11:104677570-104677592 CCACCATGCCTGGCTAATGTTGG - Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1091083006 11:132690225-132690247 TCACCATGCCTGGCCAAGCCAGG + Intronic
1091378411 12:41296-41318 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1091745623 12:2990910-2990932 CCACCATGCCTGGTCACAACTGG - Intronic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092808646 12:12251217-12251239 CCACCGTGCCCAGCCAAAGCCGG + Intronic
1092944999 12:13444668-13444690 CCACCATGCCTAGCCTAGGCTGG + Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093963583 12:25302070-25302092 CCACCATGCCTAGCCAATCCTGG - Intergenic
1094357199 12:29590497-29590519 CCACCATGCCTGGCCACACGTGG - Intronic
1094653647 12:32400306-32400328 CCACCACGGCTGCCCAAAGCAGG - Intronic
1095107536 12:38253336-38253358 CCACCATGCCTGGTCAATGCAGG + Intergenic
1096393563 12:51248330-51248352 CTACCATTCCTAGACAAAGAGGG - Intronic
1098227743 12:68342115-68342137 GTGCCATGCCTGTCCAAGGCTGG - Intergenic
1098310957 12:69148526-69148548 AGACCATGCATGGCCAAAGAGGG - Intergenic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1100027185 12:90145067-90145089 CCAGCATGCCTGGCAACAGCAGG - Intergenic
1100255302 12:92877262-92877284 CCACCATTCCTGGCCTAACCTGG + Intronic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100570918 12:95842333-95842355 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1100597261 12:96082319-96082341 CCACCATGCCTGGCCAATTTTGG - Intergenic
1100602304 12:96122405-96122427 CCACCTTGCCTGGCCAATGTTGG + Intergenic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1100828187 12:98494177-98494199 CCACCTTGCCTGGCCAAGGTTGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102177019 12:110883436-110883458 CTACCATGCCCGGCCAGGGCAGG + Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1103047987 12:117754348-117754370 CCACCATGCCTGGCCGAGGAAGG - Intronic
1103374172 12:120442270-120442292 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104787918 12:131461676-131461698 CTACCACGCCTGGCCAAACCAGG - Intergenic
1105385076 13:19922200-19922222 CCACCAGGCCTGGCCACAGGTGG + Intergenic
1106044992 13:26130572-26130594 CTGCCACGCCCGGCCAAAGTTGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106642909 13:31604682-31604704 CCACCGCGCCTGGCCAAGGCTGG - Intergenic
1106685562 13:32055328-32055350 CCACCATGCCTGGCCTAAGATGG + Intronic
1106744832 13:32690276-32690298 CTACCATGCCTGGGCAGGGCTGG + Intronic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1107606294 13:42060634-42060656 ACACTATGCCTGGCCATAGCAGG - Intronic
1108079497 13:46720097-46720119 CCACCGTGCCTGGCCAAGGTAGG - Intronic
1108087517 13:46809662-46809684 CCACCGTGCCTGGCCAGATCTGG - Intergenic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108724111 13:53162298-53162320 CCACCATGCCTGGCCCCAGTAGG + Intergenic
1108827725 13:54435124-54435146 CCACCACGCCTGGCCAAAGATGG + Intergenic
1109265597 13:60196197-60196219 CTACCATGCCTGTCCTTTGCAGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1111003856 13:82223040-82223062 CCACCATGCCCGGCCAATGTAGG - Intergenic
1111626467 13:90794246-90794268 CCACCATGCCTGGCCAGACAGGG + Intergenic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1112394278 13:99014205-99014227 CTGCCATTACTGGCCCAAGCAGG + Intronic
1112590117 13:100755611-100755633 CCACCATGCCTGGCCATATTCGG - Intergenic
1112747296 13:102541148-102541170 CTACCGCGCCCGGCCACAGCAGG - Intergenic
1113767799 13:112891816-112891838 CTAACAAGCCTGGCCCCAGCAGG + Intergenic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1114632565 14:24168788-24168810 CCACCATGCCTGGCCTCACCTGG - Intergenic
1115010246 14:28537321-28537343 CTGCCATACCTGGACAGAGCAGG - Intergenic
1115058928 14:29167773-29167795 CCACCATGCCTGTCCAAGGCTGG - Intergenic
1116840953 14:49820656-49820678 CTCTCATGCCGAGCCAAAGCTGG + Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117415316 14:55490202-55490224 CCACCATGCCTGGCCATCTCAGG + Intergenic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1117953714 14:61107023-61107045 CTGCCATGCCAGGTCAAAGTTGG - Intergenic
1118341412 14:64896638-64896660 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1118407646 14:65442455-65442477 CCACCACGCCTGGCCAAGGGTGG + Intronic
1118658804 14:67984222-67984244 CCACCATGCCTGGCCAGGGCTGG + Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1119516996 14:75256140-75256162 CTACCATGCCAGGCCTAAAATGG + Intronic
1119698780 14:76735432-76735454 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1119942829 14:78659389-78659411 CTACCATGCCCAGCCAAAAATGG - Intronic
1120367309 14:83587699-83587721 CTACCAGGCCTGGTGATAGCTGG - Intergenic
1120501327 14:85300647-85300669 CCACCATGCCTGGCCAGATATGG - Intergenic
1120955373 14:90077406-90077428 CCACCATGCCCGGCCAATCCTGG + Intronic
1122139967 14:99657221-99657243 CTACAATGCCTGGCCGAGGAAGG - Intronic
1123099549 14:105787230-105787252 CCACCATGCCTGTCCTATGCTGG + Intergenic
1123446503 15:20334621-20334643 CCACCGTGCCTGGCCAATGTTGG + Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1123965242 15:25449471-25449493 CCACCATGCCCAGCCAAGGCAGG - Intergenic
1123979885 15:25591396-25591418 CTACCATGCCTGGCCTTTGTAGG + Intergenic
1124042307 15:26116788-26116810 CCACCACGCCTGACCAAAGATGG - Intergenic
1124548805 15:30657997-30658019 CCACCATGCCTGGCCACACATGG + Intronic
1125583307 15:40802813-40802835 CTACCACGCCTGGCCAGAGGAGG - Intronic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125898565 15:43324327-43324349 CCACCATGCCTGGCCTAGGTGGG - Exonic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126133725 15:45370087-45370109 CAACCATGCCTGGCCAATAATGG - Intronic
1126167185 15:45663476-45663498 CCACCATGCTCAGCCAAAGCAGG - Intronic
1127087737 15:55440336-55440358 CCACCACGCCTGGCCAATGATGG + Intronic
1127360495 15:58240873-58240895 CCACCATGCCTGGCCGACCCAGG - Intronic
1128352966 15:66903716-66903738 CCACCACGCCCGGCCAAGGCTGG + Intergenic
1128479397 15:68024260-68024282 CCACCATGCCTGGCCAGTGGTGG - Intergenic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1129245661 15:74277344-74277366 CCACTATGCCTGGGCAGAGCAGG + Intronic
1129260955 15:74367001-74367023 CCACCATGCCTGGCCAGACCTGG + Intronic
1129380388 15:75161347-75161369 CTGCCCTGCCTGGCCCAAGTTGG - Intergenic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1130367273 15:83251923-83251945 TGACCATGCCTGGCCTCAGCAGG - Intergenic
1130702754 15:86201996-86202018 CTCCCATGCCTGGCCACACAGGG - Intronic
1130913613 15:88288051-88288073 CTTCCAAGACTGGCCAGAGCAGG - Intergenic
1130913914 15:88290302-88290324 CTACCATCCCTGGACAGAGAAGG - Intergenic
1131167889 15:90155788-90155810 CCACCGCGCCTGGCCAGAGCTGG + Intergenic
1131178913 15:90227332-90227354 CCACCATGCCTGGCCACTGAGGG + Intronic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131538315 15:93255489-93255511 CCACGATGCCTGGCCGAAGTAGG + Intergenic
1131670922 15:94618830-94618852 CCACCATGCTGGGCCGAAGCTGG + Intergenic
1131742277 15:95406198-95406220 CTTCCGTGTCTGGCCACAGCTGG - Intergenic
1131988165 15:98065899-98065921 ACACCATGCCTTCCCAAAGCAGG + Intergenic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132527288 16:423762-423784 CTACCACACCTGGCCTAAGGTGG + Intergenic
1132737438 16:1393900-1393922 CCACCAGGCCTGGCCCACGCCGG + Intronic
1132855219 16:2041893-2041915 CCACCACGCCTGGCCACACCCGG + Intronic
1132903333 16:2270022-2270044 CTTCCATGCCTGGGCACAGCAGG - Intergenic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133228757 16:4356238-4356260 CCACCATGCCTGGCCACACCTGG + Intronic
1133730277 16:8572721-8572743 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1134027089 16:10962769-10962791 ATACCATGCCTGGCCAATCTTGG - Intronic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134218754 16:12337021-12337043 CTCCCAGGCCTGGCCAACTCTGG - Intronic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134536425 16:15030255-15030277 CCACCATGCCCGGCCAATTCAGG - Intronic
1134590701 16:15450756-15450778 CCACCACGCCCGGCCATAGCTGG + Intronic
1134642010 16:15836875-15836897 CTACCATGCCTGGCTAATTTTGG + Intronic
1134660896 16:15983706-15983728 CTACCATGCCTGGCTAATTTTGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135333835 16:21584228-21584250 GCACCGTGCCTGGCCGAAGCAGG - Intergenic
1135645313 16:24156560-24156582 TCACCATGCCCGGCCAAAGTTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135780536 16:25296050-25296072 CCACCATGTCTGGCCATAGTCGG + Intergenic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136353799 16:29730020-29730042 CTACCATGCCTGGCCAATTTTGG - Intergenic
1136379718 16:29887597-29887619 CCACCATGCCCGGCCAAGGTGGG + Intronic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1137250994 16:46740837-46740859 CTACCACGCCCGGCCAGAGATGG + Intronic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139414762 16:66799513-66799535 CCACCGTGCCTGGCCTAAGAGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139448031 16:67010351-67010373 CCACCATGCCTGGCCACTGTGGG + Intergenic
1139488161 16:67271043-67271065 CCACCGAGCCTGGCCAAGGCTGG + Exonic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1139659527 16:68411332-68411354 CCACACTGCCTGGCCAGAGCTGG + Intronic
1139859644 16:70010531-70010553 CCACCATGCCCGGCCAATTCAGG + Intergenic
1139897307 16:70298004-70298026 CTACTGTGCCTGGCCAATCCTGG + Intronic
1140960383 16:79906433-79906455 CCACCATGCCTGGCCACATGTGG - Intergenic
1141510377 16:84507979-84508001 CCACCATGCCCGGCCTAAGAGGG + Intronic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141662840 16:85450771-85450793 CCACCGTGCCCGGCCAAACCTGG - Intergenic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141859222 16:86705101-86705123 CCACCGCGCCTGGCCACAGCAGG - Intergenic
1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG + Intronic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1142874976 17:2846561-2846583 CCACCATGCCTGGCCAACTTTGG + Intronic
1143122001 17:4613972-4613994 CCACCGTGCCTGGCCTATGCAGG - Intergenic
1143222398 17:5273545-5273567 CCACCACGCCCAGCCAAAGCTGG - Intergenic
1143233092 17:5374309-5374331 CCACCATGCCCAGCCAAAGATGG + Intronic
1143346920 17:6256581-6256603 CCACCGTGCCCGGCCAAAGTTGG - Intergenic
1143533354 17:7519505-7519527 CCACCATGCCTGGCCAACTTAGG + Intergenic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1144143361 17:12371711-12371733 TTCCCATGCCTGACCAATGCAGG + Intergenic
1144317358 17:14075422-14075444 CTCCCATGCCTGCCTATAGCTGG + Intronic
1144456564 17:15423560-15423582 CCACCACGCCCGGTCAAAGCAGG - Intergenic
1144536214 17:16094603-16094625 CTCTCATGCCGAGCCAAAGCTGG + Intronic
1144560723 17:16318643-16318665 CCACCACACCTGGCCAAAGCTGG - Intronic
1144574186 17:16418559-16418581 CTAGCCTGCGAGGCCAAAGCTGG - Intronic
1144747891 17:17627790-17627812 CCACCATGCCTGGCCTCACCTGG + Intergenic
1144843501 17:18203439-18203461 CTACCGTGTCAGGACAAAGCAGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145733486 17:27211429-27211451 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1145872859 17:28290036-28290058 CCACCATGCCTGGCCACAGATGG - Intergenic
1145907810 17:28525812-28525834 CTACCAGGTGTGGCCAAAACAGG + Intronic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145979277 17:29002307-29002329 CTACCATGCCTGCCTAAATATGG - Intronic
1146363382 17:32197713-32197735 CCACCGTGCCTGGCCACACCCGG + Intronic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147047601 17:37766140-37766162 CCACCATGCCCGGCCAATGTTGG - Intergenic
1147609182 17:41791760-41791782 CCACCATGCCTGGCCGATCCTGG + Intergenic
1147766301 17:42838603-42838625 CCACCATGCCTGGCCAGACTAGG + Intronic
1147784546 17:42969837-42969859 CCACCACGCCTGGCCCAAGAAGG - Intronic
1147870860 17:43586516-43586538 CCACCATGCCTGGCCTAGGCAGG - Intergenic
1148849065 17:50545746-50545768 CCACCGTGCCTGGCCAGAGAAGG - Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1149937417 17:60821920-60821942 CTACTTTGGCAGGCCAAAGCAGG - Intronic
1150266797 17:63837443-63837465 CTCCCATGCCTGCCCAGCGCCGG - Exonic
1150750890 17:67861601-67861623 CCACCATGCCCAGCCATAGCTGG + Intronic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151323977 17:73367789-73367811 CCACCATGCCTGGCCCCTGCCGG + Intronic
1151477033 17:74350084-74350106 CTACTGTGCCTGGCCACAGACGG + Intronic
1151483081 17:74381703-74381725 CCACCGTGCCTGGACGAAGCTGG - Intergenic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151907706 17:77059735-77059757 CCACCGTGCCTGGCCCAAGAGGG + Intergenic
1151941131 17:77292644-77292666 CCACCATGCCTGGCCAATTTTGG + Intronic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152746915 17:82044749-82044771 CCACCACGCCCGGCCAAACCCGG + Intergenic
1152763282 17:82121096-82121118 CCACCATGCCTGGCAACGGCTGG - Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153832815 18:8938241-8938263 CCACCATGCCTGGCCACAGGTGG - Intergenic
1154158008 18:11959090-11959112 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1155202204 18:23527094-23527116 CCACCATGCCTGGCCTCAGTAGG - Intronic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155973430 18:32102916-32102938 CCACCATGCCTGGCCAATTTGGG + Intronic
1156268182 18:35507367-35507389 CTTTCATGCCTGGCCAAGGCAGG + Intergenic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156493675 18:37511847-37511869 CTACCATGCTTACCCCAAGCAGG + Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1156703193 18:39848971-39848993 CCTCCATGCCTGGCCAAACAGGG - Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158361018 18:56673544-56673566 CCACCATGCCTGGCCCAGGAGGG - Intronic
1158580428 18:58676240-58676262 CTACCACGCCTGGCCACAATAGG - Intronic
1158588753 18:58762563-58762585 CCACCATGGCTGCCCATAGCAGG + Intergenic
1159243811 18:65778944-65778966 CTACCATGCCTGTCCTTTGCAGG + Intronic
1160610423 18:80080373-80080395 CTGCCTTGCCTGGCCACACCGGG + Intronic
1160743371 19:698187-698209 CCACCATGTCTGGCCCAAGTTGG + Intergenic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160758204 19:769137-769159 CTACCATGCCTGGCCCCTGCAGG - Intergenic
1161020336 19:2007546-2007568 CTACCGTCCCTGGCCTAAGGCGG - Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161192107 19:2963514-2963536 CCACCGTGCCTGGCCAGAGTGGG - Intergenic
1161244534 19:3242060-3242082 CCACCATGCCCGGCCCAAGGTGG + Intronic
1161312754 19:3603885-3603907 CTACCCCTCCTGGCCAATGCAGG - Intronic
1161566012 19:5003202-5003224 CCACCATGCCCGGCCCAAGCAGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161676567 19:5653748-5653770 CCACCATGCCTGGCCGGGGCAGG + Intronic
1162006371 19:7782831-7782853 CTGCCATGCCTGACCTATGCTGG - Intergenic
1162076540 19:8191620-8191642 CCACCATGCCTGGCCATTCCTGG - Intronic
1162117564 19:8440410-8440432 CCACCAGGCCTGGCCCATGCTGG - Intronic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162317224 19:9946903-9946925 CCACCGCGCCTGGCCAGAGCTGG - Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1162997191 19:14343613-14343635 CCACCATGCCTGGCCTCAGATGG - Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163166285 19:15500275-15500297 CCACCGTGCCTGGCCTAGGCTGG - Intergenic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163729096 19:18939711-18939733 CACCCATGACTGGCCAGAGCGGG + Intronic
1163945659 19:20531185-20531207 CTCTCATGCCAAGCCAAAGCTGG - Intergenic
1164066278 19:21720387-21720409 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1164115869 19:22217989-22218011 CCACCATGCCCGGCCAATGATGG + Intergenic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164186354 19:22872356-22872378 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1164632386 19:29770073-29770095 CCACCATGCCCGGCCTAAGAAGG + Intergenic
1164795656 19:31025528-31025550 CCACCGTGCCTGGCCACAGATGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1165103611 19:33455806-33455828 TTACCATGCCTGGCAATATCAGG + Intronic
1165903244 19:39178508-39178530 CACCCATTCCTGGCCAAGGCAGG + Exonic
1166372278 19:42308834-42308856 CCACCATGCCTGGCCTCATCTGG + Exonic
1166682231 19:44776256-44776278 CCACCATGCCTGGTCAGACCAGG - Intergenic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
926024288 2:9527033-9527055 CCAACATGCCCGGCCAAAGACGG - Intronic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
926194637 2:10755321-10755343 CCACCGTGCCTGGCCACACCTGG + Intronic
926274219 2:11391304-11391326 CCACCACGCCTGGCCCAAGATGG + Intergenic
926624317 2:15077967-15077989 CCACCACGCCTGGCCCAAGAAGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927777207 2:25911564-25911586 CTCCCATGCCGAGCCGAAGCTGG - Intergenic
927846273 2:26474226-26474248 CTACCCATCCTGACCAAAGCTGG - Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928180073 2:29062630-29062652 CTAGCTTGCATGGCCACAGCAGG + Exonic
928230756 2:29496981-29497003 CCACCATGCCTGGCCTCATCAGG - Intronic
928237857 2:29560722-29560744 CTACCATGCCTGGCTAATTTTGG + Intronic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929104976 2:38355982-38356004 CCACCATGCCTGGCCACATTTGG + Intronic
929596088 2:43177041-43177063 CCACCACGCCTGGCCAAACAAGG + Intergenic
929825905 2:45309610-45309632 CCACCATTCCTGGCCAGGGCTGG + Intergenic
929964161 2:46521197-46521219 CTACCATGCCTGGCCTGGGAAGG + Intronic
930007649 2:46910750-46910772 CCACCATGCCTGGCCTATCCTGG - Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930208991 2:48615430-48615452 CTCTCATGCCGGGCCAAAGCTGG - Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
930840305 2:55837959-55837981 CTACCATGCCTGGCCTAGAATGG + Intergenic
930994111 2:57696124-57696146 ATACCATGACTGGTCAATGCAGG - Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931751917 2:65338336-65338358 CTCTCATGCCGGGCCAAAGCTGG + Intronic
932138822 2:69256773-69256795 CCACCATGCCTGGCTAGAGATGG - Intergenic
932898200 2:75665439-75665461 CCACCATGCCCGGCCAAATCTGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
934660645 2:96141840-96141862 CCACCATGCCTGGCCCAGGATGG + Intergenic
934775162 2:96932648-96932670 CCACCATGCCCGGCCCATGCTGG - Intronic
935114771 2:100125877-100125899 CTACCATGCCTGTGTAAACCTGG - Intronic
935201556 2:100861152-100861174 CCACCATGCCTGGCCCAGCCTGG + Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935408071 2:102730335-102730357 CCACCATGCCTGGCCACCTCTGG + Intronic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
936247745 2:110843305-110843327 CCACCATGCCTGGCCAATGTAGG + Intronic
936540388 2:113345144-113345166 CCACCATGCCTGGCCTAATTAGG + Intergenic
936824603 2:116566032-116566054 CCACCATGCCTTGCCAAAGAAGG + Intergenic
937176232 2:119938412-119938434 CCACCATGCCTGGCTAATGTGGG + Intronic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
937821997 2:126320710-126320732 CCACCATGCCTGGCCAAGTGAGG + Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938296229 2:130181395-130181417 CTGCCCTGCCTGGGCAGAGCCGG + Intronic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938898577 2:135777597-135777619 CCACCATGCCTGGCCTGAGGTGG - Intronic
939238130 2:139523983-139524005 CTAACTTCCCTGGCCAGAGCAGG - Intergenic
939251058 2:139682119-139682141 CCACCATGCCTGGCCACATAGGG - Intergenic
939392301 2:141584090-141584112 CCACCATGCCTGGCTAACGTTGG - Intronic
939509684 2:143090152-143090174 CTACCAAGCCTGGTGATAGCTGG - Intergenic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
941820147 2:169836370-169836392 CTACCACGCCTGGCCCCACCAGG + Intronic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942235993 2:173905709-173905731 CCACCACGCTTGGCCAAATCTGG - Intergenic
942341839 2:174957337-174957359 CTGCCTTGCTTGGCCACAGCCGG + Intronic
943764751 2:191648568-191648590 CTACTGTGCTTGGCCAAAGTTGG + Intergenic
943773219 2:191741255-191741277 CTCTCAAGCCGGGCCAAAGCTGG + Intergenic
944151431 2:196562754-196562776 CCACCAACCCTGGCCAAAGCTGG - Intronic
944599036 2:201284634-201284656 CTCTCATGCCGAGCCAAAGCTGG - Intronic
944785816 2:203069015-203069037 CCACCATGCCTGGCCACTGGTGG + Intronic
944799625 2:203226871-203226893 CCACCATGCCTGGCCAATGAAGG + Intergenic
945090530 2:206172556-206172578 CTCTCATGCTGGGCCAAAGCTGG - Intergenic
945970603 2:216227513-216227535 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
945991006 2:216395284-216395306 CGAGGATGCCTGGCCCAAGCTGG + Intergenic
946265122 2:218534199-218534221 CCACCATGCCCGGCCTAATCTGG - Intronic
946712449 2:222520441-222520463 CTGCCATGCCTGGCCTAATATGG - Intronic
946950856 2:224873287-224873309 CTACCACACCTGGCCAGAGATGG - Intronic
947167226 2:227274784-227274806 CCACCATGCCTGGCCGAAGGAGG + Intronic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947738840 2:232475556-232475578 CCACCGTGCCTGGCCGAAGGGGG - Intergenic
947797644 2:232905140-232905162 CTCTCATGCCGAGCCAAAGCTGG + Intronic
947808826 2:232987303-232987325 ACACCGTGCCTGGCCAGAGCAGG + Intronic
947842849 2:233219545-233219567 CCACTATGCCTGGCCCAAGATGG - Intronic
947852925 2:233303100-233303122 CCACCATGCCTGGCTGAAGAAGG + Intergenic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
949012903 2:241691770-241691792 CCACCATGCCTGGCCAGGGATGG - Intergenic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169199245 20:3699687-3699709 CTACCATGCCCAGCCAAGCCAGG - Intronic
1169223263 20:3839599-3839621 CCACCATGCCTGGCCCAGCCAGG - Intergenic
1169330772 20:4714384-4714406 CCACCATGCCTGGCCCCTGCTGG - Intergenic
1169385220 20:5143129-5143151 CTACCATGCCCAGCCAAAAATGG + Intronic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1169861096 20:10153450-10153472 CCACCATGCCTGGCCTGAGGCGG - Intergenic
1170739034 20:19037285-19037307 CCACTATGCCTGGCCAGAGTTGG - Intergenic
1171963246 20:31510543-31510565 CTACCATGCCTGGCCACTCAAGG - Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172165402 20:32895856-32895878 CCACCGTGCCTGGCCCAGGCTGG + Intronic
1172492843 20:35354680-35354702 CCACCATGCCCAGCCAAAGGAGG + Intronic
1172559101 20:35870015-35870037 CTACCGCGCCTGGCCACACCCGG - Intronic
1172934757 20:38611859-38611881 CCACCGTGCCTGGCCACACCCGG + Intronic
1173183192 20:40820050-40820072 CCACCATGCCTGCCTAAACCTGG + Intergenic
1173299633 20:41790360-41790382 CTACCATGCCTGGCCATCAATGG + Intergenic
1173527297 20:43742982-43743004 CTGCCATACCTGGCCATACCTGG + Intergenic
1173978336 20:47204168-47204190 CCACCATGCCTGGCCAATGTGGG + Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174237332 20:49104696-49104718 TCACCATGCCTGGCCTAAGATGG - Intergenic
1174256285 20:49257997-49258019 CCACCGTGCCTGGCCAGAGATGG + Intronic
1174272210 20:49377877-49377899 CAACCCTGCCTGGGGAAAGCAGG - Intronic
1174830109 20:53804622-53804644 CCACCATGCCTGGCCTTATCAGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175830461 20:61962569-61962591 CCACCATGCCTGGCCTAGGCGGG - Intronic
1175895586 20:62334334-62334356 CTCGCAGGCCTGGCCACAGCAGG + Exonic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1179195052 21:39156667-39156689 CTCTCATGCCGGGCCAAAGCTGG + Intergenic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179767866 21:43587376-43587398 CTACCGTGCCTGGCCATCCCAGG - Intronic
1180221414 21:46360803-46360825 CCACCACGCCTGGCCATAGTTGG + Intronic
1180623853 22:17180847-17180869 CCACCATGCCTGGCCTATTCTGG - Exonic
1180678975 22:17609976-17609998 CCACCATGCCTGGCCTCAGAGGG - Intronic
1180691159 22:17717178-17717200 CCACTGTGCCTGGCCAAAGTTGG - Intronic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181470943 22:23139331-23139353 CCACCATACCTGGCCAAAGCTGG - Intronic
1181579826 22:23821988-23822010 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1181802964 22:25359138-25359160 CCACCATGCCTGGCCAGGCCAGG - Intronic
1182343791 22:29644878-29644900 CTCTCATGCCGAGCCAAAGCTGG - Intronic
1182608879 22:31529881-31529903 CCACCATACCCGGCCAAAGGTGG - Intronic
1182888547 22:33797049-33797071 CCACCATGCCTGGCCAGACTTGG + Intronic
1183123719 22:35754068-35754090 CGATGATGCCTGGCCAAAGTAGG + Intronic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183621056 22:38972978-38973000 CCACCGTGGCTGGCCAAAGGTGG - Intronic
1183859367 22:40658320-40658342 CCACCGCGCCCGGCCAAAGCTGG + Intergenic
1183871886 22:40746352-40746374 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1183891691 22:40935086-40935108 CCACCATGCCCGGCCAAGCCCGG - Intergenic
1183952546 22:41359684-41359706 CTTCCTGGCCTGGCCAGAGCTGG + Exonic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1184166287 22:42730338-42730360 CTACCCTGCCTGGCCAGTGATGG - Intergenic
1184272845 22:43394587-43394609 CCACCGGGCCTGGCCAAATCAGG + Intergenic
1184285238 22:43466892-43466914 CCACCATGCCTGGCCAGACAGGG - Intronic
1184334150 22:43843596-43843618 CCACCATGCCTAGCCAATGAGGG + Intronic
1184437072 22:44485610-44485632 CCATCGTGCCTGGCCAGAGCTGG + Intergenic
1184496202 22:44843089-44843111 CTTCCGTGCCTGTCCACAGCTGG - Intronic
1184563982 22:45280340-45280362 CCACCGTGCCTGGCCTCAGCAGG - Intergenic
1184578870 22:45398540-45398562 CCACCATGCCCGGCCGATGCAGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1185155371 22:49190562-49190584 CCACCATGCCCGGCCAAACTGGG + Intergenic
949540745 3:5030333-5030355 CTATCTTGCCTGGCCAAAGTGGG + Intergenic
949551307 3:5114612-5114634 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
949976609 3:9466735-9466757 CCACCATGCCCAGCCTAAGCTGG - Intronic
950128787 3:10527737-10527759 CTCCCATACCTGGCCAGAGATGG + Intronic
950150608 3:10684117-10684139 CTACCATGATTGGCCAGACCTGG - Intronic
951215590 3:20021895-20021917 CCACCATGCCTGGCCTCAGTTGG - Intergenic
952481886 3:33770109-33770131 CCACCATGCCCGGCCACATCTGG + Intergenic
953440923 3:42916649-42916671 CTACCACGCCTGGCCAATCCAGG + Exonic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
954007716 3:47605482-47605504 CCACCATGCCCGGCCACATCTGG - Intronic
954071801 3:48148437-48148459 CTACCATGCCCGGCCAAGAAAGG - Intergenic
954087320 3:48255774-48255796 CCACCATGCCTGGCCAGAGACGG + Intronic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954473696 3:50723058-50723080 CCACCATGCCTGGCCTCAGATGG + Intronic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
954680902 3:52345442-52345464 AGACCCTGCCTGGCCAAACCAGG - Intronic
955727466 3:61948410-61948432 GAACAATGCCTGGCCATAGCAGG - Intronic
955940478 3:64142596-64142618 CCACCACGCCTGGCCCATGCAGG + Intronic
956130295 3:66046902-66046924 CCAGCATACCTGGCCACAGCTGG + Intergenic
956213460 3:66825259-66825281 CCACTGTGCCTGGCCCAAGCAGG + Intergenic
956636254 3:71368412-71368434 CCACCATGCCTGGCCTTAGTTGG + Intronic
956756939 3:72398044-72398066 CCACCATGCCCGGCCATAGGAGG - Intronic
957035292 3:75288747-75288769 CTCTGATGCCTAGCCAAAGCTGG + Intergenic
957137506 3:76308089-76308111 CCACCATGCCCAGCCAAAGTAGG - Intronic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958006887 3:87823672-87823694 CCACCATGCCCGGCCAAGGCTGG + Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959689674 3:109185280-109185302 TGACCATGCCTGGCCAATGAGGG - Intergenic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
961103679 3:124222890-124222912 CTACCATGCCTGGCCTCACCTGG + Intronic
961540531 3:127596364-127596386 CCACCATGCCTGGCCATCCCAGG + Intronic
961982907 3:131100307-131100329 CCATCATGCCTGGCCCAAGTAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964218031 3:154310493-154310515 CCACCATGCCCGGCCTAAGTGGG - Intronic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965842454 3:172922631-172922653 CTACCATGCCTGGCCAGGCCTGG - Intronic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966669055 3:182506451-182506473 CCACCATGCCTAGCCTAAGTAGG + Intergenic
967160860 3:186736761-186736783 CTACCACGCCTGGCCTCAACTGG - Intronic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
969233021 4:5845036-5845058 GTGCTATGCCTGGCCAAAGATGG + Intronic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972563733 4:40251048-40251070 CCACCACGCCCGGCCGAAGCTGG - Intergenic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
973214635 4:47655328-47655350 GTACCAGGCTTGGCCACAGCGGG + Intronic
973946448 4:55961475-55961497 CCACCGTGCCCGGCCAAAGATGG - Intronic
974604458 4:64132961-64132983 TTACCATGCCTGGCCAACTGTGG - Intergenic
976945937 4:90767938-90767960 CCACCATGCCTGACCAAACAAGG + Intronic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
977939906 4:102846929-102846951 CTACCATGCCTAGCCCCAGCCGG + Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978529164 4:109697071-109697093 CCACCATGCCCGGCCAACTCAGG + Intronic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978964399 4:114724168-114724190 CCACCACGCCTGGCCGGAGCAGG + Intergenic
979059710 4:116042661-116042683 CCACCATGCCCAGCCAAAGCTGG + Intergenic
979292227 4:118990895-118990917 CCACCATGCCCGGCCTAAGCTGG + Intronic
980131590 4:128821367-128821389 CAACCATGCCTTGCCATAGGTGG + Intronic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
980997765 4:139797043-139797065 TCAACATGCCTGGCCAGAGCAGG + Intronic
981511654 4:145565030-145565052 CCACTATGCCTGGCCAAATTTGG - Intergenic
981677316 4:147357314-147357336 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
982052997 4:151522011-151522033 CTACCATGCCTGGCTGATGTTGG + Intronic
982443663 4:155465109-155465131 CTACCAAGCCTGGTGATAGCTGG - Intergenic
982465114 4:155720974-155720996 TCACCTTGCCTAGCCAAAGCAGG - Intronic
982860986 4:160448753-160448775 CCACCAAGCATGGCAAAAGCAGG + Intergenic
983214901 4:164993598-164993620 CCACCATGCCCGGCCAGAGATGG + Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
984890344 4:184486473-184486495 CCACCACGCCTGGCCGAGGCAGG - Intergenic
985510713 5:311970-311992 CCACCATGCCTGGCCAACTATGG + Intronic
986219661 5:5756497-5756519 CCTCCATGCCTGGCCAAACACGG + Intergenic
986352749 5:6895579-6895601 CTACTGTGCCTGGCCAAATTAGG + Intergenic
986370341 5:7073972-7073994 CCACCATGCCCGGCCAGGGCTGG - Intergenic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988402893 5:30784726-30784748 CCACCATGCCTGGCCCACGGAGG - Intergenic
988447339 5:31302433-31302455 CCACCATGCCCGGCCAGAACTGG - Intronic
988596044 5:32591983-32592005 CCACCATGCCTTGCCAAAGTTGG + Intronic
990303599 5:54473360-54473382 CCACCACGCCTGGCCACACCTGG + Intergenic
990326751 5:54684553-54684575 CTACCATGCCTGGCCACTGTAGG + Intergenic
990332906 5:54745160-54745182 CCACCATGCCTGGCCAGACTAGG + Intergenic
990694435 5:58400137-58400159 CTACCAGGCATTCCCAAAGCAGG + Intergenic
991073981 5:62514549-62514571 CTCTCATGCCGGGCCAAAGCTGG - Intronic
992315349 5:75546952-75546974 CCACCACGCCTGGCCACAGATGG + Intronic
992814135 5:80419363-80419385 CAACCATGCCTGGCCATTTCTGG + Intronic
993638814 5:90377922-90377944 CTACCATGCCTGGCCAAGTACGG + Intergenic
993710893 5:91223684-91223706 CTACTGTGCCTGGCCACATCAGG + Intergenic
994688200 5:102983156-102983178 CCACCATGCCTGGCCTTACCGGG - Intronic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995517034 5:112964476-112964498 CCACCATGGCTGGCCAAGGCTGG - Intergenic
995972052 5:117984359-117984381 CCACCATGCCTGGCCATATATGG + Intergenic
996743910 5:126828845-126828867 CCACCATGCCCGGCCAAGGTTGG + Intronic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997315899 5:132935481-132935503 CCACCATGTCTGGCCACACCCGG - Intronic
997394834 5:133550958-133550980 TTACGATGCCTGCCCCAAGCTGG + Intronic
997594793 5:135099850-135099872 CTGCCATGCCTGGCCCCAACTGG - Intronic
997613545 5:135231387-135231409 CCACCCTGCCTGGCCTACGCTGG - Intronic
997802032 5:136873306-136873328 CTACCACGCCTGGCCGAGACAGG - Intergenic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
999218903 5:149958957-149958979 CCACCATGCCCGGCCAAATTTGG + Intergenic
999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG + Intergenic
1000139745 5:158390606-158390628 ATACCATGCCTGGCCTACACTGG + Intergenic
1000638754 5:163675873-163675895 CCACCATGCCTGGCCCCAGATGG - Intergenic
1000971263 5:167717241-167717263 CTACCATGCCCGGCCAACTTTGG + Intronic
1001872623 5:175170011-175170033 CCACCACGCCCGGCCAAAGAAGG + Intergenic
1002399005 5:178980919-178980941 CCACCATGCCTGGCCAAGGTTGG + Exonic
1002919011 6:1552798-1552820 CTACCATGCCTGGCCTGCCCTGG - Intergenic
1002922427 6:1581947-1581969 CCACCGTGCCTGGCCAACGTGGG - Intergenic
1002981398 6:2142222-2142244 CAACAATACCTGGCAAAAGCGGG + Intronic
1003384012 6:5650762-5650784 CCACCCTGCCTGGCCAAAGTGGG + Intronic
1003944511 6:11061836-11061858 CCACCATGCCCAGCCAAAGAAGG - Intergenic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004701059 6:18079894-18079916 CCACCATGCCTGGCCTAAGGAGG + Intergenic
1004727707 6:18326973-18326995 CCACCGCGCCAGGCCAAAGCGGG + Intergenic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1005644876 6:27828433-27828455 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1005837038 6:29717936-29717958 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1005934127 6:30506999-30507021 CCACCGTGCCCGGCCAAGGCAGG + Intergenic
1006142538 6:31938938-31938960 CCACCATGCCCGGCCACACCTGG + Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1006567997 6:34975848-34975870 TCACCATGCCTGGTCAAAGGAGG - Intronic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007070022 6:39029596-39029618 CTACCATGCCTGGCCTCTGGGGG + Intronic
1007587386 6:42999846-42999868 CCACCATGCCTGGCCATTGGTGG + Intronic
1007611907 6:43155123-43155145 ATAACAGGGCTGGCCAAAGCAGG - Intronic
1008277253 6:49555891-49555913 CCACCATGCCTGGCCAAGTGTGG + Intronic
1008484443 6:52020230-52020252 CTACCATGGCTGTGCACAGCTGG - Intronic
1008624911 6:53306161-53306183 CTCTCATGCCGAGCCAAAGCTGG - Intronic
1008790993 6:55233376-55233398 CCACCACGCATGGCCAAAGCTGG + Intronic
1008926779 6:56895974-56895996 CTCTCATGCCGAGCCAAAGCTGG - Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010039944 6:71369394-71369416 CCACCACGCCCGGCCAAAGGTGG + Intergenic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011549599 6:88518271-88518293 CTTCCATGACTTTCCAAAGCTGG + Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011690385 6:89861695-89861717 CCACCACATCTGGCCAAAGCTGG + Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1011695190 6:89906158-89906180 CCACCGTGCCCGGCCAAAGTTGG + Intergenic
1013100985 6:106986638-106986660 CCACCATGCCTGGCCACACTTGG - Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014995208 6:128134656-128134678 CCACCATGCCTGGCTAATGTTGG - Intronic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1015556223 6:134464166-134464188 CTACCATGCCCAGCCTAATCTGG - Intergenic
1016158589 6:140846151-140846173 CCACCATGCCTGGCTAATGTTGG - Intergenic
1016324859 6:142889183-142889205 CCACCATGCATGGCCACATCAGG - Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017262430 6:152402593-152402615 CTCCCATGCCTGCCAAATGCAGG + Intronic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1018864684 6:167737391-167737413 CTCCCAAGCCTGGCCACTGCAGG + Intergenic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019082484 6:169444507-169444529 CCACCAGGGCTGGCCAGAGCCGG + Intergenic
1019855366 7:3600833-3600855 CCACCGTGCCTGGCCAATGTAGG + Intronic
1020002778 7:4765222-4765244 GTACCATGCCTGGCTCATGCCGG + Exonic
1020072966 7:5239612-5239634 CCACCATGCCCGGCCACACCTGG - Intergenic
1020185410 7:5955459-5955481 CCACCACGCCTGGCCAACCCTGG - Intronic
1020266954 7:6567180-6567202 CCACCATGCCTGGCCATGCCTGG - Intergenic
1020297504 7:6769290-6769312 CCACCACGCCTGGCCAACCCTGG + Intronic
1020522224 7:9205802-9205824 CTACCATTCTTGGACAAAGTGGG + Intergenic
1021054995 7:16036130-16036152 CCACCGTGCCTGCCCAAGGCAGG - Intergenic
1021083250 7:16388251-16388273 CAACCATGCCCAGCCAAAGTTGG + Intronic
1021674815 7:23069459-23069481 CCACCGCGCCTGGCCATAGCTGG - Intergenic
1021941198 7:25680424-25680446 CCACCACGCCTGGCCACACCTGG + Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022457826 7:30574397-30574419 CAACAGTGCCTTGCCAAAGCTGG + Intergenic
1023011056 7:35925101-35925123 CCACTGTGCCTGGCCAGAGCTGG - Intergenic
1023044028 7:36196450-36196472 CTCTCATGCCGGGCCAAAGCTGG + Intronic
1023060715 7:36323313-36323335 CCACCATGCCTGGCCTCAGAGGG - Intergenic
1023175963 7:37435823-37435845 CTACCATCCTTAGCCACAGCTGG + Intronic
1024333610 7:48180712-48180734 CCACCATGCGTGGCCGATGCTGG + Intronic
1024334432 7:48191693-48191715 CCACCGTGCCCGGCCAAAGAGGG + Intronic
1024608478 7:51042647-51042669 CCACCATGCCAGGCCAAACGTGG + Intronic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026125873 7:67579055-67579077 CCATCATGCCCGGCCAAAACTGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027112262 7:75449652-75449674 CTACCATGCCCGGCAACAGTAGG + Intronic
1027284495 7:76634194-76634216 CTACCATGCCCGGCAACAGTAGG + Intergenic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029292889 7:99516128-99516150 CCACCACGCCTGGCCACATCTGG + Intronic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029383069 7:100225893-100225915 CCACCGCGCCTGGCCAAGGCAGG + Intronic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029631385 7:101752980-101753002 CCACCATGCCTGGCCCAGGGTGG + Intergenic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030637784 7:111969561-111969583 CTACCATGCCTGTCCTTTGCAGG - Intronic
1030990056 7:116288745-116288767 CCACCGCGCCTGGCCAAATCAGG + Intronic
1032561373 7:132897004-132897026 CTACCATCACTGGTAAAAGCAGG + Intronic
1033130002 7:138737732-138737754 CTACCATGCCTGGCTAATTTTGG + Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034261520 7:149759607-149759629 CTACCATGTCTGCACAAGGCTGG + Intergenic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034624799 7:152484405-152484427 CCACCATGCCCGGCCTAAGAAGG + Intergenic
1034865942 7:154642303-154642325 CCACCATGCCAGGCCAAAGTGGG - Intronic
1035422053 7:158737977-158737999 CCACCATGACTGGCCTAATCAGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036399484 8:8395511-8395533 CCACCATGCCTGGCCATGTCTGG - Intergenic
1036439578 8:8768615-8768637 CCACCATGCCTGGCCTATTCTGG + Intergenic
1037602046 8:20405469-20405491 CTACCATGCCAGGCCATGGCTGG - Intergenic
1037688118 8:21161050-21161072 CTTACATGCCTGCCCACAGCTGG + Intergenic
1037794365 8:21979330-21979352 CCACCACACCTGGCCAAAGCTGG + Intronic
1037902927 8:22698292-22698314 CCACAAGGCCTGGCCAAGGCAGG - Intergenic
1038471885 8:27831024-27831046 TTACCATGCCTGGCCTAGGATGG - Intronic
1038508230 8:28105092-28105114 CCACCATGTCTGGCCAAGCCTGG - Intronic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039339104 8:36627224-36627246 CCACCATGCCTGGAAACAGCTGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039925439 8:41927497-41927519 CCACCATGCCTGGCCATGTCTGG - Intergenic
1040367947 8:46738865-46738887 CCACCATGCCTGGCCTCAGTTGG + Intergenic
1040432292 8:47355241-47355263 CCACCATGCCTGGCCGATGAAGG + Intronic
1040464708 8:47683837-47683859 CCACCATGCCCGGCCAAATTGGG - Intronic
1040513815 8:48118253-48118275 CTACCATGCCTGGCCAGCACTGG + Intergenic
1040767359 8:50928983-50929005 CCACCGCGCCTGGCCAAGGCTGG + Intergenic
1041010892 8:53542409-53542431 CTACCATGTGAGGACAAAGCAGG + Intergenic
1041268781 8:56090167-56090189 CTACCACACCTGACCAAACCAGG - Intergenic
1041357890 8:57021272-57021294 CTCTCATGCCGGGCCAAAGCTGG + Intergenic
1042222526 8:66487401-66487423 CTACCGTGCCTGGCCACAGTGGG - Intronic
1042381355 8:68118066-68118088 CCACCACGCCCGGCCAAAGATGG - Intronic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1043232808 8:77823824-77823846 CTAACATCCCTGGACAAAGTGGG - Intergenic
1043488326 8:80720898-80720920 CTGCCATGCCTGGGCCAGGCAGG + Intronic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044659642 8:94582484-94582506 CCACCACGCCTGGCCACACCTGG + Intergenic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045282439 8:100760816-100760838 CTACCACGCCTGGCCCTACCTGG - Intergenic
1045520793 8:102901259-102901281 CCACCATGCCTGGCCATGTCTGG - Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046095368 8:109552806-109552828 CTACCATGCCTAGCCAAGTCTGG - Intronic
1047078119 8:121427637-121427659 CTAGCAAGCCTGCCCCAAGCGGG + Intergenic
1047117363 8:121858899-121858921 GTTCCAGGCCTGGGCAAAGCAGG + Intergenic
1047424681 8:124734438-124734460 CCACCATGCCCGGCCACACCTGG - Intergenic
1048292591 8:133191995-133192017 TCACCATGCCTGGCCCTAGCAGG - Intronic
1048854296 8:138673494-138673516 CCACCATGCCCGGCCCCAGCCGG + Intronic
1049523185 8:143105434-143105456 CCACCATGCCTGGCCAGGCCAGG + Intergenic
1049704422 8:144034136-144034158 CTGCCTTCCCTGGCCAATGCTGG - Intronic
1049949289 9:628789-628811 CCACCATGCCCGGCCCAAGATGG - Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050353681 9:4763397-4763419 CTATCAGGCCAGGCCAGAGCTGG + Intergenic
1050452420 9:5797360-5797382 CCACCACGCCCGGCCAAAGCTGG - Intronic
1050557907 9:6806205-6806227 CCACCATGCCTGGCCAATTTGGG - Intronic
1050765571 9:9129235-9129257 CTACCATGCCTGGCTAATTTTGG - Intronic
1051214099 9:14778362-14778384 GTACCTTGGCTGGCCAAGGCGGG + Intronic
1051400431 9:16675777-16675799 CCACCGAGCCCGGCCAAAGCTGG - Intronic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051669416 9:19494913-19494935 CCACCATGCCCGGCCAATGTGGG + Intergenic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052702072 9:31949780-31949802 CTTACATGCATGGCCAGAGCAGG + Intergenic
1052805584 9:33010430-33010452 CCACCACGCCTGGCGAACGCAGG - Intronic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053624153 9:39851734-39851756 CCACCACGCCTGGCCATTGCAGG + Intergenic
1053880713 9:42591494-42591516 CCACCACGCCTGGCCATTGCAGG - Intergenic
1054219744 9:62398964-62398986 CCACCACGCCTGGCCATTGCAGG - Intergenic
1054230971 9:62510209-62510231 CCACCACGCCTGGCCATTGCAGG + Intergenic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055892753 9:81141056-81141078 CCACCATGCCTGGCCATGCCTGG - Intergenic
1056557364 9:87700786-87700808 CCACCATGCCTGGCCAATTTTGG + Intronic
1056632062 9:88302127-88302149 CCACCATGCCTGGCCACTGTGGG - Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057454436 9:95194910-95194932 CCACCAAGCCTGGCCAAACTAGG - Intronic
1057847719 9:98538463-98538485 CAGCCATGCTTGGCCAAAGTGGG + Intronic
1058255662 9:102759651-102759673 CCACCATGCCTGGCCCAATGTGG - Intergenic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1058910614 9:109517093-109517115 TTACTTTGCCTGGCCATAGCTGG + Intergenic
1059536256 9:115083890-115083912 CCACCATGCCCGGCCAAATGAGG + Intronic
1060526763 9:124325303-124325325 CCACCATGCCGGGCCTAAGAGGG - Intronic
1060732135 9:126045486-126045508 CCACCGTGCCTGGCCACAGATGG - Intergenic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1061033738 9:128102152-128102174 CTTCCATGCCTGATCAGAGCGGG + Intronic
1061081630 9:128374337-128374359 CAACCAAGACTGGCCAAACCTGG - Intronic
1061154604 9:128850171-128850193 CCACCATGCCTGGCCAGCCCAGG + Intronic
1061331809 9:129899363-129899385 CCACCATGCCCGGCCAGATCTGG + Intronic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061407678 9:130401608-130401630 CCACCATGCCTGGCCTAACATGG + Intronic
1061571556 9:131480881-131480903 CCACCACTCCTGGCCAAAGTTGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1062021380 9:134321009-134321031 CAACCTCGCCTGGCCTAAGCAGG - Intronic
1062414164 9:136439533-136439555 CGACCATCCCCGGCCCAAGCGGG - Exonic
1062420010 9:136476111-136476133 GCACCATGCCTGGGCACAGCTGG + Exonic
1062472134 9:136710910-136710932 CCACCGTGCCTGGCCACACCAGG - Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187379257 X:18785593-18785615 CTACCATGCCTGGCTGCAACTGG - Intronic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1189035439 X:37490107-37490129 CTGCCATACCTGGCCAATGAGGG + Intronic
1189102401 X:38204989-38205011 CTACCATGCTTTTCCAAACCAGG - Intronic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189895469 X:45651224-45651246 CCACCACGCCTGGCCCAAGTAGG - Intergenic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1189986273 X:46556254-46556276 CCACCATGCCTGGCCTGAGATGG - Intergenic
1190168323 X:48091730-48091752 CCACCATGCCTGGCCCAAGATGG - Intergenic
1190168920 X:48095955-48095977 CCACCATGCCTGGCCCAAGATGG + Intergenic
1190169402 X:48099981-48100003 CCACCATGCCCAGCCAATGCTGG + Intergenic
1190312733 X:49128534-49128556 CCACCATGCCCAGCCAAGGCAGG - Intergenic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1191744236 X:64468207-64468229 CCACCATGCTTGGCCAAGGATGG - Intergenic
1192106833 X:68325904-68325926 CTCTCATGCCGAGCCAAAGCTGG + Intronic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192431577 X:71115994-71116016 CCACCATGCCTGGCCCACTCTGG + Intergenic
1193188855 X:78545468-78545490 CTACCAGGCCTTGACAGAGCAGG - Intergenic
1194018496 X:88657249-88657271 CTATCATGCCTGGACAGAGCAGG + Intergenic
1195067751 X:101252900-101252922 TCACCAGGCCTGGCCACAGCTGG + Intronic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1197119680 X:122875663-122875685 CTACCAGGCCTAAGCAAAGCTGG + Intergenic
1197193064 X:123670329-123670351 CCACCATGCCCAGCCAAGGCAGG - Intronic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197296370 X:124723884-124723906 CAACCATGCCCGGCCGAAGCTGG + Intronic
1197974808 X:132155467-132155489 CCACCATGCCTGGCCAATTTAGG + Intergenic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198332480 X:135634391-135634413 GTACCATGCCTGGGCATAGTTGG + Intergenic
1198333420 X:135643459-135643481 GTACCATGCCTGGGCATAGTTGG - Intergenic
1198402966 X:136285363-136285385 CCACCACGCCTGGCCAAGGATGG - Intergenic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198532403 X:137559573-137559595 CCACCATGCCTGGCCCACCCTGG + Intergenic
1199067005 X:143431319-143431341 CTACCAAGCCTGGTGATAGCTGG + Intergenic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic
1202575956 Y:26324995-26325017 CTACCATACCTGGCCAAGAAGGG + Intergenic