ID: 1011691338

View in Genome Browser
Species Human (GRCh38)
Location 6:89872228-89872250
Sequence ATGTTTTAAGAGATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1995
Summary {0: 1, 1: 1, 2: 12, 3: 167, 4: 1814}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011691333_1011691338 12 Left 1011691333 6:89872193-89872215 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG 0: 1
1: 1
2: 12
3: 167
4: 1814
1011691336_1011691338 8 Left 1011691336 6:89872197-89872219 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG 0: 1
1: 1
2: 12
3: 167
4: 1814
1011691335_1011691338 9 Left 1011691335 6:89872196-89872218 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG 0: 1
1: 1
2: 12
3: 167
4: 1814
1011691331_1011691338 18 Left 1011691331 6:89872187-89872209 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG 0: 1
1: 1
2: 12
3: 167
4: 1814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011691338 Original CRISPR ATGTTTTAAGAGATGGAGTC AGG Intronic
900108205 1:994769-994791 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
901302127 1:8207431-8207453 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
901316012 1:8309029-8309051 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
901352222 1:8607735-8607757 TTTTTTTTTGAGATGGAGTCTGG + Intronic
901710947 1:11114577-11114599 ATGTCTTAGGAGAAGGAATCAGG + Intronic
901719164 1:11181511-11181533 ATTTATTTTGAGATGGAGTCTGG - Intronic
901805185 1:11734296-11734318 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
901840966 1:11953779-11953801 TTTTTTTTTGAGATGGAGTCTGG - Intronic
902097468 1:13958560-13958582 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
902319662 1:15652352-15652374 TTGTATTAAGAGATGGGGTTTGG - Intronic
902354970 1:15891361-15891383 TTTTTTTTTGAGATGGAGTCTGG + Intronic
902525608 1:17055157-17055179 TTATTTGTAGAGATGGAGTCTGG + Intergenic
902603766 1:17557329-17557351 TTTTTTTTTGAGATGGAGTCTGG - Intronic
902897553 1:19489396-19489418 ATTTTTTTTGAGACGGAGTCTGG + Intergenic
903080147 1:20804203-20804225 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
903484609 1:23680417-23680439 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
903603778 1:24560147-24560169 TTTTTTTTTGAGATGGAGTCTGG - Intronic
903866559 1:26402839-26402861 TTGTTTTTAGAGATGAGGTCTGG - Intergenic
903870519 1:26431106-26431128 ATTTATTTAGAGACGGAGTCTGG - Intergenic
903901589 1:26650110-26650132 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
903955864 1:27025156-27025178 ATTTATTTTGAGATGGAGTCTGG + Intergenic
903976873 1:27155925-27155947 ATTTTTTTTGAGATAGAGTCTGG + Intronic
903991861 1:27277472-27277494 TTTTTTTAAGAGACGGAGTCTGG + Intronic
904060144 1:27702636-27702658 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
904136266 1:28314974-28314996 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
904145636 1:28388836-28388858 TTTTTTTTTGAGATGGAGTCTGG - Intronic
904166338 1:28558226-28558248 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904186553 1:28709584-28709606 AATTTTTTTGAGATGGAGTCTGG + Intronic
904277552 1:29394286-29394308 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
904399357 1:30245705-30245727 TTGTTGTTTGAGATGGAGTCTGG - Intergenic
904513370 1:31033216-31033238 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904536881 1:31205318-31205340 TTGTTTTTTGAGACGGAGTCTGG + Intronic
904655337 1:32041599-32041621 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904661408 1:32088112-32088134 TTTTTTTTGGAGATGGAGTCTGG - Intronic
904661459 1:32088403-32088425 ATTTTTTTTGAGACGGAGTCTGG - Intronic
904737816 1:32648668-32648690 TTTTTTTTTGAGATGGAGTCTGG + Intronic
904765654 1:32844486-32844508 AATTTTTATGAGATGGGGTCTGG + Intronic
904779485 1:32934667-32934689 ATGTATTTAGAGACGGAGTCTGG - Intergenic
904787118 1:32991541-32991563 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
904800703 1:33091249-33091271 CTATTTTTTGAGATGGAGTCTGG + Intronic
904904976 1:33890240-33890262 TTTTTTTTTGAGATGGAGTCTGG + Intronic
905144017 1:35872484-35872506 ATGATTAAAGAAATTGAGTCGGG - Intronic
905432564 1:37935187-37935209 TTTTTTTTTGAGATGGAGTCTGG - Intronic
905561027 1:38927413-38927435 TTTTTTTTTGAGATGGAGTCTGG - Intronic
905592142 1:39173325-39173347 TTTTTTTTTGAGATGGAGTCTGG - Intronic
905700787 1:40012080-40012102 ATTTTATTTGAGATGGAGTCTGG + Intergenic
905816762 1:40957322-40957344 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
905878328 1:41447786-41447808 AGCTTGTAAGAGATGGAGGCAGG + Intergenic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
906349158 1:45042540-45042562 ATGGTGTGAGAGATGGAGGCAGG + Intronic
906408355 1:45559997-45560019 TTTTTTTTTGAGATGGAGTCTGG + Intronic
906681053 1:47725606-47725628 ATCTATACAGAGATGGAGTCAGG - Intergenic
907002143 1:50872051-50872073 TTTTTTTTTGAGATGGAGTCTGG - Intronic
907204147 1:52754035-52754057 TTTTTTTTTGAGATGGAGTCTGG + Intronic
907449370 1:54533629-54533651 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
908093984 1:60717858-60717880 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
908410907 1:63864189-63864211 AGCTATTAAGAGATGGAGGCAGG + Intronic
908449072 1:64233017-64233039 TTTTTTTTCGAGATGGAGTCTGG + Intronic
908816707 1:68042637-68042659 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
908991435 1:70095986-70096008 TTGTTTTTTGAGATGGAGTCTGG + Intronic
909135874 1:71799722-71799744 TTTTTTTTTGAGATGGAGTCTGG + Intronic
909314856 1:74203398-74203420 TTTTTTTTTGAGATGGAGTCTGG + Intronic
909480142 1:76121702-76121724 TTGTTTTTTGAGATGGAGTCTGG - Intronic
909783661 1:79582690-79582712 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
909905700 1:81191920-81191942 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
910007052 1:82410785-82410807 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
910257735 1:85265038-85265060 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
910514716 1:88046973-88046995 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
910832890 1:91478257-91478279 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
910886067 1:91964919-91964941 TTTTTTTTTGAGATGGAGTCTGG + Intronic
910967789 1:92824895-92824917 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911035413 1:93539938-93539960 ATGTTTTAAGAGAAGGTGTTGGG - Intronic
911315387 1:96350458-96350480 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911519511 1:98911757-98911779 TTTTTTTTAGAGATGGGGTCAGG + Intronic
911597488 1:99813695-99813717 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911723714 1:101219382-101219404 ATGTTTAAAGAGATTGACTGAGG - Intergenic
911827053 1:102499758-102499780 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
911868805 1:103064676-103064698 TTTTTTTTTGAGATGGAGTCTGG - Intronic
912133977 1:106636771-106636793 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
912171719 1:107108470-107108492 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
912340375 1:108908706-108908728 TTGTGTTTTGAGATGGAGTCTGG - Intronic
912402466 1:109406653-109406675 TTTTTTTAAGAGATGAGGTCTGG - Intronic
912402845 1:109409869-109409891 TTTTTTTAAGAGATGAGGTCTGG - Intronic
912402995 1:109411630-109411652 TTTTTTAAAGAGATGGGGTCTGG + Intronic
912599548 1:110914739-110914761 ATTTTTTTAGAGACGGATTCTGG - Intergenic
912815237 1:112823500-112823522 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
912834053 1:112979811-112979833 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
912911251 1:113760611-113760633 TTTTTTTAAGAGACGGGGTCTGG - Intergenic
913273872 1:117119594-117119616 TTTTTTTCTGAGATGGAGTCTGG - Intronic
913970252 1:143409570-143409592 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914064627 1:144235166-144235188 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914097251 1:144554442-144554464 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914114523 1:144731188-144731210 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
914301742 1:146383171-146383193 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
914371171 1:147025572-147025594 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
914689744 1:150015303-150015325 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
914763159 1:150615416-150615438 CTTTTTTAAGAGATGGGGTTTGG + Intronic
914791921 1:150885878-150885900 TTTTTTTGTGAGATGGAGTCTGG + Intergenic
914798384 1:150940984-150941006 TTTTTTTTTGAGATGGAGTCTGG - Intronic
914799245 1:150948280-150948302 TTTTTTTTTGAGATGGAGTCTGG + Intronic
914841540 1:151253156-151253178 TTTTTTTCAGAGATGGGGTCTGG + Intergenic
914891935 1:151632881-151632903 ATTTTTTTTGAGACGGAGTCTGG + Intronic
915059541 1:153169551-153169573 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
915254058 1:154612337-154612359 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915256158 1:154630999-154631021 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
915272721 1:154766689-154766711 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915295673 1:154919868-154919890 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915395840 1:155583360-155583382 ATTTTTATAGAGATGGGGTCTGG - Intergenic
915398918 1:155608509-155608531 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915411445 1:155703968-155703990 ATTTTTACAGAGATGGGGTCTGG - Intronic
915433576 1:155886142-155886164 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915485829 1:156219973-156219995 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915493083 1:156262462-156262484 TTTTTTTCTGAGATGGAGTCTGG - Intronic
915566831 1:156719180-156719202 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
915569157 1:156734541-156734563 TTTTTTTTTGAGATGGAGTCTGG + Intronic
915582941 1:156826310-156826332 TTTTTTTCTGAGATGGAGTCTGG + Intronic
915602047 1:156928580-156928602 TTTTTTTGGGAGATGGAGTCTGG + Intronic
915742840 1:158132477-158132499 ATGTCTAAAGAGAAAGAGTCTGG + Intergenic
915757206 1:158273685-158273707 ATCTTTTAAAAGATGGAGCCAGG - Intergenic
915924607 1:160006267-160006289 ATTTTTGTAGAGATGGAGTCTGG + Intergenic
916018792 1:160775365-160775387 ATGATTGAAGATCTGGAGTCAGG + Intergenic
916048055 1:161015384-161015406 TTTTTTTTTGAGATGGAGTCTGG - Intronic
916255530 1:162783671-162783693 ATTTATTAAGAAATGAAGTCAGG + Exonic
916265862 1:162889227-162889249 AGTTTGTAAGTGATGGAGTCAGG + Intergenic
916499997 1:165378446-165378468 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
916859351 1:168786326-168786348 TTTTTTTAAGAGATGGGGGCCGG - Intergenic
916980239 1:170128289-170128311 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
917125965 1:171687740-171687762 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
917436438 1:175025847-175025869 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
917624302 1:176830189-176830211 ATTTTTTAAGAGATGGGGTCTGG - Intronic
917624398 1:176831097-176831119 TTGTTTTAGGACATGGAGTTGGG + Intronic
917796333 1:178535288-178535310 TTTTTTTTTGAGATGGAGTCTGG - Intronic
917814763 1:178696672-178696694 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
917868122 1:179217300-179217322 TTTTTTTTTGAGATGGAGTCTGG - Intronic
917875344 1:179281864-179281886 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
917927044 1:179798208-179798230 TTTTTTTTTGAGATGGAGTCTGG - Intronic
918206300 1:182312469-182312491 GTTTTTTATGAGATGGTGTCTGG + Intergenic
918307034 1:183256395-183256417 ATTTTTTTTGAGATGGAGTCTGG - Intronic
918445446 1:184612667-184612689 TTGTTTTTTGAGATGGAGCCTGG - Intronic
918636556 1:186781593-186781615 AAATTATTAGAGATGGAGTCTGG + Intergenic
918650717 1:186959188-186959210 TTTTTTTTTGAGATGGAGTCTGG - Intronic
918708305 1:187696183-187696205 ATGTTTATGGAGATGGATTCTGG + Intergenic
918767860 1:188511716-188511738 ATATTTGAAGAGATGTATTCTGG - Intergenic
918800392 1:188962977-188962999 TTATTTTTTGAGATGGAGTCCGG - Intergenic
918806884 1:189059335-189059357 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
919140482 1:193565135-193565157 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
919406411 1:197189928-197189950 GTTTTTTTTGAGATGGAGTCTGG + Intronic
919636730 1:200010361-200010383 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
919697325 1:200591013-200591035 TTTTTTTTTGAGATGGAGTCTGG - Intronic
919781720 1:201225579-201225601 TTGTTTTTTGAGACGGAGTCTGG - Intronic
919885269 1:201929112-201929134 ATTTATTTAGAGACGGAGTCTGG + Intronic
920122522 1:203669445-203669467 CTGTTTTTTGAGATGGAGTCTGG + Intronic
920125625 1:203691891-203691913 TTTTTTTTTGAGATGGAGTCTGG + Intronic
920126460 1:203697460-203697482 ATGTTCTCAGAGCTGGAGCCTGG + Intronic
920520101 1:206617657-206617679 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
920629742 1:207640128-207640150 TTTTTTTTTGAGATGGAGTCTGG + Intronic
920633787 1:207679006-207679028 TTTTTTTTTGAGATGGAGTCTGG + Intronic
920717205 1:208351442-208351464 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
920867509 1:209765368-209765390 ATGTTTTAAGAAAAACAGTCTGG + Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
922275914 1:224078247-224078269 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
922313697 1:224421750-224421772 TTGTTGTTTGAGATGGAGTCTGG - Intronic
922614394 1:226953039-226953061 TTATTTTTTGAGATGGAGTCTGG + Intronic
922656121 1:227385233-227385255 TTGTTTTTTGAGATGGAGCCTGG - Intergenic
922760723 1:228128745-228128767 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
922881149 1:228981930-228981952 TTTTTTAAAGAGATGGGGTCTGG - Intergenic
922939195 1:229446720-229446742 TTTTTTTTTGAGATGGAGTCTGG - Intronic
922944658 1:229502545-229502567 TTTTTTTTTGAGATGGAGTCTGG - Intronic
923150302 1:231227236-231227258 ATGTTGTGAGAGATGGTGTATGG - Intronic
923169731 1:231403754-231403776 TTTTTTTTTGAGATGGAGTCTGG - Intronic
923536914 1:234859504-234859526 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
923560244 1:235034496-235034518 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
923572852 1:235131495-235131517 TTGTTTTTTGAGATGGAGTTTGG - Exonic
923698317 1:236276812-236276834 ATGTTTTATGATATATAGTCTGG + Intronic
923812220 1:237331512-237331534 CTTTTTTTTGAGATGGAGTCTGG + Intronic
923815665 1:237374887-237374909 ATGTTCTTATGGATGGAGTCAGG + Intronic
924020021 1:239771074-239771096 TTTTTTTTTGAGATGGAGTCTGG - Intronic
924249599 1:242118162-242118184 AGGTTCTAAGTGCTGGAGTCTGG - Intronic
924303323 1:242661927-242661949 TTATTTTTTGAGATGGAGTCTGG - Intergenic
924327692 1:242912124-242912146 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
924421524 1:243914476-243914498 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
924599452 1:245475533-245475555 TATTTGTAAGAGATGGAGTCTGG - Intronic
924605088 1:245527543-245527565 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1062886768 10:1022245-1022267 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1063153174 10:3355136-3355158 CTGCCTTCAGAGATGGAGTCAGG + Intergenic
1063196188 10:3746044-3746066 ATATTTTATGAGAAAGAGTCAGG + Intergenic
1063482436 10:6387739-6387761 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1063512768 10:6662454-6662476 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1063632617 10:7748181-7748203 ATATTTTATGAGATGGAGTCAGG - Intronic
1063732351 10:8712352-8712374 ATGATTTAAGAGATAGAGGGAGG - Intergenic
1063842075 10:10083308-10083330 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1064132792 10:12724866-12724888 GTTTTTTAAGAGATGGGGTCTGG - Intronic
1064202433 10:13296154-13296176 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1064202572 10:13297463-13297485 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1064374505 10:14783475-14783497 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1064517584 10:16167789-16167811 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1064648613 10:17485506-17485528 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1065095519 10:22277048-22277070 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1065134783 10:22656784-22656806 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1065179279 10:23108485-23108507 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1065200325 10:23306515-23306537 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1065291212 10:24231808-24231830 TTTTTTTTTGAGATGGAGTCCGG + Intronic
1065502163 10:26392781-26392803 CTTTTTTTAGAGATGGGGTCTGG + Intergenic
1065587856 10:27237963-27237985 ATTTTTTCGGAGACGGAGTCTGG + Intronic
1065686379 10:28289287-28289309 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1065736752 10:28759944-28759966 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1065823985 10:29552993-29553015 ACTTTTTAAGAGGTGGAGTCTGG + Intronic
1065831294 10:29616730-29616752 ATTTTGTTTGAGATGGAGTCTGG + Intronic
1065895756 10:30162147-30162169 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1065908641 10:30282031-30282053 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1065950674 10:30647856-30647878 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066111702 10:32203208-32203230 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1066210935 10:33237589-33237611 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1066245048 10:33574571-33574593 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066259121 10:33711726-33711748 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066405753 10:35116331-35116353 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066506106 10:36046090-36046112 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1066536309 10:36395925-36395947 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1066631807 10:37465609-37465631 CTATTTTCTGAGATGGAGTCTGG - Intergenic
1066697624 10:38092868-38092890 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1066721993 10:38349329-38349351 ATTTATTAAGAAATGAAGTCAGG + Intergenic
1067151695 10:43740984-43741006 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1067323618 10:45245569-45245591 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1067486876 10:46658732-46658754 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1067537951 10:47128978-47129000 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1067994951 10:51261894-51261916 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1068025607 10:51639423-51639445 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1068064335 10:52109749-52109771 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1068334469 10:55614100-55614122 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1068674649 10:59758507-59758529 TTTTTTTAAGAGATAGGGTCTGG + Intergenic
1068714338 10:60171555-60171577 ATGTGTTGAGTCATGGAGTCAGG + Intronic
1068766146 10:60765842-60765864 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1068905384 10:62316425-62316447 ATGTTTTAAGAGCTAAAGACAGG + Intergenic
1069049249 10:63775284-63775306 TTTTTTTTAGAGATGGGGTCTGG + Intergenic
1069206067 10:65687335-65687357 ATGTTTTGAAAGAGGTAGTCAGG + Intergenic
1069306160 10:66972720-66972742 TTTTTTTATGAAATGGAGTCTGG + Intronic
1069431822 10:68343278-68343300 ATGATTTAGGAGAGGGAGCCGGG + Intronic
1069479969 10:68772744-68772766 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1069502730 10:68968397-68968419 ATGCTTTCAGAGGTGGAGGCAGG - Intronic
1069512764 10:69054404-69054426 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1069687723 10:70329571-70329593 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1069697584 10:70398337-70398359 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1069910004 10:71753126-71753148 ATGTGAAAAGAAATGGAGTCCGG - Intronic
1069972519 10:72184130-72184152 TTATTTTTTGAGATGGAGTCTGG - Intronic
1070061246 10:72984864-72984886 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1070066133 10:73036406-73036428 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1070119256 10:73559714-73559736 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1070462902 10:76687788-76687810 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1070507988 10:77132534-77132556 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1070689709 10:78515537-78515559 TTGTATTAAGCTATGGAGTCTGG - Intergenic
1071013129 10:80962488-80962510 AATTTTTTTGAGATGGAGTCTGG - Intergenic
1071144017 10:82545797-82545819 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1071313288 10:84364751-84364773 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1071534053 10:86412943-86412965 ATTTATTTAGAGACGGAGTCTGG - Intergenic
1071541980 10:86493704-86493726 TTTTTTTAAGAGATGGGGCCAGG + Intronic
1072038883 10:91589378-91589400 ATGTTTGTAGAGGAGGAGTCAGG - Intergenic
1072087900 10:92098781-92098803 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1072133712 10:92522698-92522720 AGCTTTTAAGTGCTGGAGTCAGG - Intronic
1072149288 10:92672633-92672655 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1072328256 10:94319879-94319901 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1072558314 10:96543344-96543366 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1072696414 10:97607090-97607112 TTTTTTTAAGAGATGGGGTCTGG - Intronic
1073304831 10:102494821-102494843 AATTTTTTTGAGATGGAGTCTGG + Intronic
1073329193 10:102659877-102659899 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1073372816 10:103006216-103006238 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1074105224 10:110384270-110384292 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1074133464 10:110606327-110606349 ATATTTTAAGAGATGGTGGGGGG + Intergenic
1074367482 10:112870886-112870908 ATTGTTTTTGAGATGGAGTCTGG - Intergenic
1074686649 10:115968192-115968214 ATGTTTTAAGAGAACCACTCTGG + Intergenic
1074724287 10:116291579-116291601 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1074926314 10:118075940-118075962 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1075143795 10:119866076-119866098 TTTTTTTAAGAGATAGAGCCTGG - Intronic
1075202580 10:120418188-120418210 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1075359575 10:121818243-121818265 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1075379021 10:122003665-122003687 TTCTTTTCTGAGATGGAGTCTGG + Intronic
1075416250 10:122266728-122266750 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1075750152 10:124762087-124762109 ATGTTTTAAGTGATGTATACTGG + Intronic
1076740550 10:132481061-132481083 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1077270003 11:1671588-1671610 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1077511362 11:2965558-2965580 ATTTTTTTTGAGACGGAGTCTGG + Intronic
1077556665 11:3229234-3229256 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1077627718 11:3787977-3787999 ATTTTTTTTGAGATGGACTCTGG - Intronic
1077872910 11:6278595-6278617 ATTTTTTAAGTGGTGGAGTAAGG + Intergenic
1077968069 11:7157320-7157342 ATTTTTTTTGAGATCGAGTCTGG + Intergenic
1077996906 11:7461382-7461404 TTGTTTTTTGAGAGGGAGTCTGG + Intronic
1078019766 11:7646711-7646733 TTATTTTTAGAGATGGGGTCTGG - Intronic
1078172394 11:8938259-8938281 TTATTTTTCGAGATGGAGTCTGG + Intergenic
1078224776 11:9382091-9382113 ATTTTTTTTGAGACGGAGTCTGG + Intergenic
1078379171 11:10824419-10824441 TTTTTTTAAGAGATGGGGTCTGG + Intronic
1078502298 11:11892631-11892653 ATTTTTGTAGAGATGGTGTCTGG - Intronic
1078782973 11:14457229-14457251 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1078964657 11:16324170-16324192 TTGTTTTGAGAGACAGAGTCTGG - Intronic
1079229756 11:18639518-18639540 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1079339960 11:19603618-19603640 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1080601051 11:33820789-33820811 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1080755949 11:35198954-35198976 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1080830711 11:35890984-35891006 ATTTTTTTAGAGATGGTGTCTGG + Intergenic
1080980595 11:37399644-37399666 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1081369182 11:42277496-42277518 TTTTTTTTAGAGATGGAGTCTGG - Intergenic
1081388697 11:42503506-42503528 TGGATTTAAGACATGGAGTCAGG - Intergenic
1081604399 11:44518342-44518364 ACATTTTCAGAGATGGGGTCTGG - Intergenic
1081619784 11:44612642-44612664 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1081636005 11:44722642-44722664 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1081995925 11:47364060-47364082 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1082062540 11:47872952-47872974 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1082098123 11:48147856-48147878 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1082126963 11:48444557-48444579 TTCTTTTTAGAAATGGAGTCTGG + Intergenic
1082694722 11:56347652-56347674 TTTTTTTTTGAGATGGAGTCAGG - Intergenic
1082805624 11:57447766-57447788 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1082904794 11:58294544-58294566 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1083028508 11:59570868-59570890 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1083093750 11:60227537-60227559 ATATATTTTGAGATGGAGTCTGG - Intronic
1083175016 11:60944145-60944167 TTGTTTTTTGAGAGGGAGTCTGG - Intronic
1083221446 11:61255476-61255498 ATGTTTAAAAAAAAGGAGTCCGG - Intergenic
1083277420 11:61604886-61604908 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1083286368 11:61661712-61661734 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1083288766 11:61678395-61678417 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1083422795 11:62564745-62564767 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1083645384 11:64169394-64169416 ATTTATTTAGAGACGGAGTCTGG + Intergenic
1083667372 11:64283235-64283257 CTATTTTTAGAGATGGGGTCTGG + Intronic
1083791841 11:64990800-64990822 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1083929211 11:65830371-65830393 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1083960940 11:66014557-66014579 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1083976794 11:66128870-66128892 TTTTTTTTTGAGATGGAGTCCGG - Intronic
1084134150 11:67162888-67162910 AATTTTTTAGAGATGGGGTCTGG + Intronic
1084202971 11:67574428-67574450 TTTTTTTAAGAGACAGAGTCTGG + Intergenic
1084203788 11:67579068-67579090 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1084217383 11:67656616-67656638 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1084335068 11:68452471-68452493 AATTTTTTTGAGATGGAGTCTGG - Intergenic
1084347912 11:68568779-68568801 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1084874376 11:72119997-72120019 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1085076914 11:73599325-73599347 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1085285075 11:75354290-75354312 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1085287500 11:75373444-75373466 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1085293499 11:75417290-75417312 ATTTTTTAAGAGATGGAGTCTGG - Intronic
1086000166 11:81974289-81974311 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1086130647 11:83398472-83398494 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
1086324141 11:85681345-85681367 ATTATTTAATATATGGAGTCAGG + Intronic
1086349628 11:85932607-85932629 GTTTATTTAGAGATGGAGTCTGG + Intergenic
1086355856 11:85998487-85998509 TTTTTTTAAGAGAAGGGGTCTGG + Intronic
1086536623 11:87854804-87854826 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
1086748582 11:90461871-90461893 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1086989428 11:93287016-93287038 ATGTTTAAAGACCTTGAGTCAGG - Intergenic
1087445284 11:98243182-98243204 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1087633998 11:100682779-100682801 TTTTTCTAAGAGATGGTGTCTGG - Intergenic
1087666245 11:101052516-101052538 ATGTGTTTAGAGATGTAGGCTGG + Intronic
1087787950 11:102375766-102375788 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1087850580 11:103023690-103023712 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1088225134 11:107611691-107611713 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1088460192 11:110074826-110074848 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1089249907 11:117151239-117151261 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1089473465 11:118739455-118739477 TTGTTTTGAGAGATGGAGTCTGG - Intergenic
1089507477 11:118973427-118973449 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1089520835 11:119062098-119062120 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1089767418 11:120777923-120777945 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1089972505 11:122705432-122705454 ATGTTTTTCGAGACAGAGTCTGG - Intronic
1090005834 11:123001602-123001624 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1090035356 11:123245057-123245079 TTGTTGTTTGAGATGGAGTCTGG - Intergenic
1090153983 11:124417296-124417318 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1090386780 11:126361891-126361913 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1090412210 11:126517054-126517076 TTGTTTTTTGAGATGGAGCCTGG - Intronic
1090551187 11:127821687-127821709 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1091240979 11:134052187-134052209 ATTTATTTAGAGATGGAGTCTGG - Intergenic
1091463148 12:661088-661110 TTGTTTTTAGAGATAGGGTCTGG + Intronic
1091466434 12:688822-688844 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1091470330 12:720836-720858 TTTTTTTTTGAGATGGAGTCCGG + Intergenic
1091471217 12:729659-729681 TTCTTTTTAGAGGTGGAGTCTGG - Intergenic
1091734808 12:2911951-2911973 TTTTTTTAAGAGATGGAGGGTGG - Intronic
1092212691 12:6657969-6657991 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1092226420 12:6751227-6751249 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1092251593 12:6901460-6901482 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1092391612 12:8085029-8085051 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1092461869 12:8694219-8694241 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1092736750 12:11589834-11589856 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1092740869 12:11628202-11628224 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1092808317 12:12248491-12248513 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1092933110 12:13336030-13336052 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1093029832 12:14277991-14278013 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093034372 12:14319535-14319557 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093489496 12:19688686-19688708 AAATTGTATGAGATGGAGTCAGG - Intronic
1093546228 12:20352471-20352493 CTTTTTTTCGAGATGGAGTCTGG + Intergenic
1093804066 12:23410482-23410504 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1093966486 12:25332174-25332196 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1094673921 12:32599557-32599579 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1094817399 12:34201545-34201567 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1095212057 12:39506039-39506061 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1095324531 12:40872582-40872604 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1095445100 12:42274845-42274867 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1096279081 12:50236151-50236173 GTTTTTTTTGAGATGGAGTCTGG - Intronic
1096290951 12:50342947-50342969 TTTTTTTTAAAGATGGAGTCAGG + Intronic
1096726963 12:53572053-53572075 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1096852571 12:54450764-54450786 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1097010338 12:55949008-55949030 TTTTTTTTTGAGATGGAGTCCGG - Intronic
1097033852 12:56109111-56109133 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1097113227 12:56678187-56678209 ATTATTTTTGAGATGGAGTCTGG + Intronic
1097238627 12:57557713-57557735 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1097692811 12:62749096-62749118 ATGTTTTAAGAGAAGTAGTAAGG - Intronic
1097878072 12:64661975-64661997 TTTTTTTAAGAGATGGGGGCTGG - Intronic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1098057932 12:66528144-66528166 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1099090190 12:78297272-78297294 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1099121293 12:78692420-78692442 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1099187557 12:79532640-79532662 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1099403496 12:82229389-82229411 ATGAAATAAGAGATGGAGGCAGG - Intronic
1099607123 12:84818311-84818333 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1100129331 12:91471267-91471289 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1100240288 12:92704247-92704269 TTCTTTTTAGAGATGGAGTCTGG - Intronic
1100256548 12:92888563-92888585 TTGTTTTTTTAGATGGAGTCTGG - Intronic
1100281379 12:93121265-93121287 TTTTTTTGTGAGATGGAGTCTGG - Intergenic
1100371242 12:93970815-93970837 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1100631820 12:96397854-96397876 ATGTTTTAAGTGGTGGAGTAGGG + Intronic
1100639994 12:96473216-96473238 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1100765611 12:97862426-97862448 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1100817247 12:98398100-98398122 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1101110264 12:101479826-101479848 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1101148356 12:101862955-101862977 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1101369445 12:104112900-104112922 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1101813093 12:108124484-108124506 ATCTTTTTAGAGATAGGGTCTGG + Intergenic
1101844550 12:108352071-108352093 ATTTTTTTAGACACGGAGTCTGG + Intergenic
1101935200 12:109051579-109051601 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1101959188 12:109235695-109235717 ATTTTTTAAGAGATGGGATGGGG + Intronic
1102115385 12:110398934-110398956 TTGTTTTTGGAGATGGAGTTTGG - Intronic
1102475987 12:113188820-113188842 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1102693239 12:114778155-114778177 TTTTTTTAAGAGATGGTATCTGG - Intergenic
1102738120 12:115181252-115181274 GTTTTTTTTGAGATGGAGTCTGG - Intergenic
1102872632 12:116426001-116426023 ATGCTTTGAGAGGTGGAGGCAGG - Intergenic
1103118211 12:118356309-118356331 TTTTTTTTTGAGATGGAGTCCGG + Intronic
1103208239 12:119146922-119146944 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1103297080 12:119896864-119896886 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1103530560 12:121598240-121598262 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1103646501 12:122397539-122397561 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1103678313 12:122674026-122674048 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1103690844 12:122773467-122773489 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1103767032 12:123287629-123287651 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1104325301 12:127790031-127790053 TGGTTTTAAGATATGGAGACAGG - Intergenic
1104691784 12:130832022-130832044 ATTTTTTTAGAGATGAGGTCTGG + Intronic
1104730235 12:131101396-131101418 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1104737489 12:131145901-131145923 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1104810130 12:131615398-131615420 ATATTTGAAGAGATGTATTCTGG - Intergenic
1105237991 13:18579242-18579264 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105382580 13:19901506-19901528 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105483773 13:20805396-20805418 ATTTTTTAGGAGATGGAGTTAGG - Intronic
1105500260 13:20965672-20965694 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1105596539 13:21844571-21844593 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1105601661 13:21893261-21893283 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1105656383 13:22444501-22444523 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1105731288 13:23219755-23219777 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1105887692 13:24656033-24656055 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106018477 13:25891996-25892018 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1106051008 13:26189314-26189336 GTTTTTTTTGAGATGGAGTCTGG - Intronic
1106084040 13:26524347-26524369 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106129118 13:26925014-26925036 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106232440 13:27831315-27831337 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1106236373 13:27864247-27864269 TTTTTTTTAGAGATGGGGTCTGG + Intergenic
1106263087 13:28085330-28085352 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1106644401 13:31616971-31616993 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1106666206 13:31853112-31853134 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106730887 13:32540262-32540284 GTTTTTTTTGAGATGGAGTCTGG - Intergenic
1106752910 13:32793499-32793521 ATGTTATTAGAGATTGAATCAGG - Intergenic
1106866326 13:33968137-33968159 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1107126290 13:36850389-36850411 AATTTTTTTGAGATGGAGTCTGG + Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107237229 13:38186443-38186465 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1107429103 13:40322961-40322983 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG + Intergenic
1108213020 13:48157277-48157299 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1108394988 13:49983190-49983212 ATTTTTTCTGAGATGGAGTCCGG - Intergenic
1108613438 13:52106753-52106775 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1108859258 13:54833731-54833753 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1109013533 13:56979622-56979644 TTCTTTTAACAGATGGTGTCAGG + Intergenic
1109054218 13:57526493-57526515 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1109058987 13:57588523-57588545 ATGTTTTAAGTGATAGAGATTGG - Intergenic
1109350342 13:61171789-61171811 TTTCTTTAAGAGATGGGGTCTGG - Intergenic
1109785175 13:67164560-67164582 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1110494522 13:76150649-76150671 AGTTTTTAAATGATGGAGTCAGG + Intergenic
1110509291 13:76329906-76329928 ATGTTTTCAGGGATGGGGTGGGG - Intergenic
1110775026 13:79397667-79397689 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1110844404 13:80177835-80177857 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1110928208 13:81182550-81182572 ATATTTTAAGAGCTGGGGTGAGG + Intergenic
1111047655 13:82835670-82835692 ATTTTTTTAGAGATGGAGTCTGG - Intergenic
1111147247 13:84199275-84199297 ATTATTTAAAAGGTGGAGTCTGG + Intergenic
1111423058 13:88042867-88042889 ATGTTTTCAGAGCTGGAGATTGG + Intergenic
1111829440 13:93308451-93308473 ATTTATTTAGAGATTGAGTCTGG + Intronic
1111887288 13:94038541-94038563 AGGTTATAAGTGGTGGAGTCAGG - Intronic
1112008058 13:95271081-95271103 CTGTTTTTTGAGACGGAGTCTGG - Intronic
1112014823 13:95323037-95323059 TTGTTTTTTGGGATGGAGTCTGG + Intergenic
1112015850 13:95330794-95330816 TTGTTTGTAGAGATGGGGTCTGG - Intergenic
1112106111 13:96241795-96241817 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1112202718 13:97292187-97292209 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1112372552 13:98806895-98806917 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1112721527 13:102251453-102251475 ATGTTTTAAAAGATTGAATTTGG - Intronic
1112791798 13:103010936-103010958 ATTTTGTAAAAAATGGAGTCTGG + Intergenic
1112912446 13:104504032-104504054 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1112993615 13:105545031-105545053 ATTTTTTTAGACATGGGGTCTGG - Intergenic
1113035448 13:106042710-106042732 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1113115287 13:106868675-106868697 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1113918915 13:113894605-113894627 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1114013629 14:18402535-18402557 ATATTTTTTGAGATGGAGTCTGG - Intergenic
1114042333 14:18690760-18690782 ATTATTTTTGAGATGGAGTCTGG + Intergenic
1114197795 14:20494351-20494373 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1114296649 14:21335367-21335389 TTGCTTTGGGAGATGGAGTCTGG + Intronic
1114354159 14:21889210-21889232 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1114451883 14:22832350-22832372 GTTTTTTTTGAGATGGAGTCAGG + Intronic
1114529533 14:23387283-23387305 AGGTTTTAAAAGTTGGAATCTGG - Intronic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1114663344 14:24364163-24364185 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1115030504 14:28787877-28787899 ACGTTTGATGAGATGGAGTTTGG + Intronic
1115213246 14:30989470-30989492 ATTTATTTTGAGATGGAGTCTGG + Intronic
1115256924 14:31412861-31412883 ATTTTTTTTGAGATGGAGTTTGG - Intronic
1115455353 14:33595680-33595702 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1115867029 14:37759249-37759271 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1115994240 14:39178746-39178768 ATTTTTTTTGAGATGGAGTTTGG + Intronic
1116175585 14:41466231-41466253 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1116660693 14:47706747-47706769 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1116754847 14:48934953-48934975 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1116943132 14:50810671-50810693 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1117137273 14:52748405-52748427 GTTTTTGTAGAGATGGAGTCTGG + Intronic
1117307804 14:54493436-54493458 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1117444335 14:55789117-55789139 ATGTTAAAAAAGATGGAGGCCGG + Intergenic
1117681001 14:58202570-58202592 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1118133715 14:62997886-62997908 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1118189173 14:63564989-63565011 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1118210850 14:63764514-63764536 TTTTTTTAAGAGATGGAGGCGGG - Intergenic
1118211175 14:63767116-63767138 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1118377662 14:65191125-65191147 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1118399745 14:65368532-65368554 GTTTTTTTTGAGATGGAGTCTGG + Intergenic
1118405911 14:65423271-65423293 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1118878405 14:69804668-69804690 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1119241402 14:73063159-73063181 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1119283496 14:73430931-73430953 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1119283765 14:73433408-73433430 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1119314162 14:73677566-73677588 ATTTTTTTTGAGACGGAGTCTGG + Intronic
1119382114 14:74235911-74235933 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1119506725 14:75179505-75179527 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
1119678687 14:76575639-76575661 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1119994857 14:79242053-79242075 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1120211019 14:81633964-81633986 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1120645308 14:87067136-87067158 ATATTTGAAGAAATGGTGTCTGG - Intergenic
1121010117 14:90515086-90515108 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1121045456 14:90784543-90784565 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1121126710 14:91412445-91412467 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1121172178 14:91863813-91863835 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1121337619 14:93086841-93086863 AAGTTTTCTGAGATGGGGTCAGG - Intronic
1121390501 14:93569423-93569445 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1121475241 14:94194638-94194660 TTTTCTTAAGAGATAGAGTCTGG + Intronic
1121475966 14:94202968-94202990 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1121606234 14:95242268-95242290 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1121895656 14:97644929-97644951 ATTTTTTGTGAGACGGAGTCTGG + Intergenic
1122021976 14:98845570-98845592 ATGTTTGAAGAGAGGGAGACAGG + Intergenic
1122427183 14:101617833-101617855 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1122457113 14:101863004-101863026 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122464769 14:101924449-101924471 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1122563590 14:102635009-102635031 TTTTTTAAAGAGATGGAGTCTGG + Intronic
1122673207 14:103387941-103387963 TTCTTTTTTGAGATGGAGTCTGG + Intronic
1122673362 14:103389350-103389372 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1202892802 14_KI270722v1_random:175542-175564 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1123416444 15:20099124-20099146 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1123436259 15:20256843-20256865 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1123525782 15:21106229-21106251 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1123703947 15:22937608-22937630 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1123786243 15:23677422-23677444 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1123786763 15:23682488-23682510 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1123844397 15:24283132-24283154 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1123863827 15:24496768-24496790 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1123930198 15:25165189-25165211 TTTTTTTAATAGATGGGGTCTGG + Intergenic
1124179336 15:27457875-27457897 TTGTTTAAAGATGTGGAGTCAGG - Intronic
1124930944 15:34118934-34118956 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1125075900 15:35617956-35617978 ATAATTTAAAAAATGGAGTCTGG + Intergenic
1125111697 15:36041872-36041894 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1125467543 15:39969370-39969392 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1125563753 15:40659502-40659524 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1125621148 15:41063323-41063345 ATTTTTTTTGAGACGGAGTCTGG - Intronic
1125626567 15:41114253-41114275 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1125652405 15:41328063-41328085 TTATTTTTTGAGATGGAGTCTGG - Intronic
1125806004 15:42494404-42494426 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1125811066 15:42541769-42541791 TTTTTTTTTGAGATGGAGTCTGG + Exonic
1125840215 15:42793538-42793560 TTTTTTTAAGAGATGGAGTCTGG - Intronic
1125869040 15:43080937-43080959 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1125905119 15:43384588-43384610 ATGTTACAAGAGATGGTGTGAGG + Intronic
1125915274 15:43481513-43481535 TTTTTTTAAGAGACAGAGTCTGG + Intronic
1125955851 15:43790773-43790795 ATTTATTTTGAGATGGAGTCTGG + Intronic
1125961449 15:43833328-43833350 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1126076649 15:44917749-44917771 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1126114409 15:45196107-45196129 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1126141718 15:45444786-45444808 ATGTTATAAGCCATGGTGTCAGG + Intronic
1126470497 15:49005316-49005338 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1126745213 15:51818983-51819005 TTGTTTTTTTAGATGGAGTCTGG + Intergenic
1126781839 15:52145631-52145653 TTATTTTTTGAGATGGAGTCTGG - Intronic
1126784400 15:52164614-52164636 ATTTATTTTGAGATGGAGTCTGG - Intronic
1126785638 15:52176035-52176057 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1126857370 15:52851941-52851963 TTGTTGTTAGAGATGGGGTCTGG + Intergenic
1126892688 15:53223068-53223090 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1126917775 15:53484609-53484631 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
1127414207 15:58741541-58741563 ATGTCTTAAGATTTTGAGTCTGG - Intronic
1127479069 15:59361846-59361868 TTATTTTTTGAGATGGAGTCTGG + Intronic
1127522792 15:59759856-59759878 ATGTTCTTAGAGAAGAAGTCTGG + Intergenic
1127644197 15:60943902-60943924 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1127878030 15:63128753-63128775 ATTTATTTTGAGATGGAGTCTGG + Intronic
1127974391 15:63986434-63986456 TTATTTTTAGAGATGGGGTCTGG + Intronic
1128000378 15:64185848-64185870 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1128017987 15:64364593-64364615 TTCTTTTAAGAGATGGGATCTGG + Exonic
1128046856 15:64625875-64625897 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1128052576 15:64676763-64676785 ATTTATTTTGAGATGGAGTCTGG + Intronic
1128083599 15:64871232-64871254 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1128129651 15:65217585-65217607 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1128291252 15:66480098-66480120 ATATTTTTTGAGATGGAGTCTGG + Intronic
1128326672 15:66728416-66728438 TTGTTTTTTGAGGTGGAGTCTGG + Intronic
1128562552 15:68678222-68678244 CTGTTGTCAGAGAAGGAGTCAGG + Intronic
1128581477 15:68813445-68813467 TTCATTAAAGAGATGGAGTCTGG - Intronic
1128750919 15:70148439-70148461 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1128823049 15:70679389-70679411 ATTTATTTAGAGATGGGGTCTGG - Intronic
1129040096 15:72678477-72678499 AAGTTTGTAGAGATGGGGTCTGG + Intronic
1129349448 15:74946439-74946461 ATTTTTTAAGAGACTGGGTCTGG + Intergenic
1129378044 15:75146323-75146345 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1129763259 15:78144344-78144366 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1130064080 15:80590558-80590580 TTTTTTTTAGAGATGGGGTCTGG - Intronic
1130126522 15:81098593-81098615 TTTTTTTAAGAAATGGGGTCTGG - Intronic
1130397620 15:83517214-83517236 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1130403376 15:83577691-83577713 AAGATTTAAGATATTGAGTCAGG - Intronic
1130523906 15:84686882-84686904 TTATTTTTTGAGATGGAGTCTGG + Intronic
1130538963 15:84807980-84808002 ATCTTTTTAGAGATGGGGTCTGG + Intergenic
1130608452 15:85338750-85338772 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1130801732 15:87271633-87271655 ATGTTTGAAGAGTAGTAGTCAGG - Intergenic
1131360226 15:91784194-91784216 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1131489555 15:92850818-92850840 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1131516842 15:93084482-93084504 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1131600406 15:93841968-93841990 AGGTTATAAGAGATGGAATTGGG - Intergenic
1131619394 15:94051108-94051130 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1132069372 15:98762247-98762269 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1132258373 15:100399112-100399134 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1132322200 15:100933808-100933830 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1132341389 15:101080495-101080517 TTGTGTTTTGAGATGGAGTCTGG + Intergenic
1132363796 15:101241105-101241127 TTGTTTTCTGAGACGGAGTCTGG + Intronic
1132717063 16:1296306-1296328 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1132817986 16:1843684-1843706 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1133047297 16:3095814-3095836 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1133059038 16:3162377-3162399 GTTTTTTCTGAGATGGAGTCTGG + Intergenic
1133546437 16:6812382-6812404 ATTTTTTTTGAGACGGAGTCTGG + Intronic
1133580365 16:7138818-7138840 TTTTTTTATAAGATGGAGTCTGG + Intronic
1133788804 16:8993428-8993450 ATATTTTTTGAGATGGAGTCTGG + Intergenic
1133815892 16:9197162-9197184 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1134002886 16:10796442-10796464 TTATTTTTTGAGATGGAGTCTGG + Intronic
1134101789 16:11457578-11457600 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1134157311 16:11853879-11853901 TTTTTTTAAGAAACGGAGTCTGG + Intergenic
1134174133 16:11992280-11992302 AAAATTTAAGAGATGGAGTCTGG - Intronic
1134217071 16:12324449-12324471 TTGTTTGTGGAGATGGAGTCAGG + Intronic
1134347028 16:13400689-13400711 ATTTGTTCAGACATGGAGTCAGG - Intergenic
1134415532 16:14040472-14040494 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1134467596 16:14493173-14493195 ATGTTTTAACAGGTGGTTTCAGG - Intronic
1134509437 16:14834322-14834344 AGTTTTAAAGAAATGGAGTCTGG - Intronic
1134642318 16:15838843-15838865 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1134660191 16:15978190-15978212 TTTTTTTAAGAGATGTGGTCTGG - Intronic
1134697142 16:16233137-16233159 AGTTTTAAAGAAATGGAGTCTGG - Intronic
1134786207 16:16946191-16946213 TTTTTTTATGAGATGGAATCTGG + Intergenic
1134974703 16:18561548-18561570 AGTTTTAAAGAAATGGAGTCTGG + Intronic
1135011663 16:18885932-18885954 ATTTTTTTTGAGATGGAGTCTGG - Intronic
1135160883 16:20095196-20095218 AGGTAGTAAGAGATGGAGCCAGG - Intergenic
1135318568 16:21473518-21473540 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1135338687 16:21627939-21627961 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1135346824 16:21695904-21695926 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1135371461 16:21905314-21905336 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1135397132 16:22139681-22139703 TTCTTTTTTGAGATGGAGTCTGG - Intronic
1135411740 16:22240088-22240110 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1135440326 16:22465401-22465423 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136219488 16:28819408-28819430 TTTTTTTATGAGATGGAGTCTGG + Intergenic
1136319694 16:29475874-29475896 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136328821 16:29555258-29555280 ATTTTTTTTGAGATGGACTCTGG - Intergenic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1136396993 16:29998277-29998299 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1136434265 16:30215219-30215241 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136443452 16:30294957-30294979 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1136449609 16:30346318-30346340 GTGTGTGTAGAGATGGAGTCTGG + Intergenic
1136501912 16:30675181-30675203 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1136504489 16:30694233-30694255 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136557546 16:31016685-31016707 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136557635 16:31017328-31017350 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1136574621 16:31116221-31116243 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1136635033 16:31515340-31515362 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1136798039 16:33041888-33041910 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1137309132 16:47236138-47236160 ATATTTTAAGATAAGGAGACAGG + Intronic
1137630685 16:49941662-49941684 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1137728742 16:50674423-50674445 TTTTTTTAAAAGATGGGGTCTGG + Intronic
1137827485 16:51511890-51511912 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1137989987 16:53144538-53144560 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1138058019 16:53856736-53856758 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1138632466 16:58309396-58309418 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1138878871 16:60986362-60986384 ATTTATTTAGAAATGGAGTCTGG - Intergenic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1139013437 16:62661613-62661635 TTATTTTTAGAGATAGAGTCTGG + Intergenic
1139165229 16:64558038-64558060 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1139443832 16:66984439-66984461 TTGTTTTTTTAGATGGAGTCTGG + Intergenic
1139569581 16:67802844-67802866 ATTTTTTGAGAGATGAGGTCTGG - Intronic
1139578869 16:67859989-67860011 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1139733377 16:68967091-68967113 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1139808133 16:69587398-69587420 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1139825413 16:69753208-69753230 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1139836871 16:69846036-69846058 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1139890164 16:70247220-70247242 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1139897368 16:70298392-70298414 TTGTTTTTTGAGATTGAGTCTGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140053708 16:71506330-71506352 ATGTTTTAATAGATTGGGTGGGG + Intronic
1140286023 16:73603783-73603805 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1140341633 16:74170580-74170602 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1140506460 16:75476547-75476569 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1140511173 16:75509504-75509526 TTGTTTTCTGAGACGGAGTCTGG - Intergenic
1140676585 16:77338197-77338219 ATGTATGAAAAGATGGAGCCAGG - Intronic
1140690321 16:77477549-77477571 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1140727438 16:77826009-77826031 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141066862 16:80920935-80920957 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1141084188 16:81079720-81079742 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1141179174 16:81740711-81740733 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141191606 16:81829118-81829140 ATTTTTTTTGAGACGGAGTCTGG + Intronic
1141297374 16:82782538-82782560 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141454327 16:84129366-84129388 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141535276 16:84675054-84675076 TTTTTTTAAGAGATAGAGTCAGG + Intergenic
1141543741 16:84748140-84748162 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1141918919 16:87121657-87121679 TTGTTTTTTGAGAAGGAGTCTGG - Intronic
1141959841 16:87398032-87398054 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1142068416 16:88075756-88075778 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1142545426 17:698419-698441 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1142770635 17:2094259-2094281 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1142791421 17:2269206-2269228 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1142949857 17:3470080-3470102 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1143000523 17:3792131-3792153 TTATTTTTTGAGATGGAGTCTGG + Intronic
1143128249 17:4658402-4658424 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1143151997 17:4813019-4813041 TTGGTTTTTGAGATGGAGTCTGG + Intronic
1143197041 17:5083876-5083898 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1143255781 17:5557013-5557035 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1143267247 17:5648749-5648771 ATTTTTTTAGAGATAGGGTCTGG + Intergenic
1143555961 17:7660481-7660503 TTGTTTTCTGAGATGGAATCTGG - Intergenic
1143558586 17:7677973-7677995 TTGTTTTTTGAGATGGAGTTTGG + Intronic
1143638868 17:8183889-8183911 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1143707854 17:8712035-8712057 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1143828355 17:9630972-9630994 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1143945412 17:10587494-10587516 ATTTTTTTTGAGATGGAATCTGG + Intergenic
1144266922 17:13578549-13578571 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1144267019 17:13579687-13579709 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1144298589 17:13902097-13902119 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1144300959 17:13922784-13922806 ATGAGAAAAGAGATGGAGTCTGG - Intergenic
1144861875 17:18309719-18309741 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1145071272 17:19810216-19810238 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1145286380 17:21509069-21509091 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
1145300288 17:21629982-21630004 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1145359347 17:22199293-22199315 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1145746776 17:27325682-27325704 ATGTTTTTAAAGAGAGAGTCGGG + Intergenic
1145927152 17:28656574-28656596 ATTTTTTTTGAGACGGAGTCTGG - Intronic
1146080639 17:29777206-29777228 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1146119829 17:30182627-30182649 TTATTTTTTGAGATGGAGTCTGG - Intronic
1146135952 17:30321171-30321193 TTTTTTTTAGAGATGGAGCCTGG + Intronic
1146216820 17:30983363-30983385 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1146369932 17:32259409-32259431 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1146378927 17:32314391-32314413 ATTTTTTTTGAGACGGAGTCTGG + Intronic
1146729540 17:35182099-35182121 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1146784078 17:35703251-35703273 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1146808514 17:35884814-35884836 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1146874597 17:36398563-36398585 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1146908991 17:36635970-36635992 TTTTTTTTAGAGATGGGGTCTGG - Intergenic
1147064786 17:37914318-37914340 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1147221901 17:38939279-38939301 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1147271827 17:39278557-39278579 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1147353933 17:39875906-39875928 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1147404438 17:40200773-40200795 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1147695218 17:42347171-42347193 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1147719188 17:42527929-42527951 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1148011153 17:44482560-44482582 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1148294854 17:46492703-46492725 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1148488431 17:48006696-48006718 GTTTTTTTTGAGATGGAGTCTGG + Intergenic
1148500863 17:48089930-48089952 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1148590898 17:48816277-48816299 TTGTTTTAAGAGATGGAGGTGGG - Intronic
1148641373 17:49190242-49190264 TTCTTTTTGGAGATGGAGTCTGG - Intergenic
1148924870 17:51075182-51075204 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1148925890 17:51084860-51084882 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1149189587 17:54043570-54043592 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1149308215 17:55369599-55369621 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1149328551 17:55558061-55558083 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1149385750 17:56141940-56141962 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1149559398 17:57597451-57597473 TTTTTTTAAGAGATGAGGTCTGG - Intronic
1149751249 17:59147639-59147661 ATTTTATTAGAGATGGAGTCTGG + Intronic
1149826042 17:59829102-59829124 TTGTTTTTGGAGACGGAGTCTGG - Intronic
1149874133 17:60213952-60213974 TTTTTTTTAAAGATGGAGTCTGG + Intronic
1150087915 17:62291212-62291234 TTTTTTTTAAAGATGGAGTCTGG + Intergenic
1150112414 17:62513698-62513720 TTGTTTTTTGGGATGGAGTCTGG + Intronic
1150114827 17:62538045-62538067 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1150152141 17:62818769-62818791 AGGTTGTGAGAGTTGGAGTCAGG + Intergenic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1150389623 17:64782735-64782757 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1150407751 17:64917232-64917254 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1150492074 17:65581238-65581260 TTTTTTGTAGAGATGGAGTCTGG + Intronic
1150604297 17:66677650-66677672 ATTTAGTAAGGGATGGAGTCAGG - Intronic
1150746258 17:67819266-67819288 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1150755181 17:67905695-67905717 TTTTTTTAAGAGATTGAGTCTGG - Intronic
1150765783 17:68001184-68001206 AATTTTTTTGAGATGGAGTCTGG + Intergenic
1151001074 17:70377325-70377347 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1151480444 17:74367463-74367485 ATGGTTCAAGAGATGGAGCCTGG - Exonic
1151561165 17:74870503-74870525 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1151605712 17:75134119-75134141 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1151607171 17:75145150-75145172 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1151611495 17:75178738-75178760 TTTTTTTAAGAGATGAGGTCTGG + Intergenic
1151642956 17:75409746-75409768 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1151753067 17:76052790-76052812 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1151844139 17:76639561-76639583 TTATTTTTCGAGATGGAGTCTGG - Intronic
1151864418 17:76790927-76790949 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1152148206 17:78582015-78582037 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1152181977 17:78828044-78828066 TTGTTTGTAGAGATGGGGTCTGG - Intronic
1152400150 17:80061332-80061354 TTGTTTTTTGAGATGGATTCTGG - Intronic
1152439870 17:80300274-80300296 TTTTTTTAAGAGACAGAGTCTGG + Intronic
1152773740 17:82187223-82187245 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1152840484 17:82564411-82564433 TGTTTTTAAGAGATGGATTCTGG + Intronic
1152963458 18:95000-95022 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1153216860 18:2828648-2828670 TCGTTTTAAGAGATGGTGTTGGG - Intergenic
1153296345 18:3550401-3550423 ATTTTTTAAGAGAGAGGGTCTGG + Intronic
1153331751 18:3880929-3880951 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1154076696 18:11210090-11210112 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1154132447 18:11749112-11749134 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1154136919 18:11787860-11787882 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1154256411 18:12784595-12784617 ATATTTTTTGAGACGGAGTCTGG + Intergenic
1154964081 18:21339173-21339195 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1155146452 18:23087864-23087886 AAATTTGTAGAGATGGAGTCTGG - Intergenic
1155171832 18:23272431-23272453 TATTTTTAAGAGATGGGGTCTGG - Intronic
1155411201 18:25546995-25547017 ATGTTTTAAGAGTTGCTGGCTGG - Intergenic
1155436511 18:25818226-25818248 TTTTTTTAAGAGACGGGGTCTGG + Intergenic
1155441226 18:25864785-25864807 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1155529238 18:26749256-26749278 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1156040017 18:32810026-32810048 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1156241493 18:35258856-35258878 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1156423221 18:36978980-36979002 ATATTTGTAGAGATGGGGTCTGG - Intronic
1156949696 18:42880234-42880256 GTATTTCCAGAGATGGAGTCAGG - Intronic
1157263715 18:46198296-46198318 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1157356656 18:46941325-46941347 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1157377068 18:47176579-47176601 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1158626229 18:59073677-59073699 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1158858842 18:61572040-61572062 ATTTATTTTGAGATGGAGTCAGG - Intergenic
1158925408 18:62252503-62252525 ATTTTTTTTGAGATAGAGTCTGG - Intronic
1158995989 18:62920267-62920289 ATTTTGTAGGCGATGGAGTCAGG + Intronic
1159067192 18:63583774-63583796 ATTATTTTTGAGATGGAGTCTGG + Intergenic
1159189452 18:65022516-65022538 TTGTTTTTTGAGAGGGAGTCTGG - Intergenic
1159190894 18:65040847-65040869 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1159421749 18:68230202-68230224 TTGTTTTTAGAGACGGAGTCTGG + Intergenic
1159456626 18:68667704-68667726 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1159730771 18:72024308-72024330 CTTTTTTGAGAAATGGAGTCTGG + Intergenic
1159735125 18:72086673-72086695 ATGTTTTAAGATAATGATTCTGG + Intergenic
1159737135 18:72114146-72114168 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1159784766 18:72699576-72699598 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1159828275 18:73241952-73241974 AAGTTTTAAGAGCTGGTGTGGGG + Intronic
1159867452 18:73723032-73723054 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1159927700 18:74283442-74283464 ATTTTTAAATAGAGGGAGTCGGG - Intronic
1159956831 18:74524592-74524614 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1160159600 18:76461168-76461190 TTATTTTTTGAGATGGAGTCAGG - Intronic
1160368305 18:78348808-78348830 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1160621613 18:80174935-80174957 TTATTTTTTGAGATGGAGTCTGG - Intronic
1160701955 19:511881-511903 GTTTTTTTTGAGATGGAGTCTGG + Intronic
1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1160913464 19:1485857-1485879 TTGTTTTTGAAGATGGAGTCTGG - Intronic
1161182500 19:2893708-2893730 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1161255571 19:3307239-3307261 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1161295133 19:3515752-3515774 TTTTTTTTAGAGACGGAGTCTGG - Intronic
1161421820 19:4180114-4180136 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1161491550 19:4564872-4564894 TTGTTTTAAGAGACAGGGTCTGG + Intergenic
1161598759 19:5167190-5167212 TTTTTTTAAGAGATGGGATCTGG - Intronic
1161674525 19:5637330-5637352 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1161692920 19:5747622-5747644 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1161696019 19:5768643-5768665 ATTTTTTAAGAGATAGGGTCTGG + Intronic
1161704676 19:5813994-5814016 ATATTTTTTGAGACGGAGTCTGG - Intergenic
1161831407 19:6607287-6607309 TTGTTTTTTGAGATGAAGTCTGG - Intergenic
1161831915 19:6612333-6612355 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1162045443 19:7996799-7996821 TGGTTTTTGGAGATGGAGTCTGG - Intronic
1162088817 19:8264546-8264568 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1162114346 19:8419480-8419502 TTATTTTTTGAGATGGAGTCCGG - Intronic
1162257944 19:9508098-9508120 CTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1162364760 19:10241780-10241802 ATTTTTTAAGAGATGAGGTTTGG - Intergenic
1162389687 19:10381835-10381857 ATTTTTGTAGAGATGGGGTCTGG + Intergenic
1162390585 19:10387477-10387499 TTTTTTTAAGAGATGGGATCTGG - Intergenic
1162407310 19:10482803-10482825 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1162468939 19:10860521-10860543 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1162645575 19:12047550-12047572 TTTTTTTAACCGATGGAGTCTGG - Intronic
1162661515 19:12172997-12173019 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1162702011 19:12523420-12523442 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1162713317 19:12612214-12612236 TTTTTTTAACAGATGGGGTCTGG + Intronic
1162749857 19:12822563-12822585 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1162955610 19:14096363-14096385 TTTTTTTTAGAGATGGGGTCTGG + Intronic
1162957149 19:14105616-14105638 GTTTTTTTAGAGATGGGGTCTGG + Intronic
1163166725 19:15503275-15503297 TTTTTTTTAGAGATGGGGTCTGG + Intergenic
1163318014 19:16554806-16554828 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1163339497 19:16695954-16695976 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1163412494 19:17164390-17164412 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1163451496 19:17379936-17379958 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1163511781 19:17739727-17739749 CACTTTTAAGAGAGGGAGTCAGG - Intergenic
1163589543 19:18184417-18184439 ATATTTTTTGAGATTGAGTCTGG - Intergenic
1163626881 19:18395357-18395379 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1163675248 19:18652576-18652598 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1163779209 19:19237475-19237497 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1163809639 19:19422721-19422743 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1163906618 19:20154300-20154322 TTGTTTTAAAAGAAGGGGTCAGG + Intergenic
1163915377 19:20236551-20236573 TTGTTTTTTGAGATGGAATCTGG - Intergenic
1163956616 19:20648386-20648408 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1163995117 19:21038437-21038459 ATTATTTTTGAGATGGAGTCTGG + Intronic
1164045721 19:21538264-21538286 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1164243003 19:23406799-23406821 ATTTTTTTTGAGATGGAGCCTGG - Intergenic
1164288240 19:23841450-23841472 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1164553445 19:29231917-29231939 TTTTTTGTAGAGATGGAGTCTGG - Intergenic
1164647001 19:29865874-29865896 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1165036259 19:33036103-33036125 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165340506 19:35208473-35208495 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1165370571 19:35403105-35403127 TTTTTTAAAGAAATGGAGTCTGG + Intergenic
1165498957 19:36172176-36172198 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1165528590 19:36377832-36377854 GTATTTTTTGAGATGGAGTCTGG - Intronic
1165568264 19:36751685-36751707 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165583284 19:36888702-36888724 TTTTTTTTTGAGATGGAGTCTGG + Exonic
1165739075 19:38195037-38195059 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165744268 19:38221526-38221548 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1165785110 19:38457032-38457054 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1165959336 19:39521319-39521341 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1166074510 19:40405944-40405966 TTTTTTTAAGAGTCGGAGTCAGG + Intronic
1166089777 19:40501225-40501247 TTTTTTCAAGAGATGGAGTCTGG - Intronic
1166202410 19:41246730-41246752 ATTTTTTTAGAGATGGGGTCTGG + Intronic
1166217042 19:41342524-41342546 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1166248357 19:41546952-41546974 TTTTTTTAAATGATGGAGTCTGG - Intergenic
1166255097 19:41598470-41598492 TTCTTTTTTGAGATGGAGTCTGG - Intronic
1166396772 19:42446903-42446925 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1166403903 19:42505445-42505467 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1166579797 19:43885366-43885388 ATTATTTTAGAGATGGGGTCTGG + Intronic
1166629315 19:44391139-44391161 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1166710285 19:44932517-44932539 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
1166728503 19:45043891-45043913 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1166859736 19:45802828-45802850 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1166922702 19:46241255-46241277 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1166964957 19:46523874-46523896 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1167050239 19:47073558-47073580 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1167130038 19:47579097-47579119 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1167244782 19:48366376-48366398 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1167276321 19:48542216-48542238 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1167290608 19:48623226-48623248 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1167360392 19:49027223-49027245 ATTTTTTTTGAGACGGAGTCTGG - Intronic
1167421811 19:49408458-49408480 TTCTTTTTTGAGATGGAGTCTGG + Intronic
1167430600 19:49452116-49452138 TTTTTTTAAGAGATGGGGTGTGG - Intronic
1167479207 19:49719070-49719092 TTGTTTTTTGAGATGGAGTTTGG - Intergenic
1167494634 19:49810354-49810376 TTTTTTTAAGAGATGGACTAGGG - Intronic
1167511662 19:49898307-49898329 TTATTTTTTGAGATGGAGTCTGG - Intronic
1167794282 19:51699184-51699206 ATTTGTTTAGAGATGGTGTCTGG + Intergenic
1167926098 19:52821889-52821911 TTTTTTTTAGAGACGGAGTCTGG - Intronic
1167930403 19:52858529-52858551 TTATTTTTAGAGAGGGAGTCTGG - Intergenic
1168028508 19:53661507-53661529 ATTTTTTTTGAGACGGAGTCTGG + Intergenic
1168040558 19:53755369-53755391 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168044593 19:53785398-53785420 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168048571 19:53811500-53811522 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1168068160 19:53931771-53931793 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1168084919 19:54038551-54038573 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168138439 19:54367732-54367754 ATATTTTTTTAGATGGAGTCTGG - Intronic
1168142861 19:54400927-54400949 TTTTTTAAAGAGATGGAGTCTGG - Intergenic
1168157036 19:54480078-54480100 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1168399039 19:56072760-56072782 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1168483086 19:56737802-56737824 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1168699092 19:58425242-58425264 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
925707187 2:6697521-6697543 TTATTTTTTGAGATGGAGTCTGG - Intergenic
925945413 2:8857971-8857993 ATGTTTTAAGAGATTCCTTCTGG + Exonic
926043300 2:9691807-9691829 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
926076468 2:9947060-9947082 TTGTTTTTTGAGATGGAGTTTGG - Intergenic
926397752 2:12462253-12462275 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
926506995 2:13729028-13729050 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
926525343 2:13973436-13973458 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
926670129 2:15569073-15569095 ATTTTTTAAGAGACAGAGTCTGG - Intergenic
926751156 2:16199612-16199634 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
927182223 2:20454808-20454830 ATGTTCTCAGAGAGGGAGGCCGG - Intergenic
927276469 2:21266577-21266599 TTGTTTTTCGAGACGGAGTCTGG + Intergenic
927436729 2:23072898-23072920 ATTTTTTATGAGATGGAGGGAGG + Intergenic
927458841 2:23280120-23280142 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
927601413 2:24445358-24445380 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
927648071 2:24892258-24892280 TTTTTTTTTGAGATGGAGTCTGG + Intronic
927750699 2:25667481-25667503 TTTTTTTTTGAGATGGAGTCTGG - Intronic
927785035 2:25968016-25968038 ATTTTCTAAGAGATGGAAGCGGG - Intronic
927905817 2:26855415-26855437 TTTTTTTTTGAGATGGAGTCTGG - Intronic
928176986 2:29041034-29041056 TTTTTTTTTGAGATGGAGTCTGG + Intronic
928349722 2:30538622-30538644 TTTTTTTTTGAGATGGAGTCTGG - Intronic
928545864 2:32328728-32328750 ATTTATTTTGAGATGGAGTCTGG + Intergenic
928642872 2:33319086-33319108 TTGTTTTAAGAGACAGGGTCTGG - Intronic
928656449 2:33456913-33456935 TTTTTTTTTGAGATGGAGTCTGG + Intronic
928683369 2:33725620-33725642 TTTTTTTTAGAGATGGGGTCTGG + Intergenic
928769693 2:34692185-34692207 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
928791480 2:34960781-34960803 CTGTTTGCAGAGATGAAGTCTGG - Intergenic
929105312 2:38359464-38359486 TTTTTTTTTGAGATGGAGTCTGG - Intronic
929113231 2:38422833-38422855 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
929116763 2:38451265-38451287 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
929203455 2:39263078-39263100 TTTTTTTTTGAGATGGAGTCTGG - Intronic
929363346 2:41121744-41121766 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
929599526 2:43196442-43196464 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
929649875 2:43668042-43668064 TTGTTTTTTGAGATGAAGTCCGG + Intronic
929903721 2:46027951-46027973 TTTTTTTTTGAGATGGAGTCGGG + Intronic
930040470 2:47118664-47118686 AACTATTAAGAGATAGAGTCAGG - Intronic
930111602 2:47683307-47683329 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
930213919 2:48673372-48673394 TTTTTTTTTGAGATGGAGTCTGG + Intronic
930315249 2:49789180-49789202 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
930343258 2:50144503-50144525 ATTTTTTAGGAGATTGAGTTGGG - Intronic
930452400 2:51558246-51558268 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
930705167 2:54497912-54497934 ATGTTTGTAGAGATGGTCTCCGG - Intronic
930792570 2:55349938-55349960 ATTTTTTTTGAGACGGAGTCTGG + Intronic
930793558 2:55361072-55361094 AAGTTTTTTGAGATGGAGTCTGG - Intronic
930804160 2:55473271-55473293 TTTTTTTAAGAGATGGAGGGTGG - Intergenic
930822961 2:55666268-55666290 ATTTTTTAAGAGACAGGGTCTGG + Intronic
930832804 2:55763225-55763247 TTTTTTGTAGAGATGGAGTCGGG + Intergenic
930865803 2:56120993-56121015 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
930967309 2:57345382-57345404 ATGTTTTAAAAAGTGGAGTTGGG - Intergenic
931166179 2:59751441-59751463 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931269500 2:60689020-60689042 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
931273824 2:60726554-60726576 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931275139 2:60737826-60737848 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
931333625 2:61316571-61316593 ATTTTTTTTGAGATGGTGTCTGG - Intronic
931333677 2:61316872-61316894 TTATTTTTTGAGATGGAGTCTGG - Intronic
931602924 2:64021261-64021283 TTTTTTTAAGAGATGGTGTCTGG - Intergenic
931758219 2:65393341-65393363 CTTTTTTTTGAGATGGAGTCTGG + Intronic
931858950 2:66333649-66333671 TTATTTTTTGAGATGGAGTCTGG - Intergenic
932189874 2:69731990-69732012 TTTTTTTTTGAGATGGAGTCTGG + Intronic
932238137 2:70137419-70137441 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
932379819 2:71271660-71271682 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
932588667 2:73049430-73049452 TTTTTTTAAGAGTTGGGGTCTGG + Intronic
932637003 2:73398853-73398875 TTTTTTTTTGAGATGGAGTCTGG + Intronic
932676228 2:73783741-73783763 ATTTTTTGTGAGATGGAGTCTGG - Intergenic
932676813 2:73788646-73788668 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932677398 2:73793543-73793565 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932677984 2:73798441-73798463 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932678570 2:73803341-73803363 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932679150 2:73808240-73808262 ATTTTTTGTGAGATGGAGTCTGG - Intronic
932810106 2:74818287-74818309 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
932813276 2:74841966-74841988 CTGTTTGATGAGCTGGAGTCAGG + Intronic
932905536 2:75746083-75746105 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
933153182 2:78939545-78939567 ATGTTCTAAGAGATGGGATTTGG + Intergenic
933170418 2:79118666-79118688 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
933191432 2:79338232-79338254 TTTTTTTTTGAGATGGAGTCTGG - Intronic
933239335 2:79902636-79902658 TTTTTTTTTGAGATGGAGTCTGG + Intronic
933240634 2:79916956-79916978 TTGTTTTTTGAGACGGAGTCTGG + Intronic
933293851 2:80468428-80468450 ATTTTTTTTGAGATGGAGCCTGG + Intronic
933572574 2:84030649-84030671 ATATTTTAAAAGATCGAGTCAGG - Intergenic
933668663 2:84985815-84985837 TTTTTTTTTGAGATGGAGTCTGG - Intronic
933680511 2:85095696-85095718 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
933848108 2:86342187-86342209 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
933960093 2:87402683-87402705 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
934067517 2:88353482-88353504 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
934769676 2:96899869-96899891 TTTTTTTAAGAGAAGGTGTCTGG + Intronic
934877716 2:97940795-97940817 TTTTTTTTTGAGATGGAGTCTGG - Intronic
934916231 2:98303105-98303127 ATGTTTTAAGAGATGTCCCCGGG + Intronic
935027693 2:99293001-99293023 TTTTTTTTTGAGATGGAGTCTGG + Intronic
935324283 2:101921935-101921957 ATGTTTTAAGGGATTGGGTGTGG + Intergenic
935546015 2:104399987-104400009 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
935789148 2:106575403-106575425 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
935967049 2:108489501-108489523 TTTTTTTTTGAGATGGAGTCTGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936610014 2:113993087-113993109 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
936706338 2:115079352-115079374 TTGTTTTTTGAGACGGAGTCTGG - Intronic
936875238 2:117181191-117181213 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
936891556 2:117376698-117376720 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
937156947 2:119726862-119726884 ATGTTTTAAGAGGTCGGGTGCGG + Intergenic
937277996 2:120698207-120698229 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
937352777 2:121177077-121177099 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
937400010 2:121574314-121574336 TTTTTTTTTGAGATGGAGTCTGG - Intronic
937423713 2:121779755-121779777 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
937533137 2:122854299-122854321 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
937659465 2:124413955-124413977 AAGTATTGAGAGATGGAGTGAGG + Intronic
937945761 2:127334619-127334641 TTTTTTGTAGAGATGGAGTCTGG + Intronic
937969533 2:127538575-127538597 TTTTTTTTTGAGATGGAGTCTGG + Intronic
938060206 2:128248490-128248512 TTTTTTTTTGAGATGGAGTCTGG + Intronic
938267874 2:129941763-129941785 ATTATTTTTGAGATGGAGTCTGG - Intergenic
938417420 2:131115364-131115386 TTTTTTTTTGAGATGGAGTCTGG + Intronic
938511007 2:131944295-131944317 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
938855785 2:135308990-135309012 TTTTTTTTTGAGATGGAGTCTGG + Intronic
939086670 2:137727716-137727738 GTGTTTTAAGACTTGGTGTCGGG - Intergenic
939145084 2:138403912-138403934 CTGTTTTAAAAGAAGGGGTCAGG - Intergenic
939474055 2:142663405-142663427 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
939505112 2:143036069-143036091 ATTTTTTTAGAGATGAGGTCTGG + Intronic
940023918 2:149185078-149185100 ATGTGGTAAGAGAGGGAGACCGG + Intronic
940039468 2:149345102-149345124 CTTTTTTCAGAGATGGGGTCGGG - Intronic
940104703 2:150085409-150085431 ATTTTATTTGAGATGGAGTCTGG - Intergenic
940636634 2:156305842-156305864 TTATTTTTTGAGATGGAGTCTGG - Intergenic
940846311 2:158646012-158646034 ATGTTTTAAGACATGGACCTTGG + Intronic
940876412 2:158901889-158901911 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
941382713 2:164815512-164815534 ATTAAGTAAGAGATGGAGTCAGG - Intronic
941436316 2:165477655-165477677 TTTTTTTTTGAGATGGAGTCTGG - Intronic
941710124 2:168703544-168703566 TTGTTTTTTGAGATGGAGTCTGG - Intronic
942016874 2:171826595-171826617 ATATTTTTTGAGATGGAGTCTGG - Intronic
942092747 2:172509861-172509883 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
942424200 2:175842049-175842071 TTATTTTTTGAGATGGAGTCTGG - Intergenic
942884006 2:180900169-180900191 TTTTTTTTTGAGATGGAGTCAGG + Intergenic
942898299 2:181084608-181084630 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
943537204 2:189167422-189167444 TTGTTTTAAAAAATGGAGTGGGG - Intronic
943611088 2:190035417-190035439 TTTTTTTTTGAGATGGAGTCTGG - Intronic
943707879 2:191055208-191055230 TTTTTTTTTGAGATGGAGTCTGG + Intronic
943999844 2:194820009-194820031 ATGTATTAAGAAATGGCTTCAGG + Intergenic
944028777 2:195206375-195206397 ATTTGTTTAGAGATGGGGTCTGG + Intergenic
944222519 2:197316782-197316804 TTCTTTTTGGAGATGGAGTCTGG + Intergenic
944434521 2:199672791-199672813 ATCTCCTAAGAGATAGAGTCAGG + Intergenic
944643705 2:201755557-201755579 GTGTTTTAAGAGATGGGAGCCGG - Intronic
944652288 2:201843196-201843218 TTTTTTTATTAGATGGAGTCTGG + Intronic
944789830 2:203113831-203113853 TTTTTTTTTGAGATGGAGTCTGG + Intronic
945229587 2:207571931-207571953 TAGTTTTAAGAGATTGAGCCAGG + Intronic
945260383 2:207837643-207837665 TTTTTTTTTGAGATGGAGTCAGG + Intronic
945366774 2:208964250-208964272 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
945498286 2:210536330-210536352 TTTTTTTTTGAGATGGAGTCTGG + Intronic
945620805 2:212134693-212134715 TTTTTTTTTGAGATGGAGTCTGG + Intronic
945852868 2:215030590-215030612 TTTTTTTTTGAGATGGAGTCTGG - Intronic
945885723 2:215373689-215373711 TTTTTTTTTGAGATGGAGTCTGG + Intronic
946278322 2:218647409-218647431 TTTTTTTTTGAGATGGAGTCTGG - Intronic
946801084 2:223416530-223416552 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
947049414 2:226025016-226025038 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
947211223 2:227710382-227710404 ATTTTTGTAGAGATGGAGTCTGG - Intronic
947214971 2:227741940-227741962 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
947480516 2:230495332-230495354 TTCTTTTTTGAGATGGAGTCTGG + Intronic
947519561 2:230834135-230834157 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
947558479 2:231121348-231121370 ATTTTAATAGAGATGGAGTCTGG - Intronic
947559731 2:231138107-231138129 ATCTTTTAAAAGATGGGGTCAGG + Intronic
947565759 2:231191928-231191950 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
947573168 2:231251176-231251198 TTTTTTTTTGAGATGGAGTCTGG + Intronic
947661448 2:231872082-231872104 TTATTTTTTGAGATGGAGTCTGG + Intergenic
947941784 2:234062701-234062723 ATGTTGAAAGAAATGGATTCTGG + Intronic
947980684 2:234406235-234406257 ATGTTACAAGAGATGGACACAGG + Intergenic
948321094 2:237070278-237070300 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
948543491 2:238706684-238706706 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
948842025 2:240656213-240656235 TTTTTTTTAGAGATGGGGTCTGG + Intergenic
948880373 2:240853957-240853979 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1168743443 20:214971-214993 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1168761954 20:355391-355413 ATTTTTTTCGAGACGGAGTCTGG + Intronic
1168952721 20:1813514-1813536 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1169161541 20:3383283-3383305 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1169179279 20:3548587-3548609 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1169211936 20:3770695-3770717 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1169310904 20:4538859-4538881 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1169469912 20:5875528-5875550 ATTTTTTAAGAGATGGGGTCTGG - Intergenic
1169618739 20:7480410-7480432 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1169651779 20:7877098-7877120 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1169794561 20:9447728-9447750 AGTTTTTAAGTGGTGGAGTCAGG + Intronic
1169892831 20:10472240-10472262 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1170218618 20:13917807-13917829 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1170243772 20:14197753-14197775 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1170342043 20:15340148-15340170 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1170419058 20:16174272-16174294 TTGTTTTTATAGACGGAGTCTGG + Intergenic
1170421819 20:16200837-16200859 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1171128592 20:22627139-22627161 TTGTTTTTTGAGATGGGGTCTGG - Intergenic
1171392067 20:24808101-24808123 TTGTTTTCTGAGATGGAGTCTGG + Intergenic
1171560145 20:26116718-26116740 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1171859275 20:30380510-30380532 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1171969793 20:31557005-31557027 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1171970996 20:31565152-31565174 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1172692368 20:36798766-36798788 ATTTGTTAACGGATGGAGTCAGG - Intronic
1172697216 20:36831171-36831193 ATGTACATAGAGATGGAGTCTGG - Intronic
1172749734 20:37242318-37242340 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1172854646 20:37992575-37992597 ATTTTTGAAAAGATGAAGTCAGG - Intronic
1172983625 20:38964440-38964462 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1173486272 20:43443372-43443394 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1173492103 20:43491425-43491447 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1173609119 20:44353818-44353840 TTTTTTTCTGAGATGGAGTCTGG + Intergenic
1173635785 20:44556372-44556394 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1173647359 20:44641777-44641799 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1174230206 20:49040142-49040164 ATATTTTTTGAGATGGAGTCTGG + Intergenic
1174309915 20:49644255-49644277 ATGTTTTAATAAATAGAGACAGG + Intronic
1174477045 20:50802860-50802882 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1174583076 20:51586480-51586502 AATTTGTAAGAGATGGAGCCAGG - Intergenic
1174661435 20:52216577-52216599 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1174826959 20:53777111-53777133 GTTTTTGTAGAGATGGAGTCTGG - Intergenic
1175002775 20:55647754-55647776 ATCTTGTCTGAGATGGAGTCTGG - Intergenic
1175143225 20:56876053-56876075 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1175145471 20:56892929-56892951 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1175160163 20:57002463-57002485 CTGTTTTGTGAGATGGAATCTGG + Intergenic
1175349479 20:58308718-58308740 ATGGGATAAGAGATGGAGCCGGG + Intergenic
1175481337 20:59313367-59313389 TTCATTTAAGAGATGGTGTCTGG - Intronic
1175551239 20:59819347-59819369 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1175866250 20:62178721-62178743 ATTTTTGTAGAGATGGAGTCTGG + Intronic
1176650904 21:9546135-9546157 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1176781976 21:13207517-13207539 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1177066160 21:16438960-16438982 ATATTTTAAAGGATGGAGGCTGG - Intergenic
1177142211 21:17369467-17369489 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177279919 21:18967657-18967679 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177280062 21:18970334-18970356 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177546671 21:22567832-22567854 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1177883500 21:26721306-26721328 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1177935154 21:27335833-27335855 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1178081116 21:29066068-29066090 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1178240750 21:30897216-30897238 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1178319412 21:31593945-31593967 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1178566840 21:33694518-33694540 ATTTTTTAAGAGAAAGGGTCTGG + Intronic
1179454041 21:41486309-41486331 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1179533196 21:42034052-42034074 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1179664132 21:42898292-42898314 TTGTTTTAAGAGAGGGGCTCTGG + Intronic
1180018712 21:45105110-45105132 TTGTTTTTTTAGATGGAGTCTGG + Intronic
1180065906 21:45412246-45412268 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1180226414 21:46395351-46395373 ATTATTTCTGAGATGGAGTCTGG - Intronic
1180242113 21:46516501-46516523 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1180242838 21:46523244-46523266 TTATTTTTTGAGATGGAGTCTGG + Intronic
1180438124 22:15333350-15333372 ATATTTTTTGAGATGGAGTCTGG - Intergenic
1181284877 22:21744726-21744748 TTGCTTTTTGAGATGGAGTCTGG - Intergenic
1181378239 22:22477816-22477838 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1181641962 22:24206325-24206347 ATTTTTTTTGAGACGGAGTCTGG + Intergenic
1181857398 22:25791924-25791946 AGCTTTTAAGTGGTGGAGTCGGG + Intronic
1181958637 22:26607032-26607054 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1182211532 22:28680788-28680810 AGTTTTCAAGAGATGGAGGCGGG - Intergenic
1182328211 22:29530506-29530528 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1182373253 22:29827084-29827106 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1182402342 22:30089362-30089384 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1182413540 22:30206492-30206514 TTGTTTTCAGAGATAGGGTCTGG + Intergenic
1182469795 22:30541644-30541666 TTCTTTTTTGAGATGGAGTCTGG - Intronic
1182535339 22:30997808-30997830 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1182575307 22:31268959-31268981 GTGTTTTAAGCTATGGAGTCTGG + Intronic
1182647686 22:31823519-31823541 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1182652381 22:31862550-31862572 ATTTTTTTTGAGATGGACTCTGG - Intronic
1182906550 22:33942878-33942900 ATTTTTGGAGAGACGGAGTCTGG + Intergenic
1182975950 22:34624277-34624299 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1183167382 22:36158036-36158058 TTTATTTATGAGATGGAGTCTGG - Intronic
1183224532 22:36540407-36540429 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183287162 22:36974208-36974230 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183374119 22:37453019-37453041 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1183619223 22:38962944-38962966 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1183714109 22:39523690-39523712 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1184053733 22:42029547-42029569 ATTTTTATAGAGATGGGGTCTGG + Intronic
1184056265 22:42052292-42052314 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1184056781 22:42057926-42057948 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1184125936 22:42487090-42487112 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1184129605 22:42509974-42509996 TTTTTTTTTGAGATGGAGTCTGG + Exonic
1184348790 22:43929606-43929628 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1184830692 22:46984353-46984375 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1184919877 22:47598572-47598594 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1184971194 22:48021406-48021428 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1185178489 22:49345737-49345759 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1185196507 22:49473752-49473774 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1185360076 22:50401217-50401239 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1185378376 22:50493807-50493829 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1185387162 22:50539074-50539096 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1185387713 22:50543894-50543916 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
949179683 3:1113664-1113686 ATGTTTAAGGGGATGGACTCAGG + Intronic
949461295 3:4297577-4297599 TTTTTTTTTGAGATGGAGTCTGG + Intronic
949962545 3:9324943-9324965 TTTTTTTTTGAGATGGAGTCTGG - Intronic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950041597 3:9923163-9923185 TTTTTTTTTGAGATGGAGTCTGG - Intronic
950383519 3:12637509-12637531 ATGTTAATAGAGATGGAGGCGGG - Intronic
950464655 3:13146162-13146184 TTTTTTTAAGAAATGGGGTCTGG + Intergenic
950512968 3:13444010-13444032 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
950538708 3:13597107-13597129 TTTTTTGTAGAGATGGAGTCTGG + Intronic
950975320 3:17236496-17236518 TTTTTTTTTGAGATGGAGTCTGG + Intronic
951142824 3:19186534-19186556 ATGATGTAAGAGGTGGAGGCAGG + Intronic
951835478 3:26978431-26978453 TTTTTTTAAGAGACAGAGTCTGG - Intergenic
951950596 3:28196377-28196399 ATGTTCTACCAGATGGAGACAGG + Intergenic
951951867 3:28207908-28207930 ATGTTTTAAGTAATTAAGTCTGG - Intergenic
952440382 3:33321296-33321318 TTTTTTTTTGAGATGGAGTCAGG - Intronic
953488701 3:43328370-43328392 TTTTCTTAAGAGATGGGGTCTGG + Intronic
953520216 3:43635238-43635260 GTGCTTGAAGAGATGGATTCCGG - Intronic
953618315 3:44511234-44511256 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
953827052 3:46262666-46262688 TTATTTTTTGAGATGGAGTCTGG + Intronic
953837723 3:46361791-46361813 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
953949744 3:47179954-47179976 TTTTTTTTAGAGATAGAGTCTGG + Intergenic
953951235 3:47191840-47191862 ATTTTTTAAGAGATAGAGTCTGG - Intergenic
954339671 3:49942847-49942869 TTTTTTTTTGAGATGGAGTCTGG - Intronic
954553974 3:51504047-51504069 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
954679040 3:52331634-52331656 TTTTTTTTTGAGATGGAGTCTGG + Intronic
954772917 3:52989409-52989431 TTTTTTTTTGAGATGGAGTCAGG - Intronic
954876930 3:53808400-53808422 TTTTTTTTTGAGATGGAGTCTGG - Intronic
954880393 3:53831939-53831961 TTTTTTTTTGAGATGGAGTCTGG - Intronic
954902656 3:54033361-54033383 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
955217894 3:56999626-56999648 ATTTTTGTAGAGATGGGGTCTGG - Intronic
955286204 3:57644136-57644158 TTTTTTTTTGAGATGGAGTCTGG - Intronic
955576583 3:60371369-60371391 TTTTTTTAAGAGATGGGGTCTGG + Intronic
955635694 3:61027096-61027118 CTTTTTTTTGAGATGGAGTCTGG + Intronic
955700362 3:61676443-61676465 TTTTTTTTTGAGATGGAGTCTGG - Intronic
956490354 3:69764911-69764933 TTGTTTTAACAGTGGGAGTCTGG + Intronic
956628797 3:71293464-71293486 TTTTTTTAAGAAATGGGGTCTGG - Intronic
956720153 3:72110430-72110452 TTGTTTTTTGAGATGGATTCTGG + Intergenic
956832348 3:73063615-73063637 ATTTTTTTTTAGATGGAGTCTGG - Intronic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
956903346 3:73740075-73740097 ATGAATTAGGAGCTGGAGTCAGG + Intergenic
956986586 3:74708614-74708636 ATTTATTTTGAGATGGAGTCTGG + Intergenic
957153775 3:76520437-76520459 ATTTTTTTTGAGATGGAGTCTGG - Intronic
957477977 3:80751455-80751477 ATCTTATAAGTGATGGAGCCAGG - Intergenic
957569665 3:81930536-81930558 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
957594346 3:82242968-82242990 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
957773247 3:84721259-84721281 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
958022859 3:88017243-88017265 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
958099220 3:88987587-88987609 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
958416208 3:93876575-93876597 TTTTTTTTTGAGATGGAGTCTGG - Intronic
958441797 3:94164413-94164435 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
958543294 3:95508718-95508740 ATTTATTTTGAGATGGAGTCTGG - Intergenic
958620145 3:96548349-96548371 ATGTTTTATGAGCTGAAGTGAGG - Intergenic
958883793 3:99703182-99703204 ATATTTTAAGAGAATCAGTCTGG + Intronic
959002919 3:100985538-100985560 TTCCTTTAAGAGATGGTGTCAGG + Intronic
959077688 3:101766948-101766970 TTTTTTAAAGAGATGGAGGCTGG + Exonic
959541279 3:107541828-107541850 TTTTTTTAAGAGATGGAGTCTGG + Intronic
959836304 3:110922502-110922524 TTATTTTTTGAGATGGAGTCTGG + Intergenic
959850426 3:111080422-111080444 ATATTTCAAGAGATGCTGTCAGG - Intronic
959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG + Intergenic
959930832 3:111980183-111980205 ATGTTTTAAGAGGTGATTTCTGG + Intronic
960092324 3:113653589-113653611 TTTTTTTAATAGATGGAGTCTGG - Exonic
960179513 3:114558791-114558813 ATGTGTTCAGAGAAGGAATCAGG - Intronic
960195459 3:114761820-114761842 TTTTTTTTTGAGATGGAGTCTGG - Intronic
960232446 3:115244107-115244129 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
960600326 3:119450813-119450835 TTTTTTTTTGAGATGGAGTCTGG - Intronic
960872011 3:122259639-122259661 TTTTTTTTTGAGATGGAGTCTGG + Intronic
960901070 3:122555044-122555066 TTTTTTAAAGAGATGGGGTCTGG + Intronic
961682218 3:128607123-128607145 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
961740361 3:129029587-129029609 TTTTTTTTTGAGATGGAGTCTGG + Intronic
962340402 3:134577446-134577468 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
962392600 3:134985164-134985186 TTGTTTTTTGAGTTGGAGTCTGG + Intronic
962567988 3:136683273-136683295 TTTTTTTTTGAGATGGAGTCTGG + Intronic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
962718496 3:138149786-138149808 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
962750125 3:138428022-138428044 TTTTTTTATGAGATGGAGTCTGG - Intergenic
963156074 3:142098726-142098748 TGTTTTAAAGAGATGGAGTCTGG - Intronic
963185411 3:142410504-142410526 TTTTTTTTTGAGATGGAGTCTGG + Intronic
963207431 3:142651156-142651178 TACTTTTAAGAGATGGAGACAGG + Intronic
963659290 3:148103961-148103983 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
963725411 3:148914614-148914636 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
963798137 3:149651839-149651861 TTTTTTTTTGAGATGGAGTCTGG + Intronic
963804728 3:149711705-149711727 ATGTTTTAAGAAAGAGAGACTGG - Intronic
963861646 3:150316564-150316586 TTTTTTTTAGAGATGGGGTCTGG - Intergenic
963889412 3:150617131-150617153 CTGTTTTAAGAGAAGCAGGCTGG + Intronic
964269727 3:154941966-154941988 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
964329880 3:155590564-155590586 TTTTTTTTTGAGATGGAGTCTGG - Intronic
964393045 3:156217379-156217401 ATGTTTTGAGACATGCAATCAGG + Intronic
964759123 3:160116720-160116742 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
964864501 3:161241430-161241452 TTTTTTTTTGAGATGGAGTCTGG + Intronic
964871088 3:161314355-161314377 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
965130350 3:164691138-164691160 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
965566171 3:170120559-170120581 TTTTTTTTTGAGATGGAGTCTGG - Intronic
965647722 3:170901569-170901591 TTTTTTTTTGAGATGGAGTCTGG + Intronic
965743584 3:171901991-171902013 ATGGATTAGGAAATGGAGTCAGG - Intronic
966162984 3:176987244-176987266 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
966381140 3:179346779-179346801 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
966606769 3:181828817-181828839 ATGTTTTTAGAAATGGGGTCTGG + Intergenic
966692839 3:182759263-182759285 TTTTTTTTAGAGCTGGAGTCTGG + Intergenic
966778795 3:183565664-183565686 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
966887308 3:184383787-184383809 TTTTTTTTTGAGATGGAGTCTGG + Intronic
966903086 3:184501229-184501251 TTTTTTTTTGAGATGGAGTCTGG + Intronic
966904945 3:184515211-184515233 TTTTTTTTTGAGATGGAGTCTGG - Intronic
966973229 3:185064265-185064287 ATTTGTTTTGAGATGGAGTCTGG - Intergenic
967131921 3:186478439-186478461 CTGTTTTAAGACATAGAGTTGGG + Intergenic
967550687 3:190791701-190791723 ATAGTTTGAGATATGGAGTCAGG + Intergenic
967839125 3:193990500-193990522 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
968063130 3:195741361-195741383 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
968183489 3:196614685-196614707 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
968632789 4:1660867-1660889 TTTTTTTTTGAGATGGAGTCTGG - Intronic
969120123 4:4902403-4902425 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
969203752 4:5626343-5626365 TTTTTTTTTGAGATGGAGTCTGG + Intronic
969567435 4:7986992-7987014 TTATTTTAAGAGACAGAGTCTGG + Intronic
969897059 4:10315314-10315336 AAGTGTCTAGAGATGGAGTCAGG + Intergenic
970849958 4:20589916-20589938 TTTTTTTTTGAGATGGAGTCTGG + Intronic
971337317 4:25735839-25735861 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
971412814 4:26393384-26393406 TTGTTTTGAGAGACAGAGTCTGG + Intronic
971699420 4:29950228-29950250 ATTTATTTTGAGATGGAGTCTGG - Intergenic
971728711 4:30348274-30348296 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
972004908 4:34089195-34089217 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
972034462 4:34504188-34504210 TTTTTTTATGAGATGGGGTCTGG + Intergenic
972499240 4:39662215-39662237 ATATTTTTTGAGATGGAGTCTGG + Intergenic
972510812 4:39767338-39767360 TTGTTTTTTGAGATGGAGTCTGG + Intronic
972526461 4:39917584-39917606 TCTTTTTATGAGATGGAGTCTGG + Intronic
972531278 4:39963446-39963468 TTTTTTTTTGAGATGGAGTCTGG - Intronic
972619561 4:40733765-40733787 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
972759916 4:42092996-42093018 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
972777972 4:42260910-42260932 ATTTTTTTTGAGATGGAATCTGG + Intergenic
972787578 4:42341554-42341576 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
972790412 4:42366466-42366488 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
972910273 4:43807579-43807601 ATGTTTTTAGAGGTAGAGTCAGG - Intergenic
972948993 4:44295119-44295141 ATTTTTTAAAATATGGAGACAGG - Intronic
973692658 4:53453808-53453830 ATATTTTAAGAGAGTGAGCCTGG - Intronic
973783826 4:54316884-54316906 TTTTTTTAAGAGATGGGGGCCGG + Intergenic
973904026 4:55508489-55508511 ATGGTTTAAGAGATGAATTGGGG - Intronic
973985485 4:56348137-56348159 CTTTTTTTTGAGATGGAGTCTGG - Intronic
974055643 4:56980101-56980123 TTTTTTTAAGAGATGGGGTCTGG + Intronic
974304937 4:60123937-60123959 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
974400039 4:61391869-61391891 TTTTTTTTTGAGATGGAGTCTGG + Intronic
974416951 4:61620651-61620673 TTTTTTTTTGAGATGGAGTCTGG + Intronic
974435791 4:61856188-61856210 ATTTTTGTAGAGGTGGAGTCTGG - Intronic
974964500 4:68744648-68744670 CTGTTTTAAAAGAAGGTGTCAGG + Intergenic
974991998 4:69104333-69104355 ATTTTTATAAAGATGGAGTCTGG + Intronic
975362742 4:73490428-73490450 TTGTTTTTTGAGACGGAGTCTGG + Intronic
975477096 4:74835880-74835902 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
975702315 4:77077968-77077990 TATTTTTAAGAGATGGGGTCTGG + Intergenic
975721979 4:77256849-77256871 ATGTTCTAAGACAAGGAGTAAGG - Intronic
975782163 4:77850656-77850678 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
976039252 4:80862356-80862378 ATATTTTTCGAGATGGAGTCTGG - Intronic
976706148 4:88021721-88021743 AAGTTATAAGAGATAGACTCTGG - Intronic
976773923 4:88686131-88686153 TTTTTTTAAGAGATGGAGAGAGG - Intronic
977276449 4:94982971-94982993 TTCTTTTTTGAGATGGAGTCTGG - Intronic
977530956 4:98200006-98200028 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
977595482 4:98874802-98874824 TTTTTTTTGGAGATGGAGTCTGG + Intronic
977708900 4:100101973-100101995 ATTTTTTAAAAAATGGAGTCAGG + Intergenic
977907309 4:102492866-102492888 TTGTTGTAAGAGATGGGGTTGGG - Intergenic
977911615 4:102543813-102543835 TTGTTTTAAGTAATTGAGTCAGG - Intronic
978416317 4:108480658-108480680 ATATTATAACAGATAGAGTCAGG + Intergenic
978460412 4:108945674-108945696 TTGTTTTTTGAGATGGAGTCTGG + Intronic
978518177 4:109591708-109591730 TTGTTTTTTGAAATGGAGTCTGG + Intronic
978520819 4:109613092-109613114 TTCTTTTTTGAGATGGAGTCTGG - Intronic
978575940 4:110189953-110189975 TTTTTTTTTGAGATGGAGTCTGG - Intronic
978738893 4:112115356-112115378 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
979302502 4:119102963-119102985 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
979390362 4:120120103-120120125 ATGATTTCAGAAATGGAGTCTGG + Intergenic
979980794 4:127252725-127252747 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
980135024 4:128850299-128850321 TTTTTTTTTGAGATGGAGTCTGG - Intronic
980152660 4:129067520-129067542 TTGTTTTTTGAGATAGAGTCTGG + Intronic
980939305 4:139258283-139258305 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
981251765 4:142611653-142611675 TTTTTTTTTGAGATGGAGTCTGG + Intronic
981465072 4:145058627-145058649 ATTATTTAAGAGATGTAGTCTGG - Intronic
981620601 4:146693662-146693684 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
982149521 4:152437365-152437387 TTTTTTTTTGAGATGGAGTCTGG - Intronic
982363897 4:154553993-154554015 ATTTTTTTTGAGACGGAGTCTGG + Intergenic
982406822 4:155030040-155030062 ATGTTTTAAAAGATCTAGTGAGG + Intergenic
982511018 4:156283428-156283450 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
982737348 4:159020106-159020128 TTTTTTTTAAAGATGGAGTCTGG - Intronic
982854561 4:160364396-160364418 AGATTTTAAGAGCTGGAGTTGGG - Intergenic
982920301 4:161266354-161266376 TTTTTTTATGAGATGGAGTCTGG - Intergenic
983016138 4:162614926-162614948 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
983027913 4:162759786-162759808 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
983199499 4:164845447-164845469 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
983294921 4:165854673-165854695 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
983420362 4:167508237-167508259 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
984459662 4:180017819-180017841 ATTTTTTTAGAGACAGAGTCTGG + Intergenic
984488471 4:180402115-180402137 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
984508752 4:180653824-180653846 GTGTCTGAAGGGATGGAGTCTGG - Intergenic
984643832 4:182199408-182199430 TTGTTTTTTGAGATGGAGTCTGG - Intronic
984652504 4:182285807-182285829 ATGTTTTCAGAGATGGACCAAGG + Intronic
984736274 4:183111226-183111248 TTATTTTTTGAGATGGAGTCTGG - Intronic
984900964 4:184586059-184586081 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
984969378 4:185173347-185173369 TTTTTTTAAGAGACGGAGTCTGG - Intronic
985009596 4:185568930-185568952 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
985096907 4:186421804-186421826 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
985163210 4:187064801-187064823 TTTTTTTTAGAAATGGAGTCCGG - Intergenic
985208587 4:187568003-187568025 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
985252904 4:188041582-188041604 TTTTTTTATGAGATGGAGTTTGG - Intergenic
985272334 4:188206324-188206346 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1202754523 4_GL000008v2_random:46990-47012 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986189372 5:5480259-5480281 TTTTTTTTTGAGATGGAGTCTGG + Intronic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
987024623 5:13911990-13912012 AGGTTTTAAGTGGTGGATTCTGG - Intronic
987247411 5:16062445-16062467 ATTTTTTTCTAGATGGAGTCTGG + Intergenic
987364795 5:17139279-17139301 ATGTTATAAAAGATGAAGCCTGG - Intronic
987474479 5:18374288-18374310 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
987924793 5:24326475-24326497 TTTTTTAAAGAGATGGGGTCTGG + Intergenic
988088087 5:26497251-26497273 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
988127960 5:27067185-27067207 ATGTTTTAAGGGATGCTATCTGG - Intronic
988242922 5:28636746-28636768 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
988292371 5:29304866-29304888 TTGTGTATAGAGATGGAGTCAGG + Intergenic
988312582 5:29580452-29580474 TTATTTTTTGAGATGGAGTCTGG + Intergenic
988377832 5:30460207-30460229 TTTTTTTTCGAGATGGAGTCTGG - Intergenic
988470745 5:31534864-31534886 TTCTTTTAAGAGATGGGGTCTGG - Intronic
988588191 5:32526098-32526120 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
988787443 5:34578015-34578037 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
988926596 5:35996654-35996676 CTTTTTTAAGAATTGGAGTCAGG + Intergenic
989035093 5:37162689-37162711 TTTTTTTTTGAGATGGAGTCTGG + Intronic
989049397 5:37304236-37304258 TTTTTTTTTGAGATGGAGTCTGG - Intronic
989088477 5:37701772-37701794 TTTTTTTTTGAGATGGAGTCTGG - Intronic
989277011 5:39601283-39601305 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
989514603 5:42327227-42327249 GTATTTTTTGAGATGGAGTCTGG + Intergenic
989603257 5:43219730-43219752 TTTTTTTTTGAGATGGAGTCTGG + Intronic
989604349 5:43229646-43229668 TTTTTTTTTGAGATGGAGTCTGG + Intronic
989715821 5:44461580-44461602 TTGTTTTAAGCAATGGAGTTAGG - Intergenic
990025552 5:51183352-51183374 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
990029426 5:51239296-51239318 ATTTATTTTGAGATGGAGTCTGG + Intergenic
990333871 5:54753508-54753530 TTTTTTTAAGAGATGGGCTCTGG + Intergenic
990405530 5:55486572-55486594 GTATTTTTTGAGATGGAGTCTGG - Intronic
990957996 5:61363083-61363105 ATGTTTTTAGAGATGTTGTAGGG + Intronic
991154802 5:63420510-63420532 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
991308366 5:65206686-65206708 TTTTTTTTTGAGATGGAGTCTGG - Intronic
991467035 5:66924403-66924425 TTTTTTTTTGAGATGGAGTCTGG + Intronic
991539342 5:67709129-67709151 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
991675012 5:69082019-69082041 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
991710754 5:69406028-69406050 TTTTTTTTTGAGATGGAGTCTGG - Intronic
992004311 5:72462555-72462577 TTTTTTTTGGAGATGGAGTCTGG + Intronic
992114501 5:73526568-73526590 ATTTTTTTTGAGATGGAGCCTGG - Intergenic
992146467 5:73854818-73854840 TTTTTTTTTGAGATGGAGTCTGG - Intronic
992239747 5:74755082-74755104 CTCTTTTTTGAGATGGAGTCTGG - Intronic
992256430 5:74925689-74925711 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
992441035 5:76798001-76798023 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
992624852 5:78627639-78627661 ATGTTTGCAGAGAGGGAGTGAGG - Intronic
992792590 5:80226904-80226926 ACTTTTTTTGAGATGGAGTCTGG + Intronic
992868343 5:80980628-80980650 TTATTTTTTGAGATGGAGTCTGG - Intronic
993196341 5:84751624-84751646 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
993597940 5:89882967-89882989 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
993806530 5:92417506-92417528 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
993989549 5:94639050-94639072 TTTTTTTTTGAGATGGAGTCTGG + Intronic
994079287 5:95688427-95688449 ATTTTTATAGAGATGGGGTCTGG + Intronic
994359917 5:98839027-98839049 ATTTTTTTTGAGAGGGAGTCTGG - Intergenic
994701168 5:103137172-103137194 TTTTTTTTTGAGATGGAGTCTGG + Intronic
995197851 5:109393620-109393642 ATTTTTTTAGAGATGGGGTCTGG - Intronic
995246734 5:109943924-109943946 TAGATTTAAGAGATGGAATCTGG + Intergenic
995510133 5:112900847-112900869 TTTTTTTTAGAGATGGAGTCTGG + Intronic
995576477 5:113541201-113541223 TTTTTTTTTGAGATGGAGTCTGG + Intronic
996230565 5:121058650-121058672 ATATTTTCAGAAGTGGAGTCTGG + Intergenic
996472285 5:123874907-123874929 TTGTTTCAAGATATTGAGTCCGG + Intergenic
997327687 5:133035695-133035717 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
997463954 5:134074291-134074313 ATTTATTTTGAGATGGAGTCTGG - Intergenic
997909890 5:137861395-137861417 TTGTTTTTTGAGATGTAGTCTGG + Intergenic
998331006 5:141327169-141327191 TTTTCTTAAGAGATGGGGTCTGG - Intergenic
998480033 5:142455077-142455099 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
998568097 5:143233727-143233749 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
998659347 5:144219222-144219244 TTATTTTTTGAGATGGAGTCTGG + Intronic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
998750379 5:145315079-145315101 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
998835331 5:146197646-146197668 CTTTTTTAAGAGACGGGGTCTGG + Intergenic
998866762 5:146512857-146512879 ATTTTTTAAGGGATCAAGTCGGG + Intergenic
998912440 5:146974699-146974721 TTTTTTTTTGAGATGGAGTCTGG + Intronic
999082439 5:148856985-148857007 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
999292113 5:150432603-150432625 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
999393451 5:151211532-151211554 TTTTTTTTTGAGATGGAGTCTGG + Intronic
999641285 5:153675866-153675888 TTTTTTTTTGAGATGGAGTCTGG + Intronic
999743169 5:154572448-154572470 TTTTTTTAAGAGATGGGGTCTGG - Intergenic
1000183234 5:158833284-158833306 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1000298631 5:159934804-159934826 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1000635632 5:163640843-163640865 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1000694641 5:164365776-164365798 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1000698093 5:164414100-164414122 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1000797246 5:165680195-165680217 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1001115230 5:168933853-168933875 ATGATTTAAGAGGAGGAGCCTGG + Intronic
1001411984 5:171518762-171518784 ATGGACGAAGAGATGGAGTCAGG + Intergenic
1001612411 5:173013561-173013583 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1002154291 5:177264046-177264068 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1002391394 5:178915337-178915359 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1002578489 5:180192754-180192776 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1002721216 5:181262225-181262247 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1002944005 6:1743529-1743551 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1002966033 6:1967128-1967150 ATGTTTTTAGCGAGGGAGGCAGG - Intronic
1003086711 6:3066043-3066065 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1003546589 6:7064525-7064547 ACTTTTTTTGAGATGGAGTCTGG - Intergenic
1003589453 6:7424951-7424973 CTATTTTTTGAGATGGAGTCTGG - Intergenic
1003651093 6:7961161-7961183 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1003848807 6:10201140-10201162 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1003863140 6:10340191-10340213 GTGTTTTAAGAGATCGAGAAAGG - Intergenic
1004214196 6:13686295-13686317 TTATTTTTTGAGATGGAGTCTGG + Intronic
1004224066 6:13770227-13770249 TTTTTTTTAGAGATGGAGTCTGG + Intergenic
1004380255 6:15126581-15126603 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1004395208 6:15241829-15241851 ATGTTTGTAGAGATGGTGTCTGG + Intergenic
1004571125 6:16846287-16846309 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1004651954 6:17618575-17618597 TTTTTTTTAAAGATGGAGTCTGG + Intronic
1004704770 6:18114218-18114240 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1004716041 6:18217388-18217410 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1004734523 6:18391854-18391876 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1004751769 6:18569062-18569084 TTTTTTTAAGAGATGGGGTCTGG - Intergenic
1004754230 6:18594125-18594147 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1004774552 6:18828770-18828792 ATGGTTTAATAGATGGAGTTAGG + Intergenic
1005043258 6:21618485-21618507 TTTTTTTAAGAGATGGAGTCTGG - Intergenic
1005480868 6:26254126-26254148 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005572937 6:27163865-27163887 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1005903883 6:30243488-30243510 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1006179132 6:32143406-32143428 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1006353478 6:33539213-33539235 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1006432589 6:34007073-34007095 TTCTTTTTTGAGATGGAGTCTGG - Intergenic
1006530787 6:34651802-34651824 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1007388180 6:41533454-41533476 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1007562158 6:42818910-42818932 ATTTTTTAAGAGAGGTAGTCAGG + Intronic
1007646470 6:43385815-43385837 ATTTTTTAAGAGATAGGGGCCGG + Intergenic
1007660694 6:43484053-43484075 ATTTTTTTAGAGATTGGGTCTGG - Intronic
1007785060 6:44275104-44275126 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1007855155 6:44847976-44847998 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1007891563 6:45298526-45298548 TTTTTTTTTGAGATGGAGTCAGG + Intronic
1007920032 6:45598896-45598918 ATGTTTTAAGTGCTAGAGACAGG - Intronic
1008153623 6:47987786-47987808 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1008314404 6:50022521-50022543 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1008611688 6:53190268-53190290 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1009320240 6:62279080-62279102 TTATTTTTTGAGATGGAGTCTGG - Intronic
1009520415 6:64675437-64675459 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1009748102 6:67846403-67846425 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1009768788 6:68118327-68118349 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1009814008 6:68707097-68707119 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1009818095 6:68763100-68763122 TTCTTTTTTGAGATGGAGTCTGG + Intronic
1009900633 6:69803881-69803903 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1009949751 6:70381652-70381674 TTTTTTTAAGAGATGGAGTCTGG - Intergenic
1010150464 6:72726220-72726242 TTTTTTTTCGAGATGGAGTCTGG + Intronic
1010401686 6:75453508-75453530 ATTTTTTAAGAGAGGGAGAAAGG + Intronic
1011330360 6:86198424-86198446 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1011410963 6:87065653-87065675 TTTTTTTTTGAGATGGAGTCAGG - Intergenic
1011655167 6:89545199-89545221 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1011676323 6:89737733-89737755 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1011686247 6:89826264-89826286 ATTTTTTTTGAGCTGGAGTCTGG - Intergenic
1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG + Intronic
1011930962 6:92712161-92712183 TTTTTTTTAGAGATGGGGTCTGG - Intergenic
1012467230 6:99529515-99529537 GTTTTTTTTGAGATGGAGTCTGG - Intergenic
1012528523 6:100206179-100206201 ATGCTATAAGAGATAGAGCCAGG + Intergenic
1012924531 6:105254216-105254238 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1013104614 6:107016303-107016325 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1013133972 6:107261918-107261940 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1013136657 6:107289074-107289096 ATATTTTAAGAAATGGAGGCCGG + Intronic
1013542509 6:111124365-111124387 TTTTTTTAAGAGACGGAGTCTGG + Intronic
1013562021 6:111315025-111315047 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1014087035 6:117358471-117358493 TTTTTTTTGGAGATGGAGTCTGG + Intronic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1014448062 6:121551937-121551959 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
1014462631 6:121715656-121715678 ATGTATGAGGAGGTGGAGTCAGG + Intergenic
1014565749 6:122945671-122945693 ATGTTATAACAGTTGGAGTATGG - Intergenic
1014623755 6:123701151-123701173 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1014753938 6:125282334-125282356 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015001458 6:128221591-128221613 ATGATTTAAGATATGGAGAAAGG - Intronic
1015244145 6:131059124-131059146 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1015253391 6:131151052-131151074 TTGTTTTTTGAGATGTAGTCTGG + Intronic
1015262675 6:131256383-131256405 ATGAATTAATAGATGGAATCAGG - Intronic
1015640301 6:135325036-135325058 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1015774628 6:136801153-136801175 TTTTTTTAAGAGATGGGGTCTGG - Intergenic
1015993710 6:138975820-138975842 ATTTTTTTTGAGACGGAGTCTGG - Intronic
1016001748 6:139048819-139048841 ATTTTTTTTGAGATGTAGTCTGG - Intergenic
1016082026 6:139867752-139867774 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1016287664 6:142491204-142491226 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1016339945 6:143051575-143051597 TTTTTTTATGTGATGGAGTCTGG - Intergenic
1016430320 6:143977483-143977505 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1016858027 6:148691811-148691833 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1017139061 6:151174118-151174140 AATTTTTAAGAGATGGGGGCTGG - Intergenic
1017501210 6:155025036-155025058 TTATTTTTAGAGACGGAGTCTGG + Intronic
1018017308 6:159724161-159724183 ATTTTTTAAAAAATGGAGACAGG + Intronic
1018223589 6:161606354-161606376 ATGTGGTAAAAGAAGGAGTCTGG + Intronic
1018313484 6:162533957-162533979 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1018450502 6:163902941-163902963 TTGTTTTTTGAGATGGAGTTTGG + Intergenic
1019220993 6:170472713-170472735 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1019234899 6:170603513-170603535 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1019389214 7:776322-776344 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1019554775 7:1623683-1623705 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1019747248 7:2707833-2707855 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1019887942 7:3921786-3921808 ATTTTTATAGAGATGGGGTCTGG - Intronic
1019936578 7:4262039-4262061 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1019952671 7:4386139-4386161 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1019974430 7:4569316-4569338 TTTTTTGAAGAGATGGAGTCTGG + Intergenic
1019988649 7:4676929-4676951 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1020057930 7:5131139-5131161 AATTTTTTTGAGATGGAGTCTGG - Intergenic
1020074883 7:5251377-5251399 TTTTTTTGTGAGATGGAGTCAGG + Intergenic
1020669631 7:11090881-11090903 AGGTTTTAGGAGATTGGGTCAGG + Intronic
1020736382 7:11954059-11954081 GAGTTTTAAGAGTTGGAGTAGGG + Intergenic
1020921242 7:14267498-14267520 ATTTTTTTTGAGACGGAGTCTGG + Intronic
1021146916 7:17100176-17100198 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1021466063 7:20944754-20944776 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1021484227 7:21149160-21149182 ATGTCTTATGATATGGAGTGAGG - Intergenic
1021506563 7:21391795-21391817 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1022077364 7:26985346-26985368 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1022147797 7:27563908-27563930 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1022245928 7:28559326-28559348 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1022544618 7:31174410-31174432 TTGTTTTTTGAGATGGAATCTGG - Intergenic
1022642431 7:32200910-32200932 ATGTTTTAAGAGTCCGAGTTAGG + Intronic
1022749081 7:33204393-33204415 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1023203421 7:37722707-37722729 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1023349563 7:39307160-39307182 ATGTTTTAAGAGGTGGTGGCTGG - Intronic
1023928262 7:44687107-44687129 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1024260002 7:47567017-47567039 TTTTTTTTTGAGATGGAGTCCGG - Intronic
1024432366 7:49303708-49303730 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1024523581 7:50329059-50329081 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1024914834 7:54487731-54487753 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1025042393 7:55658708-55658730 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1025167771 7:56727952-56727974 TTTTTTACAGAGATGGAGTCTGG - Intergenic
1025204229 7:56982444-56982466 TTTTTTTGTGAGATGGAGTCAGG - Intergenic
1025667711 7:63594489-63594511 TTTTTTTGTGAGATGGAGTCAGG + Intergenic
1025719107 7:63993333-63993355 ATTTTTTTTTAGATGGAGTCTGG + Intergenic
1025956229 7:66185272-66185294 TTTTTTTAAGAGATGGGGTGGGG + Intergenic
1025992769 7:66508107-66508129 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1025993546 7:66513630-66513652 ATTTTTTTAGAGATAGGGTCTGG + Intergenic
1026015519 7:66668272-66668294 TTGTTTTTAGAAATGGGGTCTGG + Intronic
1026034870 7:66823800-66823822 ATTTTTTTAGAGATAGGGTCTGG - Intergenic
1026080945 7:67220213-67220235 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1026083991 7:67247894-67247916 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026086374 7:67266509-67266531 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026088788 7:67283376-67283398 ACTTTTTGAGAGGTGGAGTCAGG - Intergenic
1026091367 7:67303068-67303090 ATGTTTTAAAAGATTTATTCAGG + Intergenic
1026121908 7:67545150-67545172 TTTTTTTAAGAGAAGGAGTCTGG - Intergenic
1026121976 7:67545699-67545721 TTTTTTTAAGAGAAGGAGTCTGG + Intergenic
1026313367 7:69207383-69207405 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026475313 7:70729892-70729914 ATGTATTTAGAGACGGACTCTGG + Intronic
1026690774 7:72548320-72548342 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1026693041 7:72566134-72566156 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1026728804 7:72893570-72893592 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1026745056 7:73005404-73005426 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1026767216 7:73167681-73167703 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026772142 7:73209275-73209297 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1026775394 7:73227860-73227882 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1026838798 7:73656450-73656472 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1026859394 7:73775768-73775790 ATGTTTTAATAAATGGAATCAGG - Intergenic
1026891932 7:73987436-73987458 TTTTTTTTAGAGATGGGGTCTGG + Intergenic
1026982026 7:74532540-74532562 TTGTTTTCAGAGATAGGGTCTGG - Intronic
1027013011 7:74762668-74762690 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1027016251 7:74781231-74781253 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1027031168 7:74890099-74890121 ATGTTTTAAAAGATTTATTCAGG - Intergenic
1027043685 7:74977390-74977412 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1027071777 7:75164706-75164728 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1027075030 7:75183366-75183388 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027079962 7:75224968-75224990 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027098684 7:75359676-75359698 ATGTTTTAAAAGATTTATTCAGG + Intergenic
1027114976 7:75471895-75471917 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1027164024 7:75822088-75822110 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1027214879 7:76177320-76177342 ATTTTTTTAGAGATAGGGTCTGG + Intergenic
1027246676 7:76372337-76372359 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1027270230 7:76514892-76514914 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1027310324 7:76948339-76948361 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1027379452 7:77590858-77590880 TTTTTTTAATAGATGGAGGCCGG - Intronic
1027463468 7:78484917-78484939 ATTGTTTAAGATTTGGAGTCAGG - Intronic
1027598133 7:80202100-80202122 TTGTTTTTTGAGATGGAGTCGGG + Intronic
1027837575 7:83264797-83264819 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028575369 7:92343652-92343674 ATGTATTTTGAGATGGGGTCTGG - Intronic
1028593088 7:92519234-92519256 CTGTTTTGAGAGATGGGGCCTGG + Intronic
1028978786 7:96943615-96943637 ATATTTTTTGAGATGGATTCTGG - Intergenic
1029082454 7:97985405-97985427 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1029100006 7:98121618-98121640 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1029143530 7:98429292-98429314 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1029241815 7:99168520-99168542 CTTTTTTAAGAGATAGGGTCTGG + Intergenic
1029248025 7:99216571-99216593 TTTTTTTGTGAGATGGAGTCTGG + Intergenic
1029260986 7:99302701-99302723 ATGTTTTTAGAGACAGAGTCTGG - Intergenic
1029270959 7:99376195-99376217 ATTTATTTAGAGACGGAGTCTGG - Intronic
1029319042 7:99741189-99741211 ATGTTTTTTGAGATGCTGTCTGG - Intergenic
1029399782 7:100336488-100336510 ATGTTTTAAAAGATTTATTCAGG + Intronic
1029462501 7:100704526-100704548 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1029521284 7:101064295-101064317 GTGGTGGAAGAGATGGAGTCAGG - Intergenic
1029571137 7:101370380-101370402 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1029571417 7:101372175-101372197 TTGTTTTTTGAGACGGAGTCTGG + Intronic
1029581224 7:101437751-101437773 TTTTTTTAAGAGACGGGGTCTGG + Intronic
1029633033 7:101765062-101765084 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1029732786 7:102448703-102448725 TTTTTTTTTGAGATGGAGTCTGG - Exonic
1029894639 7:103970152-103970174 TTTTTTTTAGAGATGGAGTCTGG + Intronic
1029949580 7:104568801-104568823 ATGCTTTAGGAGATGAATTCTGG - Intronic
1030520200 7:110589050-110589072 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1030770695 7:113471274-113471296 ATTTTTTAAGAAATGGTGTTGGG - Intergenic
1030878555 7:114846882-114846904 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1030930141 7:115512594-115512616 GTGCTTTAGGAGATGGAGGCAGG - Intergenic
1030981418 7:116188855-116188877 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1031430907 7:121667628-121667650 ATATCTTAAGAAATGAAGTCAGG + Intergenic
1031486484 7:122332641-122332663 ATTTTTTAAAAGATGAAGTATGG - Intronic
1031773822 7:125881372-125881394 ATTTTTTTTGAGATGGAGCCTGG + Intergenic
1032003887 7:128284903-128284925 GTTTTTTTTGAGATGGAGTCTGG - Intergenic
1032055986 7:128684601-128684623 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1032166016 7:129545518-129545540 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1032172984 7:129601256-129601278 TTTTTTTTCGAGATGGAGTCTGG + Intergenic
1032213344 7:129936580-129936602 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1032320298 7:130880267-130880289 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1032333566 7:131003295-131003317 TTTTTTTAAGAGATAGGGTCTGG + Intergenic
1033225413 7:139558688-139558710 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1033271869 7:139939357-139939379 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1033309761 7:140252514-140252536 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1033341768 7:140497743-140497765 ATTTTTTTTGAGATGGAGTCGGG + Intergenic
1033772309 7:144566112-144566134 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1033778006 7:144634599-144634621 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1034043100 7:147899879-147899901 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1034105774 7:148488533-148488555 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1034150959 7:148915032-148915054 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1034280960 7:149853924-149853946 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1034342465 7:150366861-150366883 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1034360019 7:150486997-150487019 TTTTTTTCAGAGATGGAGGCAGG + Intergenic
1034655068 7:152722653-152722675 TTGTTTGTAGAGATGGGGTCTGG + Intergenic
1034698678 7:153077740-153077762 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1034854202 7:154525324-154525346 TTTTTTGAAGAGACGGAGTCTGG + Intronic
1035821265 8:2594752-2594774 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1035855948 8:2976524-2976546 TTTTTTGTAGAGATGGAGTCTGG + Intronic
1035871641 8:3141807-3141829 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG + Intronic
1036020110 8:4834943-4834965 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1036132932 8:6133281-6133303 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1036516401 8:9448009-9448031 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1036530022 8:9576480-9576502 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1036647553 8:10621336-10621358 CTTTTTTTTGAGATGGAGTCTGG + Intronic
1036943602 8:13073713-13073735 TTGTTTTCAGAGATGGGATCTGG - Intergenic
1036947022 8:13103826-13103848 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1037245422 8:16829509-16829531 ATTTATTTAGACATGGAGTCTGG + Intergenic
1037339287 8:17825350-17825372 TTCTTTTCTGAGATGGAGTCTGG - Intergenic
1037359958 8:18062880-18062902 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1037790971 8:21941327-21941349 TTTTTTTTAGAGATGGGGTCTGG + Intronic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038348111 8:26750607-26750629 ATGTTTTAACATATGGATTTTGG + Intronic
1038366971 8:26946417-26946439 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1038529092 8:28302908-28302930 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1038656619 8:29458401-29458423 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1038975523 8:32691339-32691361 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1039481794 8:37879302-37879324 GTTTTTTTTGAGATGGAGTCTGG - Intronic
1039741512 8:40387099-40387121 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1039868650 8:41528009-41528031 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1039941246 8:42093149-42093171 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1039942891 8:42106598-42106620 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
1040045017 8:42953550-42953572 TTTTTTTCTGAGATGGAGTCTGG - Intronic
1040055392 8:43053023-43053045 ATTTTTTTAGAGTTGGGGTCTGG + Intronic
1040432694 8:47359793-47359815 ATTTTTTAAGAGAAAGAGGCTGG - Intronic
1040664950 8:49620828-49620850 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1040873524 8:52125665-52125687 TTTTTTTTAGAGATGGGGTCTGG + Intronic
1040940709 8:52830034-52830056 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1041232321 8:55766386-55766408 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1041326542 8:56672297-56672319 ATGAGTTAATAGATGGGGTCTGG + Intergenic
1041515176 8:58691794-58691816 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1041609944 8:59833854-59833876 ATGTTTTCAGATATGCATTCAGG + Intergenic
1041772873 8:61490947-61490969 TTTTTTTTGGAGATGGAGTCTGG - Intronic
1041928612 8:63264212-63264234 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1042053252 8:64733956-64733978 ATATTTTTTGAGATGGGGTCTGG - Intronic
1042369514 8:67975713-67975735 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1042544391 8:69937969-69937991 TTTTTTTTTGAGATGGAGTCAGG - Intergenic
1042551978 8:70002168-70002190 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1042553798 8:70017418-70017440 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1042711908 8:71726649-71726671 ATGTTTTGAGAACTGGAGTAGGG + Intergenic
1043313178 8:78887212-78887234 ATGTCTTAAGAGTTGCAGACAGG - Intergenic
1043421811 8:80105741-80105763 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1043442336 8:80287313-80287335 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1043465995 8:80507600-80507622 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1043632570 8:82354648-82354670 ATGTTTTAGGAAATGGAGGTGGG + Intergenic
1043814389 8:84783952-84783974 ATGATTTCAGAGTTGGAGGCAGG - Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044462182 8:92458415-92458437 ATGTGTTGAGTGATGGAGGCTGG - Intergenic
1044540346 8:93401890-93401912 ATGTGTTAAGAGAAGAAGTCAGG + Intergenic
1044671174 8:94682376-94682398 TTGTTTTTTGAGATGTAGTCTGG + Intronic
1044848996 8:96409398-96409420 TTCTTTTTGGAGATGGAGTCTGG - Intergenic
1044856534 8:96481699-96481721 TTTGTTTCAGAGATGGAGTCTGG - Intergenic
1044982044 8:97726772-97726794 TTGTTTTAAGAGATGGCAGCTGG + Exonic
1045038843 8:98201394-98201416 ATTTTTTTAGAGATGGGGTCCGG + Intronic
1045213791 8:100126794-100126816 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1045267854 8:100635539-100635561 TTTTTTTAAGAGATGAAGTCTGG - Intronic
1045274382 8:100689439-100689461 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1045435249 8:102156945-102156967 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1045725519 8:105168760-105168782 ATATTTTAAGTGGTGGAGGCAGG + Intronic
1045801791 8:106110554-106110576 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1046354698 8:113066562-113066584 ATGTATTGAGAGCTGGAATCTGG - Intronic
1046457246 8:114482984-114483006 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1046466011 8:114604339-114604361 ATGTTCAAAGAGATGGATTCAGG - Intergenic
1046532766 8:115469508-115469530 GTTTTTTTTGAGATGGAGTCTGG + Intronic
1046560667 8:115833085-115833107 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1046923742 8:119764132-119764154 ATTTTTTTTGAGATGGAGTCTGG - Intronic
1047014000 8:120703134-120703156 TTTTTTTGAGAGATGGAGTCTGG + Intronic
1047106333 8:121734595-121734617 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1047236144 8:123043272-123043294 CTTTTTTTTGAGATGGAGTCTGG - Intronic
1047505685 8:125477627-125477649 ATTTTCTTTGAGATGGAGTCTGG + Intergenic
1047624036 8:126637322-126637344 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1047792609 8:128220003-128220025 ATGTTTTAAGAGATTCACTCTGG + Intergenic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1049522384 8:143100242-143100264 TTCTTTTTTGAGATGGAGTCTGG + Intergenic
1049627255 8:143630500-143630522 TTATTTTTTGAGATGGAGTCTGG - Intergenic
1049723568 8:144133707-144133729 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1049723680 8:144134995-144135017 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1049727786 8:144158002-144158024 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1049729660 8:144169652-144169674 ATGTTTTTTGAGATGGAATTTGG + Intronic
1049729684 8:144169843-144169865 ATGTTTTTTGAGATGGAATTTGG + Intronic
1049954639 9:681034-681056 TTTTTTGTAGAGATGGAGTCTGG - Intronic
1050317539 9:4418685-4418707 TTGTTTTTTGAGATGGACTCTGG - Intergenic
1050523902 9:6529134-6529156 GTTTTTTTTGAGATGGAGTCTGG + Intergenic
1050604960 9:7291065-7291087 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1050934143 9:11372485-11372507 ATGTTTTAAGAAATTGACTTTGG + Intergenic
1051168723 9:14295617-14295639 TTGTTTTTTGAGAAGGAGTCTGG - Intronic
1051341264 9:16113036-16113058 TTGAGTTAAGAGATGGAGACTGG + Intergenic
1051414267 9:16822079-16822101 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1051472855 9:17468896-17468918 ATGTCTTAATAGATGAATTCAGG + Intronic
1051633060 9:19157765-19157787 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1051750826 9:20339180-20339202 TTTTTTTATGAGACGGAGTCTGG - Intergenic
1051840643 9:21393536-21393558 CTTTTTTTTGAGATGGAGTCTGG - Intergenic
1052015466 9:23459293-23459315 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1052110034 9:24571173-24571195 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1052301949 9:26962002-26962024 CTGTTTCAAGAGGTGGAGTTGGG + Exonic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1052793267 9:32897887-32897909 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1052844593 9:33323993-33324015 GTGCTTTGAGAGATGGAGGCAGG + Intronic
1052906927 9:33843488-33843510 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1053389103 9:37720655-37720677 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1053519445 9:38763306-38763328 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1053543645 9:39000029-39000051 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1053574665 9:39346149-39346171 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1053601327 9:39612598-39612620 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053793985 9:41708492-41708514 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1053808071 9:41823531-41823553 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1053839228 9:42174396-42174418 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1053858974 9:42366394-42366416 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054096229 9:60904839-60904861 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1054117688 9:61180775-61180797 TTTTTTTTGGAGATGGAGTCTGG + Intergenic
1054151185 9:61606356-61606378 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054182396 9:61920510-61920532 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1054252209 9:62729840-62729862 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054470965 9:65537468-65537490 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054566324 9:66764339-66764361 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1054590066 9:67001791-67001813 TTTTTTTTGGAGATGGAGTCTGG - Intergenic
1054622521 9:67363897-67363919 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1054656114 9:67667969-67667991 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054774869 9:69116776-69116798 ATTTATTTAGAGATGGAGTCTGG + Intergenic
1054776516 9:69128532-69128554 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1054840688 9:69735780-69735802 ATGGTATAAGAGCTGGATTCTGG - Intronic
1054946944 9:70805520-70805542 TTTTTTTTCGAGATGGAGTCTGG - Intronic
1055039635 9:71855483-71855505 TTCTTTTCTGAGATGGAGTCTGG + Intergenic
1055174653 9:73302129-73302151 ATGTTATTAGAGATAGAGTTTGG + Intergenic
1055492116 9:76815912-76815934 ACGTTTTAAGAGGTTGAGGCGGG + Intronic
1055739389 9:79369135-79369157 ATTTATTTAGAGATGGAGTCTGG - Intergenic
1056465283 9:86847784-86847806 ATTTTTTTTGAGACGGAGTCTGG - Intergenic
1056534816 9:87518121-87518143 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1056801620 9:89696164-89696186 TTGTTTTTTGAGACGGAGTCTGG + Intergenic
1056855147 9:90121390-90121412 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1056988144 9:91384553-91384575 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1057396840 9:94688316-94688338 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1057408940 9:94799388-94799410 TTTTTTTAAGAGATGGGGTCTGG - Intronic
1057504444 9:95621191-95621213 TTATTTTTTGAGATGGAGTCTGG + Intergenic
1057595421 9:96411837-96411859 TTGTTTTTTGAGATGGACTCTGG + Intronic
1057795601 9:98155356-98155378 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1058777923 9:108303398-108303420 TTGTTTTCAGTTATGGAGTCTGG - Intergenic
1058788886 9:108421215-108421237 CTGTTTTTAGAGATAGAGTCTGG - Intergenic
1058872743 9:109216634-109216656 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1059195035 9:112363181-112363203 ATAATTTTTGAGATGGAGTCAGG + Intergenic
1059311702 9:113392827-113392849 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1059313278 9:113403008-113403030 ATGTTTCAAAAGGTGGAGGCTGG - Intergenic
1059677459 9:116553052-116553074 ATCTTTTAAGATATGCAGCCAGG - Intronic
1059790477 9:117636820-117636842 AGGTTTTAAGAAATGGTGCCAGG + Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1059916538 9:119109638-119109660 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1059969277 9:119648294-119648316 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1060126458 9:121052438-121052460 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1060297377 9:122352001-122352023 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1060598656 9:124863164-124863186 ATATTTTTTGAGATGGAGTCTGG + Intronic
1060957110 9:127649874-127649896 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1060963159 9:127695713-127695735 CTGTTTTAAAAGAAGGGGTCGGG - Intronic
1061041089 9:128140962-128140984 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1061057032 9:128228969-128228991 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1061067462 9:128287439-128287461 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1061143756 9:128784861-128784883 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1061182855 9:129035254-129035276 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1061613365 9:131763152-131763174 TTGTTTGAGGAGATGGGGTCTGG - Intergenic
1061632889 9:131884617-131884639 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1061696676 9:132381203-132381225 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1061746983 9:132747457-132747479 TTTTTTTCTGAGATGGAGTCTGG + Intronic
1062415318 9:136446115-136446137 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1062458520 9:136652753-136652775 ATTCATTTAGAGATGGAGTCTGG - Intergenic
1062683326 9:137796690-137796712 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1062726959 9:138079729-138079751 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1062734635 9:138128731-138128753 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1203628637 Un_KI270750v1:49686-49708 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1185486703 X:487097-487119 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1185511707 X:668572-668594 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1185608929 X:1382761-1382783 TTTTTTTTGGAGATGGAGTCAGG + Intergenic
1185684711 X:1918799-1918821 ATTTTATTAGAGATGGAGTTTGG + Intergenic
1185710713 X:2301399-2301421 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1185789598 X:2918726-2918748 TTGTTTTTTGAGACGGAGTCTGG - Intronic
1185837587 X:3359762-3359784 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1185862062 X:3588974-3588996 ATGTTTTTTGAGATGCAGTTGGG - Intergenic
1185869551 X:3652404-3652426 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1186192608 X:7080905-7080927 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1186430031 X:9497395-9497417 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1186467986 X:9799177-9799199 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1187117825 X:16371351-16371373 TTGCTTTTTGAGATGGAGTCTGG + Intergenic
1187197442 X:17101063-17101085 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1187399321 X:18945941-18945963 TTATTTTTTGAGATGGAGTCTGG + Intronic
1187518431 X:19992337-19992359 ATTTATTTAGAGATAGAGTCTGG + Intergenic
1187706828 X:22017610-22017632 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1187902385 X:24036861-24036883 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1187927113 X:24260620-24260642 ATTTTTAAAGAGATGGGGTCTGG + Intergenic
1188011134 X:25057329-25057351 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1189068504 X:37837549-37837571 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1189074065 X:37897469-37897491 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1189087055 X:38036292-38036314 TTATTTTTTGAGATGGAGTCTGG - Intronic
1189305958 X:39986813-39986835 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1189381255 X:40503980-40504002 ATTTTTTAAGAGATGAAATTGGG - Intergenic
1189627244 X:42912220-42912242 ATGTATTAAGAGAAGGGCTCTGG + Intergenic
1189914614 X:45844607-45844629 ATTTTTTGAGAGACGGAGTCTGG + Intergenic
1190100838 X:47521767-47521789 ATTTTTTTAGAGATAGAGTCTGG - Intergenic
1190104082 X:47546169-47546191 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1190234218 X:48603634-48603656 TTTTTTTAAGAGATGGAGTCTGG - Intronic
1190390738 X:49928911-49928933 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1190558764 X:51666704-51666726 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1190780943 X:53594083-53594105 GTTTTTTTTGAGATGGAGTCTGG - Intronic
1190848366 X:54215103-54215125 TTTTTTTTTGAGATGGAGTCTGG - Intronic
1190868394 X:54404348-54404370 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1191997498 X:67111911-67111933 CTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192041409 X:67626452-67626474 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1192322987 X:70107308-70107330 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192705753 X:73527659-73527681 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1192893111 X:75411218-75411240 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1193095504 X:77544005-77544027 ATGTGTTATGAGATGGTGTTAGG + Intronic
1193749866 X:85328214-85328236 TTATTTTTTGAGATGGAGTCTGG + Intronic
1194715822 X:97286050-97286072 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1194802186 X:98287716-98287738 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1194900389 X:99502639-99502661 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1195165309 X:102214294-102214316 ATGTGTTAAGAAATTAAGTCAGG + Intergenic
1195193549 X:102472797-102472819 ATGTGTTAAGAAATTAAGTCAGG - Intergenic
1195267511 X:103196941-103196963 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1195689410 X:107611659-107611681 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1195697534 X:107677973-107677995 TTGTTTTTTGAGACGGAGTCTGG - Intergenic
1196333114 X:114495469-114495491 ATTTTTTAAAAGATGAATTCTGG - Intergenic
1196602695 X:117620652-117620674 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1196669872 X:118354404-118354426 TTTTTTTAAGAGACAGAGTCTGG - Intronic
1196731283 X:118943778-118943800 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1196836616 X:119819854-119819876 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1197231736 X:124012172-124012194 ATGTTTTAAATGATGAATTCTGG + Intronic
1197707448 X:129644571-129644593 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1198307608 X:135398591-135398613 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1198873432 X:141199114-141199136 CTGTTTTAAAAGAAGGGGTCGGG + Intergenic
1198920282 X:141718079-141718101 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1198926116 X:141798325-141798347 TTGTTTTTTGAGATGGAGTTTGG + Intergenic
1198974013 X:142314665-142314687 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1199158961 X:144585587-144585609 TTGTTTTTTGAGATGGAGTTTGG - Intergenic
1199410742 X:147519533-147519555 TTTTTTTCGGAGATGGAGTCTGG + Intergenic
1199770823 X:150974144-150974166 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1199775359 X:151006330-151006352 ATTTTTTAAGAGACAGGGTCTGG + Intergenic
1199969365 X:152847872-152847894 TTTTTTTTTGAGATGGAGTCTGG + Intronic
1200259205 X:154603173-154603195 ATTTCTTGAGAGATGGGGTCTGG + Intergenic
1200380349 X:155830810-155830832 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1200780994 Y:7215557-7215579 TTGTTTTTTGAGATGGGGTCAGG + Intergenic
1200806343 Y:7437150-7437172 TTGTTTTTCGAGATGGAGTCTGG - Intergenic
1201263068 Y:12179349-12179371 TTTTTTTTTGAGATGGAGTCTGG + Intergenic
1201632506 Y:16084597-16084619 TTTTTTTTTGAGATGGAGTCTGG - Intergenic
1201914166 Y:19164813-19164835 TTTTTTTCTGAGATGGAGTCTGG - Intergenic
1201948722 Y:19540291-19540313 TTGTTTTTTCAGATGGAGTCTGG - Intergenic