ID: 1011694617

View in Genome Browser
Species Human (GRCh38)
Location 6:89901017-89901039
Sequence ATCCACCCGCCTCAAAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011694616_1011694617 -10 Left 1011694616 6:89901004-89901026 CCGACTTCAGGCGATCCACCCGC No data
Right 1011694617 6:89901017-89901039 ATCCACCCGCCTCAAAGTGTTGG No data
1011694613_1011694617 9 Left 1011694613 6:89900985-89901007 CCAGGCTGGTCTCGAAATCCCGA 0: 10
1: 1844
2: 60654
3: 170405
4: 227648
Right 1011694617 6:89901017-89901039 ATCCACCCGCCTCAAAGTGTTGG No data
1011694615_1011694617 -9 Left 1011694615 6:89901003-89901025 CCCGACTTCAGGCGATCCACCCG 0: 15
1: 1164
2: 18220
3: 64761
4: 97035
Right 1011694617 6:89901017-89901039 ATCCACCCGCCTCAAAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011694617 Original CRISPR ATCCACCCGCCTCAAAGTGT TGG Intergenic
No off target data available for this crispr