ID: 1011696177

View in Genome Browser
Species Human (GRCh38)
Location 6:89915410-89915432
Sequence ACACATAGACTGAAAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011696177_1011696179 9 Left 1011696177 6:89915410-89915432 CCCTCTACTTTCAGTCTATGTGT No data
Right 1011696179 6:89915442-89915464 ACTGTGACATGAGTTTCTTTAGG No data
1011696177_1011696180 23 Left 1011696177 6:89915410-89915432 CCCTCTACTTTCAGTCTATGTGT No data
Right 1011696180 6:89915456-89915478 TTCTTTAGGCAGCATATAGTTGG No data
1011696177_1011696181 24 Left 1011696177 6:89915410-89915432 CCCTCTACTTTCAGTCTATGTGT No data
Right 1011696181 6:89915457-89915479 TCTTTAGGCAGCATATAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011696177 Original CRISPR ACACATAGACTGAAAGTAGA GGG (reversed) Intergenic
No off target data available for this crispr