ID: 1011696180

View in Genome Browser
Species Human (GRCh38)
Location 6:89915456-89915478
Sequence TTCTTTAGGCAGCATATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011696178_1011696180 22 Left 1011696178 6:89915411-89915433 CCTCTACTTTCAGTCTATGTGTA No data
Right 1011696180 6:89915456-89915478 TTCTTTAGGCAGCATATAGTTGG No data
1011696177_1011696180 23 Left 1011696177 6:89915410-89915432 CCCTCTACTTTCAGTCTATGTGT No data
Right 1011696180 6:89915456-89915478 TTCTTTAGGCAGCATATAGTTGG No data
1011696176_1011696180 27 Left 1011696176 6:89915406-89915428 CCATCCCTCTACTTTCAGTCTAT No data
Right 1011696180 6:89915456-89915478 TTCTTTAGGCAGCATATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011696180 Original CRISPR TTCTTTAGGCAGCATATAGT TGG Intergenic
No off target data available for this crispr