ID: 1011697732

View in Genome Browser
Species Human (GRCh38)
Location 6:89928003-89928025
Sequence TACAATGCCCTGTGTGGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011697732_1011697737 29 Left 1011697732 6:89928003-89928025 CCAACTCCACACAGGGCATTGTA 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1011697737 6:89928055-89928077 TCCAACACAGTCTTCAGTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 159
1011697732_1011697739 30 Left 1011697732 6:89928003-89928025 CCAACTCCACACAGGGCATTGTA 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1011697739 6:89928056-89928078 CCAACACAGTCTTCAGTTTGGGG 0: 1
1: 1
2: 0
3: 10
4: 197
1011697732_1011697736 28 Left 1011697732 6:89928003-89928025 CCAACTCCACACAGGGCATTGTA 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1011697736 6:89928054-89928076 TTCCAACACAGTCTTCAGTTTGG 0: 1
1: 0
2: 1
3: 8
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011697732 Original CRISPR TACAATGCCCTGTGTGGAGT TGG (reversed) Exonic
911509763 1:98797199-98797221 TAAAATGCCCTGTGTGGATCAGG + Intergenic
911596833 1:99807440-99807462 TACAATTCCCTGTGTTTTGTTGG + Intergenic
912518052 1:110228177-110228199 TACATGGGCCTGTGTGGAGGAGG - Intronic
913093519 1:115495847-115495869 CACAGTGCCCTGGGTGGGGTGGG - Intergenic
914320790 1:146557578-146557600 TACAATGCATTTTGTGGACTTGG + Intergenic
920845541 1:209590304-209590326 TCCCATGCCCTGTGTGGTGGAGG - Intronic
924614703 1:245603116-245603138 TACAATGCCCAGGCAGGAGTAGG - Intronic
1064040337 10:11957106-11957128 CACCATGCCCAGTATGGAGTAGG + Intronic
1066161136 10:32730157-32730179 CACAGTGGCCTGTCTGGAGTGGG - Intronic
1066746717 10:38608644-38608666 TATAATTTCCTGTGTGGAGAAGG - Intergenic
1068643412 10:59437053-59437075 TAAAATGCCATGAGTGGAGGAGG - Intergenic
1071045525 10:81370282-81370304 TACAATGGACTTTGTGGACTTGG - Intergenic
1071988420 10:91075710-91075732 TACAATACCATGTTTGGAGGTGG + Intergenic
1073163326 10:101420516-101420538 TCCACTGCCCTGTGTGGATGTGG + Intronic
1076333734 10:129691294-129691316 GACAAGGCTCTGTGTGGACTGGG - Intronic
1078478299 11:11653437-11653459 CACAATGCCCGGTGTGGAGTAGG - Intergenic
1080073948 11:28125944-28125966 TACATAGCCATGTGTGGATTTGG - Intronic
1080126292 11:28737937-28737959 TACAGTGGCATGTTTGGAGTCGG + Intergenic
1081017912 11:37906639-37906661 TACCATGCCCTGTTAGGAATGGG + Intergenic
1081225472 11:40516917-40516939 TACAATGCTCTGTGCAGTGTAGG - Intronic
1084150825 11:67287191-67287213 AGCAAAGCCCTGTGTGGAGTGGG - Intergenic
1084547259 11:69820610-69820632 CACACTGCCCTGTGTGTATTGGG - Intergenic
1085620166 11:78032000-78032022 AAGAATTCCCTGGGTGGAGTGGG - Intronic
1087345184 11:96963135-96963157 TACAATGTGCTGTGTGAAGATGG + Intergenic
1087563036 11:99815647-99815669 TGCAGTGCCCTGTGTGGAGCAGG + Intronic
1089513010 11:119012495-119012517 TTTAATGTCCTGTGTTGAGTTGG - Intronic
1089613552 11:119682833-119682855 TACAGTGTCCAGTATGGAGTAGG - Intronic
1090132302 11:124157588-124157610 TACAATGGACTTTGTGGACTTGG + Intergenic
1090562852 11:127951317-127951339 TACAAAGCCCAGTGTAGATTGGG - Intergenic
1090653867 11:128827698-128827720 TCCAAGGCCCTGGGTGGAATCGG - Intergenic
1091294395 11:134463229-134463251 TACAATGCCCATTGTATAGTAGG + Intergenic
1091999321 12:5019533-5019555 TGCAATGCAGTGTGTTGAGTGGG + Intergenic
1093905604 12:24688678-24688700 TGCAATCCCCTCTGTGGAATTGG + Intergenic
1094524028 12:31219909-31219931 GAGCCTGCCCTGTGTGGAGTAGG + Intergenic
1100107063 12:91188451-91188473 AAAAATGCCCTGTGTGAAGTCGG + Intergenic
1100252878 12:92848257-92848279 TACAAAGCCCTGTTTGCAGGAGG + Intronic
1100614671 12:96221835-96221857 TAAAATGCCCTGTGGGTAATTGG + Intronic
1101588181 12:106103158-106103180 CACCATGCCCTGTGTGGCCTTGG - Intronic
1106300551 13:28460430-28460452 AACAGGGCCTTGTGTGGAGTAGG + Intronic
1106306638 13:28517008-28517030 TACAATGCACTTTGGGGATTTGG + Intergenic
1108817344 13:54307974-54307996 TACAATGGCCTTTGGGGACTTGG + Intergenic
1113139625 13:107132825-107132847 TGAAATGCCCTGTGTGGTGAAGG - Intergenic
1113191329 13:107750244-107750266 GACGATGCCCTGTGTGGAGCTGG - Intronic
1114528562 14:23381150-23381172 TGCAAAGCCCAGTGGGGAGTGGG + Intergenic
1114559958 14:23582473-23582495 GACAAGGCTCTGTGTGGAGAAGG - Intergenic
1114890676 14:26918497-26918519 TACAATGACCTCAGAGGAGTGGG - Intergenic
1117096351 14:52302493-52302515 TACAATGGACTTTGGGGAGTGGG - Intergenic
1118870030 14:69733759-69733781 CACAATGCCCTGTGGGCACTGGG + Intronic
1122945675 14:105007685-105007707 TCTCATGCCCTGTGTGGAGGTGG - Intronic
1128302862 15:66577999-66578021 TAGAAACACCTGTGTGGAGTGGG - Intergenic
1129061203 15:72861679-72861701 TGTAATGGCCTGTGTGGAGCAGG - Intergenic
1130376796 15:83336505-83336527 TGCTATGCCCTGTGTAGAGTGGG - Intergenic
1130397292 15:83513710-83513732 TACCATGCCCTGGGTAGAGTGGG - Intronic
1130927274 15:88395227-88395249 TACAAGATCCTGTGTGGAGTAGG - Intergenic
1131044765 15:89305263-89305285 TACAATACCCTGTGTGGGGATGG + Intronic
1134930754 16:18205882-18205904 TACAATGGACTGTGGGGACTCGG + Intergenic
1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG + Intergenic
1137584832 16:49658216-49658238 TGCACTGCCCTGTCTGGAGGGGG - Intronic
1139957898 16:70701807-70701829 TAGAATGCCGTGAGTGGAGGAGG - Intronic
1140531329 16:75669159-75669181 TACAAAGCCCAGTGTGGTGGTGG + Intronic
1141220891 16:82068464-82068486 AACAGTGCCCAGAGTGGAGTGGG - Intronic
1141907656 16:87038191-87038213 TCAAATGCTCTGTGTGGAGCTGG - Intergenic
1143032397 17:3975016-3975038 TACAATGACCTTCGTGCAGTGGG - Intergenic
1146083180 17:29801748-29801770 CACAATGCCCTATGTGCAGATGG + Intronic
1149640798 17:58201236-58201258 TACCAGGCGCTGTGTGAAGTGGG - Intronic
1151074970 17:71260812-71260834 AACAGTGCCCGGTGTAGAGTAGG + Intergenic
1153168434 18:2288089-2288111 TACAATGCACTTTGGGGACTTGG - Intergenic
1156465909 18:37347754-37347776 TGCAACCCCCTGTGTGGTGTGGG - Intronic
1156857540 18:41799795-41799817 TAAAATGCAGTGTGTGCAGTAGG + Intergenic
1157144916 18:45152293-45152315 TACAATGGACTTTGTGGACTTGG - Intergenic
1157931076 18:51824118-51824140 TACAATGCCAGGTGTAAAGTGGG + Intergenic
1160748848 19:724232-724254 TACAGGGCCCTTTGTGGTGTGGG - Intronic
1162638778 19:11990757-11990779 TACAATGGACTGTGGGGACTGGG + Intergenic
1164383504 19:27754637-27754659 GAGAATGCCTTGTGTTGAGTGGG + Intergenic
1164526083 19:29014641-29014663 TCCCATGCCCTCTGTGGATTGGG - Intergenic
925526866 2:4813051-4813073 TAAATTGCCCAGTCTGGAGTAGG - Intergenic
926515768 2:13843553-13843575 TACAATGGACTGTGGGGACTTGG + Intergenic
927393921 2:22627596-22627618 CACAGTACCTTGTGTGGAGTGGG - Intergenic
928580363 2:32701166-32701188 TACACTGCCATGTAGGGAGTAGG + Intronic
929067519 2:37993750-37993772 TACAATGCCTGGTGGGGGGTGGG + Intronic
929501514 2:42494348-42494370 TTCAAAGCCCAGTGTGGACTCGG + Intergenic
931622229 2:64222328-64222350 TAAAATGCCTGGTATGGAGTAGG - Intergenic
932621805 2:73269234-73269256 TAGCCTGCCCTGTGAGGAGTTGG - Exonic
933446426 2:82385790-82385812 TACAAGGTCCAGTGAGGAGTGGG - Intergenic
936056113 2:109263481-109263503 TAAAATGTCCTCTGTGGATTAGG + Intronic
937390682 2:121483179-121483201 TACCAGGCCCTGTGTGGGGCGGG - Intronic
939171504 2:138701481-138701503 TACAGTACCTTGTGTGTAGTTGG - Intronic
942559679 2:177207360-177207382 TACAGTGCCCTGTCTAGAGCAGG - Intergenic
946361883 2:219223855-219223877 TACAAGGCAGTGAGTGGAGTTGG - Exonic
947116269 2:226774447-226774469 AACTATGTCCAGTGTGGAGTTGG + Intronic
1169603595 20:7290458-7290480 TAAAATGGCGTGTGTGCAGTGGG - Intergenic
1174902072 20:54510703-54510725 TACATTGCCCTGGGTTGTGTTGG + Intronic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1176254426 20:64143564-64143586 CACCATGACCTGTGTGGAGGTGG - Intergenic
1177834295 21:26171838-26171860 CTCCAAGCCCTGTGTGGAGTGGG - Intergenic
1181781810 22:25199291-25199313 CACAATGCCTTGCGTGTAGTAGG + Intergenic
1183705234 22:39471654-39471676 ACCGATGCCCTGTGTGGTGTGGG - Intronic
950437336 3:12987923-12987945 GACAATGCCCAGTGTGGGGTTGG + Intronic
950948685 3:16977064-16977086 CACAATGCCTTGTGTGAACTTGG - Intronic
952040462 3:29255604-29255626 TAGAATGCCTTGTGTGGATCAGG - Intergenic
953052180 3:39354536-39354558 GAGAATGCCCTCTGTGGAGGGGG - Intergenic
954003626 3:47576759-47576781 TACGCTGCCCTCTGTTGAGTCGG + Intronic
957161288 3:76612535-76612557 TACCAGGCCCTGTTTGGGGTAGG + Intronic
959903524 3:111685806-111685828 TACAATGTCTTATTTGGAGTAGG + Intronic
960633143 3:119753826-119753848 TACAATGGACTGTGCGGACTTGG - Intronic
962001498 3:131303279-131303301 TAAAAGGCACTGTGTCGAGTTGG - Intronic
962386769 3:134938225-134938247 TACCAGGCCCTGCCTGGAGTGGG - Intronic
964600669 3:158497416-158497438 TACAATGGACTGTGAGGACTTGG - Intronic
966234305 3:177683751-177683773 TACACTGCCCTGTGTGGTGGTGG + Intergenic
967089635 3:186124646-186124668 TAAAATGTCCTCTGTGGAGCGGG - Intronic
967598656 3:191358114-191358136 TACAAAGACCTGTGAGGATTTGG + Exonic
969304106 4:6315554-6315576 TACAATTCCGTGTGTGGGCTGGG - Intergenic
969984795 4:11197143-11197165 CACATAGCCCTGTGTGGAGATGG + Intergenic
971130559 4:23804619-23804641 TACAAGGCCCTGTATGGTCTGGG + Intronic
971182630 4:24343908-24343930 TACAATGGACTTTGTGGACTTGG - Intergenic
973179107 4:47246081-47246103 TACAATGGACTGTGGGGACTTGG - Intronic
974934522 4:68396922-68396944 TACTCTGCACTGTGTGGACTTGG - Intergenic
980146190 4:128986924-128986946 TACACTGTGCTGTCTGGAGTTGG - Intronic
981752977 4:148110615-148110637 TTCAATGCTCTGTTTGGAATAGG + Intronic
985677337 5:1238812-1238834 GACAAGGCCCTTGGTGGAGTCGG - Intronic
988168791 5:27628760-27628782 TACAATGCACTGTTTAGAATAGG - Intergenic
988992279 5:36683287-36683309 TACAATGACCCTTGTGAAGTTGG - Intronic
989117509 5:37969655-37969677 TACATTGGACTGTGTGGAATAGG + Intergenic
990563138 5:57003714-57003736 TACAATGGACTTTGTGGACTAGG + Intergenic
990918228 5:60933869-60933891 TACAGTGACCTGGGTGGAATTGG - Intronic
991520412 5:67490868-67490890 TAAAAAGCACTGTCTGGAGTTGG - Intergenic
993002774 5:82398623-82398645 AACAACGCCTTGTGTAGAGTAGG + Intergenic
993382760 5:87226737-87226759 TAAAGAGCTCTGTGTGGAGTAGG + Intergenic
996011481 5:118485585-118485607 TACAATGGACTGTGGGGACTTGG + Intergenic
1002291129 5:178201628-178201650 AACAATCCCCAATGTGGAGTTGG + Intergenic
1003682677 6:8271530-8271552 TACAATGCCTGGCCTGGAGTTGG - Intergenic
1005661431 6:28002702-28002724 TACAATGCCCTATTAGGAATGGG - Intergenic
1006722560 6:36167095-36167117 TACAATGGACTGTGGGGACTTGG + Intergenic
1007853840 6:44833789-44833811 TACAGTGCTCTGGGTGGAATTGG - Intronic
1010290792 6:74134394-74134416 TGCATTGCCCTGTGAGGAATTGG + Intergenic
1011145948 6:84217127-84217149 AACAATGCCTGGTGTGTAGTAGG - Intronic
1011697732 6:89928003-89928025 TACAATGCCCTGTGTGGAGTTGG - Exonic
1013356221 6:109348105-109348127 TCCAAGGCCCTGTGTGCACTGGG + Intergenic
1013929346 6:115512256-115512278 TATAATGTCATGTGTTGAGTTGG - Intergenic
1014784050 6:125597741-125597763 CACACGGCCCTGTGTGAAGTGGG + Intergenic
1015112101 6:129604459-129604481 ATCAATGCCCAGTGTGCAGTGGG - Intronic
1015986264 6:138887175-138887197 CACAATGCCCTGTGAGGAAAGGG + Intronic
1017498074 6:154998959-154998981 CACAATGCCCTGGGTAAAGTAGG + Intronic
1017906509 6:158760510-158760532 TGCAAGGCCCTGGGTGGAGCAGG - Intronic
1021183350 7:17533992-17534014 TGCGATGCCCTGTGTGGCCTTGG - Intergenic
1021485107 7:21158799-21158821 TACAAAGCCCTGTGTGAGGAGGG - Intergenic
1022166415 7:27767791-27767813 TAAAGTACCCTTTGTGGAGTAGG - Intronic
1022891811 7:34708783-34708805 TACAATCCCCTGAGTTGAATGGG - Intronic
1023159197 7:37281205-37281227 TACAATGGACTGTGGGGACTTGG + Intronic
1023904428 7:44512333-44512355 TACAAGGGCCTTTGAGGAGTGGG - Intergenic
1025780741 7:64599801-64599823 TACAATGCCCTTTGTGGGAAGGG - Intergenic
1028348850 7:89818609-89818631 TAGAATGAACTGTGTGGTGTTGG - Intergenic
1028609619 7:92695744-92695766 TACAATCCCCTGGGTGGGGAAGG + Intronic
1033790313 7:144785180-144785202 TACAGTGCCCTATGTGGAGGAGG + Intronic
1035016430 7:155770348-155770370 CACAATGACCTGTGTGTAGAGGG + Intronic
1038366751 8:26943808-26943830 TACAATGGACTTTGGGGAGTTGG - Intergenic
1039160557 8:34614053-34614075 TACAATGGACTTTGTGGACTTGG + Intergenic
1039365393 8:36923225-36923247 AACAGTGCCCTGTGCAGAGTAGG - Intronic
1039635990 8:39166212-39166234 TACAATGGACTGTGGGGACTGGG - Intronic
1041038910 8:53826154-53826176 GACAATGCCCTCTGTTGAGAAGG + Intronic
1041998808 8:64096392-64096414 TCGAATGCCACGTGTGGAGTTGG + Intergenic
1044652089 8:94506709-94506731 TGCAATGTCCTGTGGGGAGCAGG + Exonic
1044965611 8:97571091-97571113 CACAATGCCTTGCATGGAGTAGG - Intergenic
1048499231 8:134960691-134960713 CACAATGCCCAGTGTGCAGTAGG - Intergenic
1049917333 9:330894-330916 TACTATGCCCTGGCTGCAGTGGG - Intronic
1058575179 9:106393333-106393355 CACTAAGCCCTGTGTGGTGTAGG + Intergenic
1059713602 9:116892679-116892701 TACAGTGCCCTCTCTGCAGTGGG - Intronic
1059892126 9:118815292-118815314 TACTCTGCACTGTGTGGACTTGG + Intergenic
1061089213 9:128417486-128417508 TGAAATGCCCTGAGGGGAGTGGG + Intronic
1062290339 9:135791594-135791616 TCCCCTGCCCTGTGTGGAGATGG + Intronic
1187586983 X:20674173-20674195 TGCAATTGTCTGTGTGGAGTTGG - Intergenic
1189146783 X:38663376-38663398 TACAATGCACTTTGGGGACTGGG + Intronic
1190220094 X:48507379-48507401 AACAATGGCCTGTATGGAGCTGG - Intergenic
1192432935 X:71124987-71125009 TACTATGCCCTGTGAGGGGAAGG + Exonic
1198510549 X:137346568-137346590 TACAATGGACTGTGGGGACTTGG - Intergenic
1198596598 X:138243013-138243035 TACAATGAACTGTGGGGACTTGG + Intergenic