ID: 1011700186

View in Genome Browser
Species Human (GRCh38)
Location 6:89948578-89948600
Sequence CGCATCATGGCTTCCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011700186_1011700194 29 Left 1011700186 6:89948578-89948600 CCTTGGTAGGAAGCCATGATGCG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1011700194 6:89948630-89948652 ACATCAGGCACGCTCATTCACGG 0: 1
1: 0
2: 0
3: 8
4: 61
1011700186_1011700191 14 Left 1011700186 6:89948578-89948600 CCTTGGTAGGAAGCCATGATGCG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1011700191 6:89948615-89948637 AGTGACTTGCCTTCCACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011700186 Original CRISPR CGCATCATGGCTTCCTACCA AGG (reversed) Intronic
900292214 1:1928348-1928370 CCCAGCCTGGCTTCCTCCCACGG - Intronic
900933732 1:5752606-5752628 CCATTCATGGCCTCCTACCAGGG - Intergenic
902702334 1:18181071-18181093 TGCATCCAGGCTTCCCACCAGGG + Intronic
916635157 1:166660372-166660394 CACATCATTGCTTCTGACCAAGG + Intergenic
1064328710 10:14374326-14374348 GTCCTCATGGCTTCCTCCCACGG + Intronic
1067257097 10:44652013-44652035 CGCATCCTGGCTGCCGCCCAGGG + Intergenic
1067698217 10:48550553-48550575 GGCATGATGGCCTCCTAGCATGG + Intronic
1067772054 10:49133742-49133764 CCCATCAGGGCTTCCTTCCCAGG + Intronic
1073308379 10:102521347-102521369 CACATCATGGGTTCAGACCATGG + Intronic
1078930393 11:15907936-15907958 CCCATCATGGATCCCCACCATGG - Intergenic
1084064976 11:66698874-66698896 CCCTTCATGGCTTCTTCCCAAGG - Intronic
1086972452 11:93098265-93098287 CCCATCATGGCTTGGTACAAGGG - Intergenic
1087260451 11:96005026-96005048 CTCATCATGGCATTCTTCCATGG - Intronic
1091080349 11:132661162-132661184 CGGATCATGGCTACTCACCAGGG - Intronic
1104410821 12:128556264-128556286 CCCATCAAGACTACCTACCATGG + Intronic
1112857218 13:103786603-103786625 CGCAGCATGGCTTCATGCCATGG - Intergenic
1116059059 14:39898104-39898126 CACAGCATTGCTTCTTACCAAGG + Intergenic
1122191090 14:100044290-100044312 CCCATCTTAGCTTCCTCCCAAGG - Intronic
1122624502 14:103077432-103077454 TGCACCAGGGCTTCCTAGCAGGG + Intergenic
1122756967 14:103989449-103989471 CACAGCATGGCCTCCTGCCAAGG - Intronic
1129164461 15:73768398-73768420 CGGATCACTGCTTCCTACCTTGG - Intergenic
1136448382 16:30337825-30337847 TGCATCATGTCATCCTTCCATGG - Intergenic
1138423553 16:56915456-56915478 CGCCTCAGGGCTTGCTACGAGGG + Exonic
1140941385 16:79724471-79724493 CTTATCATGGCCTCCTACAAAGG - Intergenic
1141559377 16:84856860-84856882 CACAGCATGGCTTCTGACCAAGG - Intronic
1142047490 16:87935006-87935028 CGCATCGTGTCATCCTTCCATGG + Intronic
1143319152 17:6056736-6056758 CACACCATTGCTTCCTGCCAGGG + Intronic
1144301124 17:13923675-13923697 CGGAGCATGGCCTCCTTCCATGG - Intergenic
1149623624 17:58064326-58064348 CCCATTCTGGCTTCCTCCCAAGG - Intergenic
1156060840 18:33074338-33074360 CCAATCACTGCTTCCTACCAAGG + Intronic
1163028765 19:14529682-14529704 TGCTTCATGGCTCCCTCCCACGG - Exonic
1165112592 19:33510985-33511007 GGCACCATGGCTACCAACCATGG - Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
927253539 2:21019658-21019680 CACATCATGGCCACCTAGCATGG - Intronic
927492025 2:23527042-23527064 CCCATCCTAGCTTCCTAGCAGGG - Intronic
927520854 2:23697163-23697185 CCCAGCCTGGCTTCCTCCCAAGG + Intronic
929033507 2:37671047-37671069 CGCATCATGGATTGGTACCAGGG - Intronic
937332754 2:121042547-121042569 AGCAGCATGCCTTCCTGCCAGGG + Intergenic
944870664 2:203908531-203908553 TGCATCATCACTTCCTAGCACGG + Intergenic
948122210 2:235539472-235539494 GGCAGCATGGCTTCCTAAAAAGG - Intronic
1170846713 20:19968174-19968196 GGCATCACGGCTTCCTCCCAGGG + Intronic
1172480670 20:35269600-35269622 AGCATCCTGTCTTCCTCCCAGGG + Intronic
1175937008 20:62518552-62518574 AAGATCAGGGCTTCCTACCAAGG + Intergenic
1176179273 20:63741883-63741905 CGCACCAGGGCCTCCTTCCAGGG - Exonic
1179027263 21:37689822-37689844 CACACCATTGCTTCCTATCAGGG + Intronic
1181469978 22:23132281-23132303 CGCTTCAAGGCCTCCTATCATGG + Intronic
949943543 3:9172847-9172869 CGCACCAGGGCCTCCTTCCAGGG - Intronic
953033405 3:39192105-39192127 GGCTTCAGGGCTTCCTCCCAGGG - Intronic
954292953 3:49659333-49659355 CGCATCATGAGTGCCTATCATGG - Intronic
954691012 3:52395550-52395572 CGCATCATGGCTTCTGCCCGAGG - Exonic
959871244 3:111330854-111330876 CCCATCCTGTCTTCCTCCCATGG - Intronic
959980360 3:112509184-112509206 GCCACCATGGCTTCCTCCCAGGG + Intergenic
961562714 3:127741504-127741526 CGCATCGTGGTGTCCTAGCATGG - Intronic
961638596 3:128350352-128350374 CACAGCATGGCTTCCTGCAAGGG - Intronic
973980894 4:56307384-56307406 GGCATCATGGTTTCCTGGCATGG + Intronic
981969580 4:150651236-150651258 CCCATACTGGCTTCATACCAAGG - Intronic
993880160 5:93351862-93351884 TCCACAATGGCTTCCTACCATGG - Intergenic
999132832 5:149297631-149297653 AGCATCATGTTTTCCTAACAAGG + Intronic
1001738783 5:174031932-174031954 CCCACCATGGCTTCCTCCCTGGG - Intergenic
1003859497 6:10309145-10309167 GGCATCATGCCTTCCTTCCCTGG - Intergenic
1011700186 6:89948578-89948600 CGCATCATGGCTTCCTACCAAGG - Intronic
1012730610 6:102875451-102875473 CACATCATTGCCTCTTACCAAGG + Intergenic
1023712439 7:43009293-43009315 AGCATCATGGCTCCCTTCTAGGG + Intergenic
1034639289 7:152589814-152589836 CGCATCATTGCTTTCCACCCCGG - Intergenic
1037895352 8:22648698-22648720 TGCATGATGGCTTCCTCCCAAGG - Intronic
1039707619 8:40023443-40023465 TGGTTCATGGCTTCCTACCAAGG - Intergenic
1053149238 9:35732312-35732334 CGCACCCTCGCTTCCTGCCAGGG - Exonic
1056858967 9:90162055-90162077 CACTTCATGGCTTCCTACACTGG + Intergenic
1059391287 9:114001140-114001162 CTCTTCTTGGCTTCCTACCATGG + Intronic
1191882788 X:65859244-65859266 CACACCAGGGCCTCCTACCAGGG + Intergenic
1191946512 X:66540194-66540216 CACAGCATTGCTTCTTACCAAGG + Intergenic