ID: 1011704816

View in Genome Browser
Species Human (GRCh38)
Location 6:89990204-89990226
Sequence GCACCGACTCCTGTCTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011704816_1011704820 3 Left 1011704816 6:89990204-89990226 CCCTTAGAGACAGGAGTCGGTGC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1011704820 6:89990230-89990252 CTGGGAGTTAACATTTTCATTGG 0: 1
1: 0
2: 4
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011704816 Original CRISPR GCACCGACTCCTGTCTCTAA GGG (reversed) Intronic
909149424 1:71982333-71982355 TCACCATCTCCTGTCCCTAAAGG + Intronic
909262895 1:73517428-73517450 GCAGCCACTCATTTCTCTAAAGG - Intergenic
910165672 1:84325186-84325208 GCCCCCACACCTGTCTCTATTGG - Intronic
912936848 1:114011024-114011046 GCACCGCCTCCTGCTTCTCAGGG + Intergenic
914433703 1:147641615-147641637 GCCTTGACTCCTTTCTCTAAGGG - Intronic
924090891 1:240499626-240499648 ACATCGACCTCTGTCTCTAAAGG - Intronic
1066452808 10:35546911-35546933 GCAGCGCCTCATGTCTGTAAAGG + Intronic
1069622963 10:69849227-69849249 GCAGCCACTTCTGTCTCTGATGG - Intronic
1069776702 10:70931487-70931509 GCAGCGCCTCCTTTCTCAAATGG + Intergenic
1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG + Intronic
1076252447 10:128995177-128995199 TCACCCACTCCTGTCTCTTGGGG - Intergenic
1076909963 10:133382382-133382404 GCCCTAACTCCTGTCTCCAAGGG + Intronic
1089462221 11:118659979-118660001 GCACTGGCTGCTGGCTCTAAAGG - Intronic
1100670768 12:96810134-96810156 CCACCTACTCCTGCCTTTAAAGG + Intronic
1102007315 12:109596979-109597001 GGACCGCCCCCTGTCTCTCAGGG + Exonic
1111657262 13:91169375-91169397 CCACTGACTTCTGTCTCTCAGGG - Intergenic
1119495171 14:75071630-75071652 GCACCGACTGGTGTTTCTGAAGG - Exonic
1122425999 14:101605599-101605621 GCACCTGCTGCTGTCTCTCATGG + Intergenic
1125609249 15:40959755-40959777 CCACCGACTCCTGGCTCTCCAGG - Intergenic
1130106819 15:80935008-80935030 GCACCGCCTCCAGTCTCCACTGG - Intronic
1130645748 15:85725201-85725223 ACACCAACTCCTATCTCTACAGG - Intronic
1130678727 15:85977829-85977851 GCCCCAACTCCTTTCTCTCATGG + Intergenic
1133429973 16:5728371-5728393 GCACGGACTCCTGTGTGCAAAGG + Intergenic
1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG + Intergenic
1135996849 16:27256702-27256724 GCACCATGTCCTGTCTCCAAGGG + Intronic
1137449252 16:48555461-48555483 GCACAGACTCCTCTTTTTAAAGG + Intronic
1137748734 16:50842399-50842421 GGCCTGACTCCTGTTTCTAAAGG - Intergenic
1138376851 16:56570084-56570106 TCACCCACTCCTGTATCTGATGG - Intergenic
1141061482 16:80876273-80876295 GCTCCCACTCCTGTCTCAAACGG - Intergenic
1144385844 17:14748493-14748515 GCACTGAGTCATGTCTGTAAGGG - Intergenic
1146820316 17:35979406-35979428 GCTCTAACTTCTGTCTCTAAAGG - Intronic
1151209843 17:72536386-72536408 GCACAGACTCCTGCCTGTGACGG + Intergenic
1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG + Intronic
1165446580 19:35860158-35860180 GCCCAGACTCCTGGCTCAAAGGG + Intronic
1165711697 19:38015820-38015842 GAAGCAACTCCTGGCTCTAATGG + Intronic
1168665076 19:58198888-58198910 GCACCCATCCCTGTCTTTAATGG - Intronic
932564415 2:72896537-72896559 GCACCGACTCCGGGCACAAAAGG + Intergenic
936950427 2:117972571-117972593 GCACCCACTGCTGTTTCTACAGG - Intronic
937056703 2:118943668-118943690 GCACTAACTTCTTTCTCTAACGG - Intronic
948953436 2:241270213-241270235 GAACCTACTCCTGTGTCTGAGGG + Intronic
1172948076 20:38703782-38703804 GCAGGGACTCCTGTCCATAAGGG - Intergenic
1174883352 20:54304601-54304623 GTACAGGCTCCTGCCTCTAAGGG - Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
960279083 3:115760906-115760928 AGACCCACTCCTGTTTCTAATGG - Intergenic
966807996 3:183821167-183821189 GCCCCGACTCCTGTCTGTCAAGG + Intronic
968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG + Exonic
972405310 4:38740568-38740590 TAACAGAATCCTGTCTCTAAAGG + Intergenic
979549869 4:121978610-121978632 GAACAGACTCCTTTCTCTCATGG + Intergenic
979608409 4:122664340-122664362 TCACCCACTCCTTTCTCTGATGG - Intergenic
984710660 4:182881353-182881375 GCAGCTACTACTGTCTTTAAAGG - Intergenic
991035291 5:62122339-62122361 CCACCAGCTCCTGTCTCTTACGG - Intergenic
995363116 5:111321601-111321623 ACACCCACTGCTGTTTCTAAAGG - Intronic
1011704816 6:89990204-89990226 GCACCGACTCCTGTCTCTAAGGG - Intronic
1015810386 6:137156637-137156659 GAATCCATTCCTGTCTCTAAGGG - Intronic
1018619267 6:165714725-165714747 GCACAGACTCCTGTTTCTTTAGG - Intronic
1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG + Intronic
1019824694 7:3274355-3274377 GAACAGATTCCTGTCTCAAAGGG - Intergenic
1024702839 7:51923421-51923443 GCAGTCACTACTGTCTCTAAAGG + Intergenic
1028718988 7:94007556-94007578 GCACCACCTCCTGTCTCTCTGGG + Intergenic
1031678547 7:124641647-124641669 TCACCCACTCCTGTCACTAAAGG - Intergenic
1036036733 8:5028263-5028285 GCCCTGAATCCTGTCTCAAAGGG - Intergenic
1037113531 8:15195576-15195598 GCACGGACTCTTGTCACCAAAGG - Intronic
1037941219 8:22952407-22952429 GTACAGACTCCTGCCTTTAAGGG - Intronic
1045420332 8:102008326-102008348 GAACCTATTCCTGTCCCTAAGGG - Intronic
1045458057 8:102401450-102401472 GTACTGACTCCTGTCTCTGCAGG + Intronic
1045841156 8:106583205-106583227 CCACTGACTCGTGACTCTAATGG + Intronic
1056089144 9:83187240-83187262 GCCCCACCTCTTGTCTCTAAGGG + Intergenic
1058833796 9:108842792-108842814 GTACCTACTACTGTCTCCAACGG - Intergenic
1188435465 X:30153493-30153515 CCACCAACTTCTGTCTCCAATGG - Intergenic
1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG + Intronic