ID: 1011704816

View in Genome Browser
Species Human (GRCh38)
Location 6:89990204-89990226
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011704816_1011704820 3 Left 1011704816 6:89990204-89990226 CCCTTAGAGACAGGAGTCGGTGC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1011704820 6:89990230-89990252 CTGGGAGTTAACATTTTCATTGG 0: 1
1: 0
2: 4
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011704816 Original CRISPR GCACCGACTCCTGTCTCTAA GGG (reversed) Intronic