ID: 1011704820 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:89990230-89990252 |
Sequence | CTGGGAGTTAACATTTTCAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 261 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 22, 4: 234} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1011704813_1011704820 | 20 | Left | 1011704813 | 6:89990187-89990209 | CCATGTGGGGAGCTATACCCTTA | No data | ||
Right | 1011704820 | 6:89990230-89990252 | CTGGGAGTTAACATTTTCATTGG | 0: 1 1: 0 2: 4 3: 22 4: 234 |
||||
1011704816_1011704820 | 3 | Left | 1011704816 | 6:89990204-89990226 | CCCTTAGAGACAGGAGTCGGTGC | 0: 1 1: 0 2: 0 3: 3 4: 66 |
||
Right | 1011704820 | 6:89990230-89990252 | CTGGGAGTTAACATTTTCATTGG | 0: 1 1: 0 2: 4 3: 22 4: 234 |
||||
1011704817_1011704820 | 2 | Left | 1011704817 | 6:89990205-89990227 | CCTTAGAGACAGGAGTCGGTGCA | 0: 1 1: 0 2: 0 3: 4 4: 90 |
||
Right | 1011704820 | 6:89990230-89990252 | CTGGGAGTTAACATTTTCATTGG | 0: 1 1: 0 2: 4 3: 22 4: 234 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1011704820 | Original CRISPR | CTGGGAGTTAACATTTTCAT TGG | Intronic | ||