ID: 1011704820

View in Genome Browser
Species Human (GRCh38)
Location 6:89990230-89990252
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011704813_1011704820 20 Left 1011704813 6:89990187-89990209 CCATGTGGGGAGCTATACCCTTA No data
Right 1011704820 6:89990230-89990252 CTGGGAGTTAACATTTTCATTGG 0: 1
1: 0
2: 4
3: 22
4: 234
1011704816_1011704820 3 Left 1011704816 6:89990204-89990226 CCCTTAGAGACAGGAGTCGGTGC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1011704820 6:89990230-89990252 CTGGGAGTTAACATTTTCATTGG 0: 1
1: 0
2: 4
3: 22
4: 234
1011704817_1011704820 2 Left 1011704817 6:89990205-89990227 CCTTAGAGACAGGAGTCGGTGCA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1011704820 6:89990230-89990252 CTGGGAGTTAACATTTTCATTGG 0: 1
1: 0
2: 4
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type