ID: 1011704981

View in Genome Browser
Species Human (GRCh38)
Location 6:89992114-89992136
Sequence GATTACCTATAGAAAGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011704981 Original CRISPR GATTACCTATAGAAAGTAGG TGG (reversed) Intronic
901183938 1:7360105-7360127 GATTACTTATAAAAAGGTGGGGG - Intronic
903964417 1:27077909-27077931 GATTAGGTATAGAACGTAGTAGG + Intergenic
908338930 1:63156416-63156438 AATTCCCTGTAGAAAGTAGCTGG - Intergenic
910402707 1:86853344-86853366 GATTACCACTATAATGTAGGTGG - Intergenic
912863974 1:113240343-113240365 AATTACCTATAGAAAAGGGGTGG - Intergenic
913133864 1:115868210-115868232 GATTACTTACAGAAAGTGGATGG - Intergenic
915422072 1:155790954-155790976 AACAAACTATAGAAAGTAGGTGG + Intronic
920866634 1:209758840-209758862 GATAAACTACAGAAGGTAGGTGG + Exonic
921688506 1:218119551-218119573 GATCGCCTAGAGAAAGTAAGTGG + Intergenic
922626040 1:227044515-227044537 AATTGCCTGTAGGAAGTAGGAGG - Intronic
923717285 1:236435815-236435837 GTTTTCCTATAGAAGGTAGAGGG + Intronic
924388814 1:243528093-243528115 GCTAACCTATAGAAAGGAGGTGG - Intronic
1066398300 10:35048768-35048790 GATACCCAATAGAAAGTAGGTGG - Intronic
1069363322 10:67669400-67669422 GATTAACTATAGAAGGAATGAGG + Intronic
1075019470 10:118940523-118940545 GAGTATGTATAGAAAGGAGGAGG + Intergenic
1078304072 11:10165120-10165142 GATTAAAAATAGAAAATAGGAGG - Intronic
1080723459 11:34871711-34871733 GATGACCTATATTGAGTAGGCGG - Intronic
1088999115 11:115034549-115034571 GGTTACCTATGGGAAGTAAGTGG - Intergenic
1089717384 11:120374386-120374408 AAGCACCTATAAAAAGTAGGGGG + Intronic
1092289869 12:7153475-7153497 GATTCACTATAGCAAGTAGGTGG + Intronic
1092698896 12:11204942-11204964 GGTTACCTACAGGAAGTGGGTGG + Intergenic
1093973485 12:25396069-25396091 GATTACCCATATAAAGTGGCTGG + Intergenic
1097196263 12:57243815-57243837 AATTTCCTCTAGAAAGTCGGTGG + Exonic
1101618766 12:106363133-106363155 GATCACCTATGGAATGTAGATGG - Intronic
1105095101 13:16356191-16356213 GATTACGCATAAAAAGTAGACGG + Intergenic
1105122427 13:16802871-16802893 GATTACGTATAAAAAGTAGACGG + Intergenic
1105128605 13:16903649-16903671 GATTACGTATAAAAAGTAGACGG + Intergenic
1105138583 13:17067030-17067052 GATTACGTATAAAAAGTAGACGG + Intergenic
1105145862 13:17185397-17185419 GATTACGTATAAAAAATAGACGG + Intergenic
1105811633 13:24001132-24001154 CATTACCTGGAGAGAGTAGGGGG - Intronic
1105862473 13:24428367-24428389 GATCACCCAAAGAAAGAAGGTGG - Intronic
1106031302 13:26007553-26007575 GATTATTTATAGAAACCAGGTGG + Intronic
1106361326 13:29033945-29033967 GCTGACCGATAGAAAGTTGGAGG - Exonic
1106711927 13:32346152-32346174 GATTACCTATAGTAAGCAAGAGG - Intronic
1107088896 13:36454707-36454729 GCTTGCCTATACACAGTAGGAGG + Intergenic
1108339969 13:49489564-49489586 GATGACCTACAGAGAGAAGGTGG - Intronic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1110502980 13:76250435-76250457 GTTTTCCTTTATAAAGTAGGAGG - Intergenic
1111274656 13:85933044-85933066 GAATACCTATACAATGTTGGTGG - Intergenic
1111327473 13:86718162-86718184 GATTACCTACAGAAATAAGCGGG + Intergenic
1114169228 14:20254905-20254927 CATTAGCTAAAGAATGTAGGTGG - Intergenic
1116066257 14:39987038-39987060 GATTACCTATACACATTTGGTGG - Intergenic
1117060115 14:51953808-51953830 GATCATGTATGGAAAGTAGGTGG - Intronic
1118281051 14:64428859-64428881 GATTACATTTATAAAATAGGTGG - Intronic
1118499215 14:66342438-66342460 GATTATCTATAGAAATTACCTGG + Intergenic
1127014062 15:54663763-54663785 GCTTTCCTATGGAAAGTAAGAGG + Intergenic
1127183370 15:56450072-56450094 GATTACAAAAAGAAGGTAGGAGG - Intronic
1131063818 15:89420667-89420689 GAGAACCAATAGAGAGTAGGAGG + Intergenic
1134607513 16:15582744-15582766 GATCACCAAGATAAAGTAGGTGG - Intronic
1139810994 16:69616839-69616861 GGATACCTATAGAGAATAGGGGG - Intronic
1142553431 17:754938-754960 GGTTACCTATAGGATGCAGGGGG + Intergenic
1144594721 17:16559150-16559172 GGTTACCTATAGGGAGTAGGTGG + Intronic
1146049058 17:29534037-29534059 CATGACCTATGGAAAGGAGGAGG - Intronic
1147032737 17:37653568-37653590 GGTTACCTACAGGAAGTGGGTGG + Intergenic
1151229577 17:72674164-72674186 GATTACCTAGAGAGGGTATGTGG - Intronic
1153153852 18:2127109-2127131 GAGAAGCTAAAGAAAGTAGGAGG - Intergenic
1154698701 18:17715234-17715256 GATTACATATAAAAAGCAGACGG + Intergenic
1158229427 18:55237390-55237412 GATGATCTATAGAAAATAGATGG - Intronic
927305616 2:21568749-21568771 AATCACCTATAGACAATAGGAGG + Intergenic
930509976 2:52332540-52332562 TATTACCAATAGAAAGCAAGAGG + Intergenic
934435956 2:93788808-93788830 GATTACATATAAAAAGCAGACGG + Intergenic
934446743 2:93963225-93963247 GATTACATATAAAAAGCAGACGG + Intergenic
934448739 2:93995468-93995490 GATTACATATAAAAAGCAGACGG + Intergenic
936906287 2:117538497-117538519 GATTACCTCTAGGAAGCAGAGGG + Intergenic
937382490 2:121392697-121392719 TATTACTGATAGAAAGAAGGTGG - Intronic
938000405 2:127730189-127730211 GATTACCTCTGGAAAGTGGGTGG + Intronic
940984724 2:160041297-160041319 AATTGAATATAGAAAGTAGGAGG + Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
1169236317 20:3932779-3932801 AATTAGCTATGGAAAGTAGCAGG - Exonic
1169816081 20:9657989-9658011 CATTACCTTCAGAAAGTAGATGG - Intronic
1173328795 20:42057224-42057246 GTCTACCTAAAGAAAGAAGGAGG + Intergenic
1174210405 20:48873829-48873851 GTTTACCTCTAGGGAGTAGGGGG - Intergenic
1174523195 20:51149350-51149372 GATTACCTATAAAAACTTGTCGG + Intergenic
1177247653 21:18550812-18550834 GATTCCCTATAAAAATAAGGTGG + Intergenic
1178234894 21:30829831-30829853 GATTACCTATGCAAATTAGTGGG - Intergenic
951035455 3:17927398-17927420 GATTACAGATAGAAAGAAGGAGG - Intronic
951057230 3:18161683-18161705 GATAAAATATATAAAGTAGGAGG + Intronic
953520937 3:43642675-43642697 AATTACCTATAGGAGGTGGGGGG - Intronic
954279114 3:49563390-49563412 GAGCACCTGTAGGAAGTAGGTGG - Intronic
955015098 3:55062554-55062576 GGTTACCTAGAGAAAGATGGAGG + Intronic
955241384 3:57181557-57181579 GATTACTTATAGAGAGTGAGTGG - Intergenic
958008002 3:87837731-87837753 TATTTCCTATAGAAAATATGAGG - Intergenic
958454841 3:94317747-94317769 GAATCCCTATAGGAAGTAGCTGG + Intergenic
958542176 3:95492413-95492435 CATTACATAGAGAAAGAAGGAGG + Intergenic
959670206 3:108968592-108968614 CATTACCTATAAAAACTATGAGG + Intronic
968475589 4:805261-805283 GATTATCTAAAGATAGAAGGAGG + Intronic
969539440 4:7777730-7777752 GATTTCCCAGAGAAAGAAGGTGG - Intronic
974556921 4:63463096-63463118 GATTACCTTTGGACAGTGGGAGG + Intergenic
975788817 4:77925087-77925109 GATTACTTACAGAAACTAGTAGG + Intronic
982735879 4:159006457-159006479 AATTAGCTATAGAAAGCTGGGGG - Intronic
983134632 4:164065500-164065522 GATGACCTACAGAATGGAGGAGG + Intronic
983162310 4:164431620-164431642 TATTACCTACAAAAAGTATGAGG + Intergenic
983727940 4:170953358-170953380 GAGTACCTATATAAATTAGTTGG + Intergenic
991112524 5:62917060-62917082 GATAAACTAAAGAAGGTAGGAGG + Intergenic
991592317 5:68265894-68265916 AAATAACTATAGAGAGTAGGGGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994901096 5:105770394-105770416 GATTACCTGTAATACGTAGGAGG + Intergenic
996485470 5:124028644-124028666 GATTATCTACACAACGTAGGAGG + Intergenic
999780540 5:154846443-154846465 GATTTTCCAGAGAAAGTAGGAGG + Intronic
1003693636 6:8379897-8379919 GATTAGCCAGAGCAAGTAGGAGG + Intergenic
1004946529 6:20619872-20619894 GAATACATATAGAAAATAGGGGG - Intronic
1011704981 6:89992114-89992136 GATTACCTATAGAAAGTAGGTGG - Intronic
1015068350 6:129058410-129058432 GATTAGAGATAGAAAATAGGAGG - Intronic
1017745984 6:157447333-157447355 CATGGCCCATAGAAAGTAGGAGG - Intronic
1021144138 7:17064800-17064822 GATTCCCTATAGAAGGAAGCAGG - Intergenic
1021717118 7:23470389-23470411 GATTAGCAAGAGAAAGGAGGAGG + Exonic
1022049924 7:26656792-26656814 GATGAACCATAGAAAGTAAGAGG - Intergenic
1022565562 7:31397159-31397181 AATTAAGTATGGAAAGTAGGAGG - Intergenic
1022636179 7:32137852-32137874 GGTTACTTATAGTAAGTAAGAGG + Intronic
1023396479 7:39756536-39756558 TAATAGATATAGAAAGTAGGAGG + Intergenic
1024293078 7:47820361-47820383 TACTACTTATAGAAAGAAGGAGG + Intronic
1024725254 7:52186695-52186717 GATTAACTTTAGAAAGTTTGTGG + Intergenic
1026282024 7:68930447-68930469 GTTTAACTATAGAAACTTGGGGG - Intergenic
1031125177 7:117765236-117765258 AATGAACTATAGAAAGTAAGTGG - Intronic
1031228752 7:119076576-119076598 TATTTTCTATAGAAAGTAGAGGG + Intergenic
1034868975 7:154666034-154666056 GATTACCTATAGGGTATAGGTGG - Intronic
1041702710 8:60809374-60809396 GATTTCCTATGGTAAGGAGGAGG + Intronic
1044602815 8:94022752-94022774 GATTAACAATAGAAAGTAGAAGG + Intergenic
1048017865 8:130513533-130513555 GATTACTTCAAGAAAGTAAGGGG + Intergenic
1048358735 8:133675949-133675971 GATTAGCTATCTAAAGTGGGAGG - Intergenic
1048799552 8:138183320-138183342 GATTACAGATAGTAAGTGGGAGG + Intronic
1050202728 9:3163358-3163380 GATTACCTAAAGTGAGTGGGTGG - Intergenic
1050747885 9:8898445-8898467 GATTATTTATACAATGTAGGTGG + Intronic
1051729145 9:20121137-20121159 GCTTTTCTATAGAAATTAGGAGG - Intergenic
1053975858 9:43815560-43815582 GATTACATATAAAATCTAGGGGG + Intergenic
1054922040 9:70552779-70552801 GATTGCCTATAGGAAGTGGTAGG + Intronic
1059940633 9:119356082-119356104 AATAACCAATAGGAAGTAGGGGG - Intronic
1189425035 X:40892012-40892034 GACTACCTCTATAATGTAGGTGG - Intergenic
1194461415 X:94174325-94174347 GAGAACTTATAGAACGTAGGAGG + Intergenic
1194722475 X:97356364-97356386 GATTAACTAGAGAGAGTTGGTGG - Intronic
1195799680 X:108693731-108693753 GATTAGCTATGGGAAGAAGGTGG + Intronic