ID: 1011706862

View in Genome Browser
Species Human (GRCh38)
Location 6:90009529-90009551
Sequence GGATGTACATCAATTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011706862 Original CRISPR GGATGTACATCAATTCAGCT GGG (reversed) Intronic
901831894 1:11898109-11898131 GAATTTACATCATTTCACCTTGG - Intergenic
902437537 1:16408212-16408234 GGATGTACATCCATTCTTCTAGG + Intronic
907105454 1:51878622-51878644 GGATGTCCATCGCTCCAGCTTGG - Exonic
907161557 1:52374047-52374069 GGATGTTAACCAAATCAGCTTGG + Intronic
907250600 1:53135856-53135878 GCAAGTACAACAATTCAACTTGG - Intronic
909016431 1:70384939-70384961 GGCTGTACATAAATACAGCTGGG + Intronic
919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG + Intronic
1064245894 10:13667355-13667377 GGAAGGACATCAAGTGAGCTGGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1076842117 10:133050775-133050797 GGCTGGACGGCAATTCAGCTGGG + Intergenic
1089728497 11:120504296-120504318 TGATGTTCATCTATTCAGATTGG + Intergenic
1100661364 12:96702386-96702408 GGAACTAGATGAATTCAGCTGGG + Intronic
1103256171 12:119543308-119543330 AGATATACATCAATTTGGCTGGG - Intergenic
1110171810 13:72510302-72510324 GGATCTACATCAAATAAGCAAGG + Intergenic
1122012625 14:98763831-98763853 GGATCTGCCTCAATTCATCTGGG - Intergenic
1133359333 16:5161491-5161513 GGATGTACATCACCTCAGGACGG + Intergenic
1135511646 16:23089890-23089912 GGACATACTTCAATTCAACTTGG + Intronic
1150344417 17:64393310-64393332 AGATATACATCATTTCTGCTGGG + Intronic
1151090659 17:71436536-71436558 AGATGTACATACATTCATCTGGG - Intergenic
1160084728 18:75765811-75765833 GCATGTACATCCATTCAGCCTGG + Intergenic
1160314332 18:77826820-77826842 GTATGTACTTCCTTTCAGCTAGG + Intergenic
930899011 2:56481070-56481092 GGAGGTACAGCATTTGAGCTAGG - Intergenic
942075100 2:172350346-172350368 TGATGTACATCACTTTCGCTGGG + Intergenic
943209285 2:184942063-184942085 GGATGTACAACAATTCATGCTGG - Intergenic
1169188419 20:3639890-3639912 GGATTTCCATCTATTCAGGTGGG - Intronic
1173658801 20:44718956-44718978 GGAGGTACATCACATCAGCCAGG - Intronic
1181358538 22:22317543-22317565 AGATGTACATCAGTTCAGTCTGG + Intergenic
1184101235 22:42342739-42342761 GGAGGGTCATCCATTCAGCTGGG - Intronic
1184980355 22:48091162-48091184 AGATGAACATTAGTTCAGCTTGG - Intergenic
949683868 3:6546404-6546426 GGAAGTATATCACTTAAGCTGGG + Intergenic
952187872 3:30989848-30989870 GCATGTATATCAATTCAACAGGG - Intergenic
952497755 3:33930855-33930877 GGAAGTACATCAAATTAGCTAGG - Intergenic
955961784 3:64348257-64348279 GGCTGTACTTCAATTAGGCTGGG - Intronic
956110603 3:65866767-65866789 CCATGTTCATCAAATCAGCTAGG + Intronic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
958073779 3:88650126-88650148 GAATGTAAATTAGTTCAGCTTGG + Intergenic
958673710 3:97238079-97238101 GCATGTACATAATTTTAGCTTGG - Intronic
960849661 3:122038459-122038481 GGATTTACATTAATTTAGCGTGG - Intergenic
961735515 3:129000087-129000109 TGGTGTCCATCAAATCAGCTAGG - Intronic
962159262 3:132981589-132981611 GTATGTACATCAATTGTGCCAGG + Intergenic
965642176 3:170840759-170840781 TGATGGACATCTGTTCAGCTTGG - Intronic
969385666 4:6845261-6845283 GGAGGTTCATCACTTCAGCAGGG + Intronic
970159208 4:13172210-13172232 GGATGTCCACAAATTCAACTGGG + Intergenic
972002167 4:34051222-34051244 GGATGTACATAAATTGAAATTGG + Intergenic
973749501 4:53999455-53999477 AGATGTGCATAAAATCAGCTGGG - Intronic
974722589 4:65761217-65761239 TGTTGTACATCATTTCAGCCAGG + Intergenic
975370194 4:73577083-73577105 GGAATTACATCAACTCAACTTGG - Intronic
983631765 4:169856660-169856682 AGATGTACATGAGTTCAGTTGGG + Intergenic
984896532 4:184546510-184546532 GTATGTACATGGTTTCAGCTGGG + Intergenic
991519145 5:67475673-67475695 GGAAGTAAATCAAGTCAGCATGG + Intergenic
992744977 5:79810593-79810615 GGAGAGACATCATTTCAGCTGGG + Intergenic
993175295 5:84476832-84476854 GGAAGCACATCAACTCTGCTAGG - Intergenic
996696450 5:126402092-126402114 GGCTGAAAACCAATTCAGCTGGG - Intronic
998843218 5:146278691-146278713 GGATGTCCATCAATACAGGATGG - Intronic
1000614145 5:163409339-163409361 GAATCTACATTAATGCAGCTAGG + Intergenic
1004718866 6:18247450-18247472 GGATTTTCATCAATTGACCTGGG + Intronic
1010753663 6:79642735-79642757 GGATATCCATCAATTCAACTTGG - Intronic
1011706862 6:90009529-90009551 GGATGTACATCAATTCAGCTGGG - Intronic
1015216239 6:130753329-130753351 GGGTATACATCCATTCACCTAGG - Intergenic
1018805718 6:167258170-167258192 GGTGGGACATCAATTCACCTGGG + Intergenic
1019957986 7:4432302-4432324 GGATGGACAGCAATTGAGTTAGG + Intergenic
1021242916 7:18226739-18226761 GAATTTACAGCAATTCAGCATGG + Intronic
1031873539 7:127112690-127112712 GGAATTCCATCACTTCAGCTTGG - Intronic
1038227708 8:25672192-25672214 CAATGTGCATTAATTCAGCTGGG + Intergenic
1041567717 8:59299181-59299203 AGATGTCCATTAATTGAGCTTGG + Intergenic
1042344118 8:67710354-67710376 GAATCTACATTAATGCAGCTGGG - Intronic
1045654666 8:104374507-104374529 TGATGTACATCATTAGAGCTCGG - Intronic
1046012411 8:108565533-108565555 AGATGTACTTCATTTCTGCTGGG + Intergenic
1052497828 9:29250202-29250224 GGATGTAAATCAAATAAGGTGGG - Intergenic
1052920409 9:33961915-33961937 GGATGTACCTGATTTCAGATTGG + Intronic
1058211722 9:102177511-102177533 GGATGTGCAGCTGTTCAGCTTGG + Intergenic
1186050815 X:5592978-5593000 AGATGTACATTAATTCAGTCTGG - Intergenic
1195389439 X:104346144-104346166 GGATCTACATCAAACCAGGTTGG + Intergenic
1196597867 X:117565792-117565814 GGATGTACATCACCTCAGGACGG - Intergenic
1198563055 X:137872233-137872255 GCATGTAAAGCAATTCAGCATGG - Intergenic
1199615911 X:149655837-149655859 GGATGTATGTCAATTTGGCTGGG + Intergenic
1199626730 X:149747411-149747433 GGATGTATGTCAATTTGGCTGGG - Intergenic