ID: 1011712002

View in Genome Browser
Species Human (GRCh38)
Location 6:90064636-90064658
Sequence CCAGCTAATAAGTGGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011711997_1011712002 9 Left 1011711997 6:90064604-90064626 CCTAAAGCAGGCCTTGTGCAGGC 0: 1
1: 0
2: 0
3: 14
4: 209
Right 1011712002 6:90064636-90064658 CCAGCTAATAAGTGGGTAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1011711998_1011712002 -2 Left 1011711998 6:90064615-90064637 CCTTGTGCAGGCTTGAAAAGTCC 0: 1
1: 0
2: 1
3: 5
4: 118
Right 1011712002 6:90064636-90064658 CCAGCTAATAAGTGGGTAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011712002 Original CRISPR CCAGCTAATAAGTGGGTAGT AGG Intronic
903928911 1:26850978-26851000 CCTGCTAAGAAGTGGGGACTGGG + Intronic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
905775210 1:40663933-40663955 CCAGCTGCTATGTGGGTAGCAGG - Intronic
907513319 1:54978466-54978488 ACAGCTAATAAGTGGGGATTGGG - Intergenic
910920302 1:92339039-92339061 CTAGATAAAAAGTGTGTAGTTGG - Intronic
912083029 1:105961772-105961794 CCAGTTAATATGAGGTTAGTAGG + Intergenic
914333886 1:146697948-146697970 CCAGCAAAGAAGGGGGCAGTTGG - Intergenic
916812523 1:168317993-168318015 CCATCTAATAAGTATGTAGGAGG - Intergenic
917896545 1:179494278-179494300 CATTCTAATAAGTGAGTAGTGGG + Intronic
919649405 1:200131654-200131676 CCAGCTCAGAAGAGCGTAGTTGG + Intronic
920689198 1:208132763-208132785 CCATTTACTAAGCGGGTAGTAGG + Intronic
921347281 1:214199439-214199461 GCAGCTACTAAGTGACTAGTTGG - Intergenic
922520435 1:226245899-226245921 CAAGCTAATTAGGGGGAAGTAGG - Intronic
924509735 1:244719723-244719745 CATTCTAATAAGTGAGTAGTGGG + Intergenic
1069944074 10:71973979-71974001 ACAGCCAGTAAGTGGGGAGTTGG - Intronic
1072327239 10:94310648-94310670 CCAGCTCAGAATTGGGTATTTGG - Intronic
1073737132 10:106361917-106361939 CTAGTTAATAAGTGGTCAGTTGG + Intergenic
1074301288 10:112235284-112235306 TCAGCTAAAAAGTGGGCAGTTGG + Intergenic
1081792180 11:45795941-45795963 CCAGATGGTAAGTGGGTTGTAGG - Intergenic
1085684812 11:78611862-78611884 CCAGCTACCTGGTGGGTAGTTGG + Intergenic
1086873725 11:92070436-92070458 CCAGATAAAAAGTGGGGAGGTGG + Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1090758369 11:129814949-129814971 CCAGCTAATTGGTGGGGACTTGG - Intergenic
1092344484 12:7704160-7704182 ACACCTAAGAAGTGGGTAGTTGG + Intergenic
1092901541 12:13064448-13064470 CCAGCTAATAAGCGGCCAGACGG - Intronic
1097162756 12:57060463-57060485 CCAACTAAAAAGTGGGTAGGGGG + Intronic
1100623552 12:96305832-96305854 CCAGCTACTCAGTAGGTAGGAGG - Intronic
1102753128 12:115313582-115313604 CCATATACTAAGAGGGTAGTAGG - Intergenic
1104800125 12:131548914-131548936 GCAGCTACTAAGTGGCCAGTGGG + Intergenic
1113067391 13:106386154-106386176 CCAGCTAAAAAGAAGGTATTGGG + Intergenic
1115507106 14:34103116-34103138 CAGGCTAATAAGAGAGTAGTTGG + Intronic
1117086576 14:52207641-52207663 CCAGCTACTTAGTAGGAAGTAGG + Intergenic
1117691211 14:58308716-58308738 ACACCTAATAGGTAGGTAGTAGG - Intronic
1121245916 14:92460766-92460788 ACAGCTGATAAGTGGGGAGGTGG + Intronic
1127136686 15:55931306-55931328 ACAGTTAAAAAGTGGGTAGCAGG + Intronic
1127537268 15:59901552-59901574 CCAGCTCACCAGTGAGTAGTGGG - Intergenic
1130081962 15:80741903-80741925 CCAGCTACTAAGTGACTAATGGG + Intronic
1130991720 15:88879629-88879651 CCAGCTAACGAGTGGGGAGCTGG - Intronic
1131549174 15:93341940-93341962 ACAGCTGAAAAGAGGGTAGTGGG + Intergenic
1133904998 16:10014113-10014135 CCAGCTAATAAATGGGTAGGTGG + Intronic
1137426733 16:48386008-48386030 TCAGCTGAAAAGTGGGTAATGGG + Intronic
1139999732 16:71013301-71013323 CCAGCAAAGAAGGGGGCAGTTGG + Intronic
1143551573 17:7633537-7633559 CTAACTAATAAGTGGATAGTTGG + Intergenic
1144202896 17:12957071-12957093 CCAGCTACTCAGTGGGTAGAGGG - Intronic
1146051952 17:29561413-29561435 TCAGCAAATAAGTGGGTATTTGG - Exonic
1147416046 17:40290668-40290690 TCAGCTACTAAGTGACTAGTGGG + Intronic
1149350203 17:55779012-55779034 CCAGCTAGGAAGTGGGAGGTTGG - Intronic
1158473205 18:57757103-57757125 CTAACTAATAAGTGGAAAGTAGG - Intronic
1167458433 19:49611206-49611228 CCAGCTACTTGGTGGGTAGGTGG + Intronic
925909506 2:8564322-8564344 CCAGCAAATCAGTGGCTAGGAGG + Intergenic
926341493 2:11908404-11908426 CCAGCTAAAAAGTAGTGAGTAGG + Intergenic
926443281 2:12912560-12912582 CCAGCTAATTAGTGGATATAGGG - Intergenic
926857029 2:17268192-17268214 CCAGATAATAGGTGGGTATAAGG + Intergenic
926957563 2:18318098-18318120 CCAACTATTAAGTGGCTAGGCGG - Intronic
929011333 2:37447927-37447949 CCAGCTAATAAGTAGGTGTGTGG + Intergenic
929795102 2:45053284-45053306 CCAGCTACTAAGAGGTGAGTTGG + Intergenic
932389990 2:71379443-71379465 ACAGCTATTAAGTGACTAGTGGG - Intronic
932888773 2:75571863-75571885 ACAACTAGTAAGTGGGAAGTGGG - Intergenic
933172039 2:79135452-79135474 CCACCTAATGCCTGGGTAGTTGG - Intergenic
933670615 2:85004013-85004035 CCAGCTGCTAAGTGACTAGTGGG + Intronic
936142383 2:109951503-109951525 ACAGCTACTAAGTGACTAGTGGG - Intergenic
936179073 2:110249462-110249484 ACAGCTACTAAGTGACTAGTGGG - Intergenic
936202305 2:110419970-110419992 ACAGCTACTAAGTGACTAGTGGG + Intronic
938561237 2:132473971-132473993 CCAGTCACTAAGTGTGTAGTTGG - Intronic
939553605 2:143646360-143646382 CCTGCTAATAAGTGGCTTCTAGG - Intronic
946720898 2:222606136-222606158 CCAGCCAATCAGTGTGGAGTTGG - Intronic
1169454112 20:5737043-5737065 CCAGCTACTTGGTGGGAAGTGGG + Intergenic
1172800777 20:37574635-37574657 CCAGCAAATCAGTGGCTACTTGG + Intergenic
1174999025 20:55606012-55606034 ACAGCTCCTAAGTGGGAAGTTGG - Intergenic
1177358691 21:20041040-20041062 CCATCTAATAGGTGTGTATTTGG - Intergenic
1180953210 22:19730098-19730120 CCAGCTCATCAGTGGGGAGGGGG - Intergenic
1181824755 22:25506067-25506089 CCTGCAAACAAGTGGGTAGCTGG + Intergenic
1182735505 22:32529912-32529934 CCAGGTAAGGAGTGGGTAGAGGG - Intronic
949926264 3:9044329-9044351 GCAGCTACTAAGTGGCCAGTGGG + Intronic
953605305 3:44409834-44409856 TGAGCTAATGAGAGGGTAGTGGG + Intergenic
956832907 3:73070887-73070909 CCAGGAAATCAGTGGGCAGTTGG + Intergenic
957667491 3:83251654-83251676 CCAGCTACTGGGTGGGGAGTGGG + Intergenic
960266026 3:115622063-115622085 CTAGCTAATAAGTGGCAACTAGG - Intergenic
963554767 3:146773019-146773041 CCAGCTAATCTGTGGGGACTTGG + Intergenic
963649597 3:147962092-147962114 CCAAATAATATGTGTGTAGTAGG - Intergenic
966550987 3:181203753-181203775 TCAGCCAATCAGTGGGTAGATGG + Intergenic
966892515 3:184417592-184417614 ACAGCTAACAAGTGGCAAGTGGG + Intronic
972618105 4:40719596-40719618 CTAGCTAATCACAGGGTAGTAGG + Intergenic
975505859 4:75136314-75136336 GGAACTAATAAGTTGGTAGTGGG - Intergenic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
982134049 4:152257149-152257171 TAAGTTAATAAATGGGTAGTAGG + Intergenic
982343212 4:154326817-154326839 CCAAATAACAAGTGGGAAGTTGG - Intronic
985009534 4:185568423-185568445 CCAGCATATAAATGGGTATTTGG + Intergenic
995847562 5:116510444-116510466 CCAGCTAGTAAGGGGGCAGAGGG - Intronic
996624224 5:125550687-125550709 CCAGATAATTACTGGGGAGTGGG - Intergenic
999046369 5:148474112-148474134 CCAGCTAGAGAGTGGGCAGTTGG - Intronic
1004294934 6:14401768-14401790 CCACCTACCAAGTGGGAAGTGGG + Intergenic
1009519570 6:64664214-64664236 CCAGCCATTAAGTGGGGAGTGGG - Intronic
1009954626 6:70438519-70438541 CCAGCTACTAAGTGACTAATTGG - Intronic
1011712002 6:90064636-90064658 CCAGCTAATAAGTGGGTAGTAGG + Intronic
1011848537 6:91597020-91597042 ACAGATAATAAGTTGTTAGTAGG + Intergenic
1012318893 6:97817304-97817326 CCAGCTCAGAAGTGGGTTGTGGG - Intergenic
1012738529 6:102982292-102982314 CCAGGTGATAAGTGGCCAGTGGG - Intergenic
1017233352 6:152095484-152095506 CCAGCTAACATGTGGGTACAAGG - Intronic
1017523193 6:155220110-155220132 CAAACTAAAAAGTGGGCAGTGGG + Intronic
1017529838 6:155278672-155278694 ACAGCTAGTAAGTGGGGAGATGG + Intronic
1025813847 7:64891775-64891797 ACAGCTGATAAGTGGGGTGTGGG + Intronic
1025818871 7:64945160-64945182 ACAGCTGATAAGTGGGGTGTGGG - Intergenic
1026391414 7:69906372-69906394 ACAGGTAATGAGTGGGAAGTGGG + Intronic
1026780977 7:73267196-73267218 CCAGCTACTCAGTGACTAGTGGG - Intergenic
1027021831 7:74820638-74820660 CCAGCTACTCAGTGACTAGTGGG - Intronic
1027066190 7:75125279-75125301 CCAGCTACTCAGTGACTAGTGGG + Intronic
1027334440 7:77133464-77133486 CCAGCTACTAAGTGGGGATGAGG - Intronic
1031249939 7:119367073-119367095 TCAGCTAATAGGTGGGTCTTAGG + Intergenic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1032325930 7:130928111-130928133 CCACCCAATAAGTCAGTAGTGGG - Intergenic
1039252605 8:35683332-35683354 CAAGCTAATAAGTTGGGAGCAGG - Intronic
1042400466 8:68340060-68340082 CATTCTAATAAATGGGTAGTGGG - Intronic
1044298711 8:90558190-90558212 ACAGCTAGTAAGTGGGAGGTTGG - Intergenic
1045961654 8:107975915-107975937 TCTTCTAATAAGTGGATAGTAGG + Intronic
1050297966 9:4226009-4226031 CCATGTAATATGTGGGTAATAGG + Intronic
1052896085 9:33749622-33749644 CCAGCTAATTGGTGGGGACTTGG - Intergenic
1052896095 9:33749765-33749787 CCAGCTAATTGGTGGGGACTTGG - Intergenic
1053295882 9:36912655-36912677 CCAGCTGTGAAGTGAGTAGTGGG + Intronic
1055336625 9:75238631-75238653 ACTGCTAATAAGTAGGTGGTTGG - Intergenic
1055557202 9:77487115-77487137 ACAGCTACTAAGTGACTAGTAGG + Intronic
1056596025 9:88008223-88008245 ACAGCTAATAAGTGACTAATGGG - Intergenic
1058693861 9:107542578-107542600 ACAGCTACTAAGTGGCTAATGGG + Intergenic
1058753672 9:108064255-108064277 CCAAATAAAAAGTGGGGAGTGGG - Intergenic
1058832691 9:108833121-108833143 CCAGCTAACATCTGGGTTGTAGG - Intergenic
1186559766 X:10598886-10598908 CGAGCTAATAAATGGGGTGTTGG + Intronic
1191636339 X:63381550-63381572 ACAGCCAATAAGTTGGTAGAAGG - Intergenic
1199713961 X:150492648-150492670 CCACCTACCAAGTGGGGAGTTGG + Intronic