ID: 1011713467

View in Genome Browser
Species Human (GRCh38)
Location 6:90079214-90079236
Sequence CTGTAGACACAGATGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011713467_1011713470 -10 Left 1011713467 6:90079214-90079236 CCCTCCAACATCTGTGTCTACAG 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1011713470 6:90079227-90079249 GTGTCTACAGAAGATACTACAGG No data
1011713467_1011713472 -5 Left 1011713467 6:90079214-90079236 CCCTCCAACATCTGTGTCTACAG 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1011713472 6:90079232-90079254 TACAGAAGATACTACAGGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 206
1011713467_1011713471 -9 Left 1011713467 6:90079214-90079236 CCCTCCAACATCTGTGTCTACAG 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1011713471 6:90079228-90079250 TGTCTACAGAAGATACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011713467 Original CRISPR CTGTAGACACAGATGTTGGA GGG (reversed) Intronic
901748535 1:11390941-11390963 CAGGATACACAGATGTTTGATGG - Intergenic
901899412 1:12345979-12346001 CTGTAGTCCCAGTGGTTGGAGGG + Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
904898762 1:33839071-33839093 ATGTAATCACAAATGTTGGAAGG + Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907582557 1:55585024-55585046 CTGCAGACGCAGATATTGGAAGG - Intergenic
908052196 1:60245584-60245606 CTGTAGACAGTGATGATGTAAGG + Intergenic
910771948 1:90839754-90839776 CCATAGAAAAAGATGTTGGAGGG - Intergenic
914242509 1:145861180-145861202 ATGAAGACTCAGGTGTTGGAAGG - Intergenic
921736422 1:218633621-218633643 CTGGAGCCAGGGATGTTGGATGG - Intergenic
922048907 1:221971749-221971771 CTTTAGATTCAGATGTTGAATGG - Intergenic
923091201 1:230742651-230742673 CTGCATACACTGATGTGGGAAGG - Intergenic
923227650 1:231954064-231954086 GTGTAAACACGGAAGTTGGAAGG - Intronic
924033883 1:239915718-239915740 CTGTAGACACATAACATGGAAGG + Intergenic
924369912 1:243336679-243336701 CTGTAATCCCCGATGTTGGAGGG - Intronic
1063856256 10:10257470-10257492 CTGGAAACATAGAAGTTGGAAGG - Intergenic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068673701 10:59748823-59748845 CTGGAATCAAAGATGTTGGAGGG - Intergenic
1070458760 10:76643970-76643992 CTGTACTCACAGTTGTTGGATGG + Intergenic
1073202499 10:101747250-101747272 GTGTAGAGACAGAGGTTGCAGGG + Intergenic
1076679996 10:132166867-132166889 CTGAAGACAGAGCTGTTGGCAGG - Intronic
1081404031 11:42675585-42675607 TTGTAGACACAGAGATTGGGTGG - Intergenic
1081559308 11:44198209-44198231 CTGTAGCCACAAGTGTTTGAGGG + Intronic
1083203857 11:61135675-61135697 CTGTAGTCCCAGCTATTGGAAGG - Intronic
1085035320 11:73296558-73296580 CGGTAGACACAGGTGGTGGGTGG - Exonic
1087419783 11:97907398-97907420 CTTTAAACACAGATGTCAGAAGG + Intergenic
1088167176 11:106952760-106952782 CTGTAGTCCCAGATATTGGGAGG - Intronic
1089797191 11:120990494-120990516 CCCTAGATACAGATGATGGAGGG - Intergenic
1090127422 11:124101984-124102006 CAGGAGCCACAGATGTTGGAAGG - Intergenic
1091496191 12:974910-974932 CTGTAACCACAGGTGTTGGAAGG - Intronic
1093598524 12:20992042-20992064 CTGCAGACAAGGAAGTTGGAGGG - Intergenic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1096789534 12:54036213-54036235 CAGTAGAAACAAATGTGGGAAGG + Intronic
1098991446 12:77068397-77068419 CAGTTGACACTGATGTTGGCTGG + Intergenic
1100594438 12:96059849-96059871 CTCTATACACTGCTGTTGGATGG + Intergenic
1104942047 12:132399767-132399789 CTGGAGACTCAGGCGTTGGAGGG - Intergenic
1105348007 13:19591429-19591451 GTGTAGACACAGCTGATGGAGGG - Intergenic
1105555715 13:21446824-21446846 CTATAGACAGAGGTGTGGGAGGG - Intronic
1106758625 13:32846568-32846590 CTGTAGACACACATCTGGGAGGG + Intergenic
1106892269 13:34258476-34258498 CAGTATACACAGAGGTTGTACGG - Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1108119160 13:47164569-47164591 CTGGAAACACATATGTTGGTTGG - Intergenic
1108743108 13:53359440-53359462 CTGCAGACACAGATGTACGTGGG + Intergenic
1108775498 13:53761052-53761074 GGGAAGACACAGATGTTGAAGGG + Intergenic
1109642190 13:65204696-65204718 CTGTAGAGACAAAGGTTGGCAGG + Intergenic
1109837639 13:67879395-67879417 CTGTAACCTCACATGTTGGAGGG + Intergenic
1111181737 13:84677651-84677673 CTGTAGGGACCTATGTTGGATGG + Intergenic
1111877939 13:93919987-93920009 CTGTAGAGAGAGATGAGGGAGGG - Intronic
1112585656 13:100716394-100716416 CTTCAGACACAGACCTTGGAGGG - Intergenic
1112657460 13:101467038-101467060 CTGTATCCTCACATGTTGGAAGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114754447 14:25243983-25244005 CTGTTTACAAAGCTGTTGGAGGG - Intergenic
1114858074 14:26476836-26476858 CTGTAGTCACAGCTGCTGGGAGG - Intronic
1117819540 14:59633162-59633184 GTGTGGAGAGAGATGTTGGATGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120248584 14:82034380-82034402 CTGTTGACAGAGAGATTGGAGGG + Intergenic
1121300649 14:92867971-92867993 CTGTATCCTCACATGTTGGAAGG + Intergenic
1122770908 14:104097252-104097274 CTGCAGCCACAGCTGTTGGTGGG + Intronic
1125526982 15:40382874-40382896 CTGTAGACAGCCATGTTGTACGG - Exonic
1126387360 15:48107787-48107809 CTTGACACACAGGTGTTGGAAGG + Intergenic
1127243707 15:57148307-57148329 CTGTAGTCCCAGCTGTTTGAAGG + Intronic
1128757062 15:70190281-70190303 CTGATGAGAGAGATGTTGGACGG + Intergenic
1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG + Intronic
1131911595 15:97211154-97211176 CTGTAGCCACATATTTTAGATGG + Intergenic
1133550372 16:6848619-6848641 GTGTAGAGAGAGATGATGGAAGG + Intronic
1133950925 16:10391772-10391794 CTGTAGTCCCAGCTGCTGGAGGG + Intronic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1135561586 16:23480704-23480726 CTGTACAAACAGGTGATGGAGGG - Exonic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1137902873 16:52288044-52288066 CTGAAGACCCAGAAATTGGATGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139230973 16:65281879-65281901 TTGTAGAGAGAGATGTAGGAAGG - Intergenic
1142039221 16:87881904-87881926 CAGGAGACAAAGATGTTGGTGGG + Exonic
1142516805 17:436812-436834 CTGCTCACACAGATGTTGGAAGG - Intergenic
1145189507 17:20826713-20826735 CTGCAGTCCCAGATATTGGAGGG + Intergenic
1146006349 17:29163064-29163086 GTGTGGACACAGTTGATGGATGG + Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1147270132 17:39263391-39263413 CTGTAGTCTCAGCTGTTGGGAGG + Intronic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148203312 17:45764204-45764226 TTGTAGTAACAGATGATGGATGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148774951 17:50090033-50090055 CTGGACAGACAGATGTTGGGAGG + Intronic
1149283353 17:55132508-55132530 CTTTAGAAAAAGATGTTGAAAGG - Intronic
1150127747 17:62649197-62649219 CTGTCGTCACAGAAGTTGGCAGG + Intronic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1153409674 18:4779573-4779595 CAGTAGACATATATGTTGGTTGG - Intergenic
1156821856 18:41382798-41382820 GTATAGACACAGATGTTGGTGGG - Intergenic
1159743480 18:72202616-72202638 ATGTAGACAGAGATGTTTGGGGG - Intergenic
1159794550 18:72826353-72826375 CTACAGACACACATGTAGGAGGG - Intronic
1160224278 18:77000000-77000022 ATGTAGACTCAGATGCTGGGGGG + Intronic
1160987701 19:1847038-1847060 CTGTAGGCACAGCTGTCGGCAGG + Intronic
1161253281 19:3292948-3292970 CTGGAGACACAGATCCTGGCTGG + Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1166381334 19:42356793-42356815 CGGTGGACACAGATGCTGGCGGG + Exonic
1167765273 19:51478559-51478581 CAGGAGACACAGGTCTTGGAGGG + Intergenic
1168298729 19:55390881-55390903 TTGGAGAGAGAGATGTTGGATGG + Intronic
1168471631 19:56644879-56644901 CTGTAGTCTCAGATATTGGAAGG - Intronic
1168703270 19:58453946-58453968 CTGTAGACACAAAGTTTGGTTGG + Intronic
925842985 2:8009660-8009682 TTGTGGAATCAGATGTTGGATGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
928304750 2:30159021-30159043 CTCTACACACTGCTGTTGGATGG - Exonic
928806116 2:35157864-35157886 TTGTAGAGAGTGATGTTGGATGG - Intergenic
929261059 2:39866997-39867019 CTGTAAAAACATATGTTGAATGG + Intergenic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
932102616 2:68914467-68914489 TTATACACACAGATGCTGGAAGG + Intergenic
933380389 2:81535907-81535929 CTGTAGACACAATTGTTCTAGGG - Intergenic
934112779 2:88757820-88757842 TTGTTGACACAGTTGTTGGAAGG - Intergenic
936163982 2:110104281-110104303 TTGTTGACACAGTCGTTGGAAGG - Intronic
940591205 2:155730147-155730169 CTGTAGAAACAGATGCTGATAGG + Intergenic
941134968 2:161703859-161703881 CTGTTGAGGCAGATGTTGTAGGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
944001104 2:194839239-194839261 GAGTTGTCACAGATGTTGGAGGG + Intergenic
947416181 2:229898873-229898895 TTGTAGAGACAGAGGTTGGGAGG + Intronic
947701965 2:232242159-232242181 CTTTAAACAGAGATGTTGGCTGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168884018 20:1232256-1232278 CAGGAGACACAGATGATGTAGGG + Intronic
1169160987 20:3378234-3378256 CTTTAGACACTGATGTCTGAGGG - Intronic
1169796646 20:9469778-9469800 CTTTAGACACAGCTGGTGAAGGG + Intronic
1171232131 20:23495931-23495953 AAGTAGTCACAGAGGTTGGAGGG - Exonic
1171507899 20:25653846-25653868 CTGTAGTCACAGCTGTTTGGTGG + Intergenic
1172443832 20:34982928-34982950 CATTAGACACAGAGGTTGGCTGG + Intronic
1174021609 20:47534791-47534813 CTGTAGTCCCAGCTGTTGGGTGG + Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176212460 20:63931634-63931656 CTGTAGTCACAGAGATGGGAAGG + Exonic
1176836908 21:13801509-13801531 CAGTAGACACAGATTTTCCAGGG + Intergenic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1177759081 21:25382510-25382532 CTGTAGACACCGGGGTTGGTTGG - Intergenic
1177904906 21:26963891-26963913 ATGTAAACAAAGATGCTGGAGGG - Intronic
1184514518 22:44953863-44953885 CAGTTGGCACAGCTGTTGGATGG - Intronic
949151878 3:778979-779001 CCGTAGACAAAGATTTTGAAAGG - Intergenic
952278991 3:31904792-31904814 CTGTAGACACAGATTTTGACAGG - Intronic
952858972 3:37796444-37796466 CTGCAGACACATTTGTTGGTTGG + Intronic
954073817 3:48162116-48162138 CTTTGGAGACAGATGTTTGAAGG + Intronic
954730300 3:52654909-52654931 CTGTAGTCACAGCTGTTTGGTGG - Intronic
956339359 3:68204418-68204440 CTGTGGACAAAGGGGTTGGAAGG - Intronic
956790474 3:72676299-72676321 CTGGAGTCACAAATTTTGGAGGG + Intergenic
957900667 3:86484639-86484661 CTGTTGACACAGCTCTTAGAAGG - Intergenic
958095198 3:88935100-88935122 ATGTGGATACATATGTTGGAGGG + Intergenic
960650779 3:119946670-119946692 CTGAAGAGAAAGAGGTTGGAAGG + Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
963382102 3:144543463-144543485 CTGGAGACACACATTTGGGAAGG + Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
964124170 3:153218540-153218562 CTGTAGCCCCAGATGTGAGAGGG + Intergenic
967183476 3:186926848-186926870 CTGCAGCCTCACATGTTGGAAGG + Intergenic
967452130 3:189637373-189637395 ATGAAGACACAATTGTTGGAAGG - Intronic
967976946 3:195040829-195040851 CGGGTGACACAGGTGTTGGAGGG - Intergenic
969180092 4:5433668-5433690 CTGTGGAAACAGATCCTGGAAGG + Intronic
971980474 4:33743742-33743764 CTGTAAATTCAGATGTTGGTTGG - Intergenic
972175224 4:36396586-36396608 CTGTAACCTCACATGTTGGAAGG + Intergenic
972533497 4:39980615-39980637 CTGTAGTCCCAGATCTTGGGAGG - Intergenic
972761517 4:42109984-42110006 GTGTAGACAGTGATTTTGGATGG - Intergenic
973560311 4:52128820-52128842 AAGAAGAGACAGATGTTGGATGG - Intergenic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
975106638 4:70574656-70574678 GTGTGGACACAGGTGTTAGATGG - Intergenic
975182805 4:71366466-71366488 CTGTAGAAAAAGATGTTGTGAGG - Intronic
975576241 4:75865506-75865528 CTGTAGACCCAGCTATTGGGAGG - Intronic
975815983 4:78217400-78217422 CTGTAGGCAAAGTTGTTGGGGGG + Intronic
976783415 4:88787985-88788007 CTGTAGGCACAGATTTTTTAAGG - Intronic
978347450 4:107787172-107787194 CTGCAGACCCAGATGTTCTATGG + Intergenic
978762733 4:112372333-112372355 CTGTAGTCACAGCTATTGGGAGG - Intronic
979724158 4:123940764-123940786 AAGCAGAGACAGATGTTGGAAGG - Intergenic
980508390 4:133754126-133754148 CTGTGGCCTCACATGTTGGAAGG + Intergenic
980539662 4:134177296-134177318 CTGTAGTCCCAGCTGTTGGGAGG - Intergenic
981914547 4:150019474-150019496 CTGTAGCTACAGGTGTTAGAGGG - Intergenic
982359549 4:154504918-154504940 CTGTAGACCCAGCTATTGGGAGG - Intergenic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
984280803 4:177667994-177668016 CAGTATAAACAGATGTTTGAAGG - Intergenic
985655118 5:1127424-1127446 CTGGAGCCGCAGAAGTTGGAAGG + Intergenic
985763375 5:1763365-1763387 CTCTAGACACAGAGGGTGGCCGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990494220 5:56330961-56330983 CTGCAGATTCAGATGTGGGAGGG + Intergenic
993526286 5:88969821-88969843 TTTTAGACACAGATGATGGTGGG - Intergenic
994682816 5:102910380-102910402 CTGAAAGCACAGAGGTTGGAGGG - Intronic
997967132 5:138366869-138366891 CTGTTGACAAAGATGTTGTTTGG - Intronic
997974719 5:138434034-138434056 ATGTAAACACCAATGTTGGACGG - Intronic
999810241 5:155120594-155120616 ATGTTTACACAGAGGTTGGATGG + Intergenic
999902976 5:156106765-156106787 CTGTATACACAGATATTAGTGGG - Intronic
1000600039 5:163261814-163261836 CTGTACACACGGATGTTGGCTGG - Intergenic
1001433004 5:171678265-171678287 GTGAAAACCCAGATGTTGGATGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001886807 5:175299590-175299612 CTATAGCCACACATGGTGGAAGG - Intergenic
1002276831 5:178109318-178109340 CTGTCCAGGCAGATGTTGGAGGG + Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1014008135 6:116444714-116444736 CTGTAGCCTCACATGTTGGAAGG - Intergenic
1017047157 6:150357439-150357461 ATGTAGACTCAGAAGTTAGATGG + Intergenic
1017696143 6:157018336-157018358 CTGTAGTCCCAGCTGTTGGGAGG - Intronic
1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG + Intronic
1018564209 6:165134799-165134821 ATTATGACACAGATGTTGGAAGG - Intergenic
1018653909 6:166013879-166013901 ATGAAGACAAAGATGCTGGAAGG + Intergenic
1018940911 6:168308456-168308478 CTGAGGACACAGCTGTTTGAGGG + Exonic
1019001934 6:168761272-168761294 CTGTAGACTCAGGAGTTGCAAGG - Intergenic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1021187891 7:17586495-17586517 CAGAAGACACAGAAGTTGTAAGG - Intergenic
1021457705 7:20847570-20847592 CAGTAGACACTGCTATTGGAAGG + Intergenic
1022002261 7:26237166-26237188 TTGTAGAGGCATATGTTGGAGGG - Intergenic
1023168164 7:37363530-37363552 CTGGAGCCACTGATGTGGGATGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1030524056 7:110632476-110632498 CTGCAGACACAGCAGTTGAATGG + Intergenic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1031322763 7:120353643-120353665 CTATAGACCCATATGTTTGATGG - Intronic
1033319111 7:140323753-140323775 CTATAGACACAGAAGTGTGATGG + Intronic
1034237809 7:149586208-149586230 CTGTAGACAAAAATGCTGGTGGG - Intergenic
1034240888 7:149609877-149609899 CTGTGGACAGAGATGCTGGTGGG - Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034768135 7:153746993-153747015 CTGTAGATGCAGATGCTGGTTGG - Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035314350 7:157988864-157988886 CTTTAGACACAGATGTGAGAAGG - Intronic
1035491683 7:159284830-159284852 CTGGAGCCAGAGATGCTGGATGG + Intergenic
1036284088 8:7428523-7428545 CTGAAGACAAAGTTTTTGGAAGG + Intergenic
1036337388 8:7883007-7883029 CTGAAGACAAAGTTTTTGGAAGG - Intergenic
1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG + Intergenic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1039462864 8:37760800-37760822 CTGTAGAGACACAGGTGGGAAGG - Intergenic
1042040831 8:64586914-64586936 CTTTAGACACAGTAGGTGGAAGG + Intergenic
1044190166 8:89306560-89306582 CTGTAGACACTGATTTGGGAGGG - Intergenic
1044200912 8:89435006-89435028 CTGTAAACAAAGATGTCGAAAGG + Intergenic
1044687700 8:94843657-94843679 CTGTATACACATATGATGGAGGG + Intronic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1048406914 8:134132547-134132569 TTGTAGACTCAGCTGTAGGAAGG - Intergenic
1048810017 8:138277071-138277093 CTGCAGACACAGGTCTTGGCAGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1051318791 9:15876578-15876600 ATGTAGACACATATGTTACATGG + Intronic
1051607172 9:18927408-18927430 CTTTAGTCACAGGTGATGGAGGG - Intergenic
1051948314 9:22599248-22599270 CAGAACAGACAGATGTTGGATGG + Intergenic
1055891630 9:81130276-81130298 GTTTAGACCCAGATTTTGGACGG + Intergenic
1056950036 9:91034513-91034535 CTGCAGACCCAGATGCTGGTGGG + Intergenic
1056999301 9:91492854-91492876 CTGGAGCCACAGGTGCTGGAGGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059061889 9:111041654-111041676 CTGTAGTCCCAGCTGTTGGGAGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061387732 9:130300347-130300369 CTGTAGACACAGCAGTGGGCAGG + Intronic
1061810321 9:133158761-133158783 TTCTGGACACAAATGTTGGATGG - Intronic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186450848 X:9672545-9672567 CTACAGGCACAGATGTGGGAGGG - Intronic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1187470698 X:19567006-19567028 CTTTAGAAACAGATGTGCGATGG - Intronic
1187771955 X:22708845-22708867 GTGGAGACAAAGATGTGGGAAGG - Intergenic
1192467149 X:71365589-71365611 CTGTAGTCCCAGCTGTTGGGGGG - Intergenic
1192912979 X:75624689-75624711 TTGTTGTCACAGATGCTGGAGGG + Intergenic
1195868167 X:109456097-109456119 CTGTAGAAACAGATCATGAATGG + Intronic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197083336 X:122444410-122444432 ATGTAGACACAAATGTTCGATGG - Intergenic
1198050032 X:132942716-132942738 GTGTAGACACAGCCTTTGGAGGG - Intronic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1200987288 Y:9316178-9316200 CTGAGGACTCAGAAGTTGGATGG + Intergenic
1201427554 Y:13870047-13870069 CTATAGACATAAATGTGGGAAGG - Intergenic
1202196895 Y:22306514-22306536 CGGCAGACCCAGATGTTGGCCGG - Intergenic