ID: 1011717186

View in Genome Browser
Species Human (GRCh38)
Location 6:90119289-90119311
Sequence AATTAGGTAAAGACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011717186_1011717189 21 Left 1011717186 6:90119289-90119311 CCCAGCTCTGTCTTTACCTAATT 0: 1
1: 0
2: 3
3: 36
4: 338
Right 1011717189 6:90119333-90119355 TATAATACGAAGACTTAATGAGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011717186 Original CRISPR AATTAGGTAAAGACAGAGCT GGG (reversed) Intronic
902106940 1:14045411-14045433 CATTAGCAAATGACAGAGCTTGG - Intergenic
903504558 1:23824279-23824301 AATTAGAAAGTGACAGAGCTTGG + Intronic
903948793 1:26981582-26981604 ACTAAGGTAGAGACACAGCTTGG - Intergenic
903957827 1:27037145-27037167 AACTAGTTAGTGACAGAGCTGGG - Intergenic
904203727 1:28838823-28838845 AATTAGTTAGGGACAGAGCTGGG + Intronic
906656784 1:47554090-47554112 AAATAGGAAAAGTCAGGGCTGGG - Intergenic
907381664 1:54095741-54095763 AATTACTAAGAGACAGAGCTGGG - Intronic
907548743 1:55286223-55286245 AATGAACTAGAGACAGAGCTGGG + Intergenic
907621745 1:55988310-55988332 AGTTAGTTAATGCCAGAGCTGGG + Intergenic
907649983 1:56285860-56285882 GATTGGGTAAAGGCAGAGCCTGG + Intergenic
907949211 1:59164746-59164768 AATAAGGCAAAGAAAGAGTTGGG - Intergenic
909703551 1:78553702-78553724 CATTAGGTGAAGACTGCGCTGGG - Intergenic
911530574 1:99038654-99038676 ATTTTGGAAAAGACAGATCTGGG + Intergenic
912507430 1:110165794-110165816 AATAAAGTAATTACAGAGCTGGG + Intronic
912961427 1:114198858-114198880 AACTAGGAAATCACAGAGCTTGG + Intergenic
913261121 1:116999053-116999075 AAATAAATAAAGACAGAGGTGGG - Intergenic
914452431 1:147804463-147804485 AAGTAGGTAGCGGCAGAGCTGGG - Intergenic
915659818 1:157394006-157394028 GAGTAGGTAGAGACAGAGATAGG - Intergenic
915813719 1:158944448-158944470 AACAAGGTAAAGACAGACATTGG + Intronic
918335168 1:183503078-183503100 AACTAGGAAATGGCAGAGCTTGG - Intronic
920247391 1:204598705-204598727 AATTAGTAAATGACAGAGCCAGG + Intergenic
921144560 1:212341298-212341320 AATTACGTAAGTACAGGGCTAGG - Intronic
921347573 1:214202918-214202940 AAGGAGGTAAGGACAGCGCTTGG + Intergenic
922015617 1:221643511-221643533 AATTATGTAAAATCAGAACTTGG - Intergenic
923299003 1:232623212-232623234 AATCACATACAGACAGAGCTAGG + Intergenic
924022723 1:239801322-239801344 AAGTAGGTACAGCCAGGGCTAGG + Intronic
924757033 1:246950744-246950766 AACTAGGAAGAGACAGAGCCAGG - Intronic
1064752096 10:18540831-18540853 AATTAATTAAATACAGAGCGAGG - Exonic
1065711292 10:28520926-28520948 ATTTAGTGTAAGACAGAGCTGGG + Intergenic
1066524878 10:36266769-36266791 AATTTTGGAAAGACAGAGTTTGG + Intergenic
1066609401 10:37223911-37223933 AATTAGGAAAAGAAATAACTGGG + Intronic
1068642776 10:59428893-59428915 AATAAGGAAAAGAAAGAGCATGG + Intergenic
1068859609 10:61833984-61834006 AGCTAGTTAAAAACAGAGCTGGG + Intergenic
1069081774 10:64096156-64096178 AAGTAGCTAAACAGAGAGCTTGG + Intergenic
1069496812 10:68912146-68912168 AATTAGGAAAAGACTGAAATAGG + Intronic
1070563598 10:77586849-77586871 GATCAGGTAAAAATAGAGCTAGG - Intronic
1071018238 10:81022795-81022817 AATGAGGTAGAGAAGGAGCTAGG + Intergenic
1072386034 10:94929132-94929154 ACTTAGGTACAGACACAGATTGG - Intergenic
1076492187 10:130869427-130869449 AAGTAGGGAAACACAGGGCTGGG - Intergenic
1076760796 10:132605074-132605096 AAGCAGGTAAGGACAGAGCAGGG + Intronic
1077220841 11:1415387-1415409 AAAAAGGTAAAGACAGGGCCAGG - Intronic
1077373925 11:2196412-2196434 AATTAGAGAGAGACAGAGATGGG - Intergenic
1077653467 11:3995953-3995975 AACTAGGGAAAGAGACAGCTGGG - Intronic
1077729291 11:4711923-4711945 AATCAGGAAAAGAAAGAGGTGGG - Intronic
1077954369 11:6998927-6998949 AATTATGTAAAAAGAGAGTTTGG - Intergenic
1078956675 11:16204868-16204890 AATTAGCTAGTGACAGAGTTAGG + Intronic
1079208166 11:18435879-18435901 AATTCAGTAAAGAGAGAGGTTGG - Intronic
1079784092 11:24649070-24649092 AATTAGGGAAAGACAAAACATGG + Intronic
1080947819 11:36994835-36994857 AGCTAGGAAATGACAGAGCTGGG - Intergenic
1081756170 11:45546265-45546287 AATGAAGTATAGACAGAGCCAGG - Intergenic
1084532921 11:69739680-69739702 CATAAGGGAAAGACAGACCTTGG - Intergenic
1084961535 11:72719395-72719417 AATTAACTAGAGACAGGGCTTGG + Intronic
1085876506 11:80413424-80413446 GGTTAGATAAAGACAGAGTTGGG - Intergenic
1085877952 11:80431429-80431451 ATATCGTTAAAGACAGAGCTGGG - Intergenic
1089149375 11:116353004-116353026 AATTAGGTAAGGAGAGAGCCAGG - Intergenic
1090112264 11:123925992-123926014 AATTAAGTAAATGCAGGGCTAGG - Intergenic
1091259294 11:134221715-134221737 AATAAGGAAAAAACAGAGATGGG + Intronic
1091600754 12:1916424-1916446 TAGTAGGTAGAGACAGGGCTGGG + Intronic
1092567207 12:9680004-9680026 ATTTGGGTAAAGACACAGCTAGG - Intronic
1094163775 12:27421077-27421099 ACTTAGGCAAGCACAGAGCTGGG + Intronic
1096356367 12:50944230-50944252 ACTTAGCAAAAGACAGACCTGGG - Intergenic
1096368354 12:51047710-51047732 ATTTAAGTTGAGACAGAGCTTGG + Intergenic
1097153725 12:56997455-56997477 AATTAGGAAAAGACATGGCCAGG - Intergenic
1098415401 12:70229364-70229386 ACTTAAGTAAAGCCAGGGCTGGG - Intergenic
1098447283 12:70579259-70579281 AATAAGTTAATGGCAGAGCTAGG + Intronic
1098721968 12:73911769-73911791 TACTAGGTGCAGACAGAGCTAGG - Intergenic
1101025192 12:100596458-100596480 AAATCAGTAAAGACAGATCTTGG - Intronic
1101833758 12:108280439-108280461 AATTTGGTGAAGACAAGGCTTGG - Intergenic
1101948689 12:109157652-109157674 TAATAAGTAAAGACAGAGTTCGG + Intronic
1102027016 12:109719427-109719449 CTTTAGGTAAAGACTGAGCAAGG + Intronic
1102162087 12:110777670-110777692 AATTAGGTAATGGCAGATCCAGG - Intergenic
1102222155 12:111201884-111201906 AATCAGGCAAAAGCAGAGCTGGG - Intronic
1102738782 12:115187515-115187537 AATTAGCTGAAGCCAGAACTAGG + Intergenic
1103039850 12:117685846-117685868 ACTTAGGTAATGACAGAGCTAGG - Intronic
1103705591 12:122869901-122869923 ATTTAGATAAAGTCAGAGCTGGG - Intronic
1103906138 12:124328102-124328124 AATTGGCTCAAGCCAGAGCTGGG + Intronic
1105447307 13:20468900-20468922 AACTAGGTAAAGGGAGCGCTGGG - Intronic
1105795663 13:23849871-23849893 ATTAAGGTAAAGAAAGAACTTGG + Intronic
1106458203 13:29945830-29945852 AATTAGTTATAGACACAGATGGG + Intergenic
1107232377 13:38125323-38125345 AATTAGCTCATGACAGATCTTGG - Intergenic
1107315628 13:39128432-39128454 ATTTAGGTTAATACACAGCTAGG + Intergenic
1107535139 13:41322086-41322108 AATTAAGTTAAAAGAGAGCTAGG + Intronic
1107575434 13:41715155-41715177 ATTTATGTAAAGAAAGTGCTTGG + Intronic
1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG + Intergenic
1109310096 13:60683450-60683472 AGTGAGTTAAAGACAGAACTGGG - Intergenic
1109586137 13:64407261-64407283 AATAAGTTAAAAAGAGAGCTGGG + Intergenic
1109640727 13:65188180-65188202 ATTTAAGTAAAGACAGATTTTGG - Intergenic
1111265893 13:85812856-85812878 TATTAGGTTAAGACAGAAATAGG - Intergenic
1112493865 13:99890214-99890236 GACTAGGGAAAGCCAGAGCTGGG - Intronic
1112882259 13:104122554-104122576 AACTGGGTAAAGGCAGGGCTTGG + Intergenic
1113306520 13:109085126-109085148 AACTAGGGAAAGACACAGCAAGG + Intronic
1113384530 13:109836576-109836598 AATTGGGTAAAGAGTGACCTTGG + Intergenic
1113888073 13:113671426-113671448 AATCATGGAAAGACAGAGCTGGG - Intronic
1117555732 14:56881264-56881286 ACTCAGGGAAAGACAGAGTTTGG - Intergenic
1118126076 14:62905864-62905886 AATTAGGTCAAGACTGAGACTGG + Intronic
1119626133 14:76177779-76177801 AATTAAGTAAAGACAAAGAAGGG - Intronic
1119664079 14:76472039-76472061 AGCTAGTTAATGACAGAGCTGGG + Intronic
1120745656 14:88148705-88148727 AATTTGGGAAAGACAGTGATTGG + Intergenic
1120751242 14:88200442-88200464 AATTAGGTACACACGTAGCTGGG - Intronic
1121181949 14:91935625-91935647 AGTTAGGTAATTACAGAGGTAGG - Intronic
1121222099 14:92293640-92293662 GATTGGGTAAAGACAGAAATGGG - Intergenic
1121237413 14:92402698-92402720 CAGCAGGCAAAGACAGAGCTTGG + Intronic
1121635791 14:95453121-95453143 AGCTAGGAAAAGACAGAGGTGGG - Intronic
1121878169 14:97473873-97473895 CATTGGGAAAAGACAGAGATAGG + Intergenic
1123051083 14:105543339-105543361 AATTAAGACAAGACAAAGCTAGG + Intergenic
1123922427 15:25079820-25079842 AATCAGGTAAAGCCAGAGTTGGG + Intergenic
1124513874 15:30349899-30349921 AATTAGGTAAAAAGAGAGTAAGG - Intergenic
1124729047 15:32180866-32180888 AATTAGGTAAAAAGAGAGTAAGG + Intergenic
1126407617 15:48337401-48337423 AACTAGTTAATGACAGAGCTGGG - Intronic
1128103307 15:65023993-65024015 ATTTAATTAAAAACAGAGCTAGG + Intronic
1128140745 15:65299032-65299054 AATAAGATAAAAACATAGCTGGG - Intronic
1128209082 15:65880109-65880131 AATTTAGTAAAGGCAAAGCTAGG + Intronic
1128327085 15:66730837-66730859 AAGCTGGTAAATACAGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1137580604 16:49631470-49631492 AATTACAGAAAGACAGAACTTGG + Intronic
1139227558 16:65247882-65247904 AGTTAGACAAAGACAGATCTGGG + Intergenic
1140135947 16:72205604-72205626 AATGATGCAAAGACAGAGCATGG + Intergenic
1141346975 16:83255761-83255783 AATCAGGAAAAGGCAGAGTTGGG - Intronic
1144196850 17:12902714-12902736 AATTAGGAAGTGACAGAACTGGG - Intronic
1144542734 17:16160430-16160452 AATTAGGTAAAGACAAATTAAGG + Intronic
1145816019 17:27795625-27795647 AATTAGCAAATGACAGAGCTGGG - Intronic
1146599238 17:34200109-34200131 AAGTAGGTAAAGACATTGCCAGG - Intergenic
1147344008 17:39775116-39775138 AGTTAAGAAATGACAGAGCTAGG + Intronic
1147356798 17:39904810-39904832 AGTTAGGAAGAGACAGAGGTAGG + Exonic
1147526940 17:41234145-41234167 AATTATGTAAGAACAAAGCTGGG + Intronic
1147527449 17:41239706-41239728 AATTAAGTAAGAACAAAGCTGGG + Intronic
1147870083 17:43581077-43581099 AAATAGGAAGAGACAAAGCTGGG - Intergenic
1148139641 17:45318919-45318941 ACTCAGGGAAAGGCAGAGCTTGG + Intergenic
1148635572 17:49146609-49146631 AATTAAGAAAAGACAGTGTTGGG - Intronic
1148877943 17:50703445-50703467 CATTAGGGAATGACAGAGGTTGG + Intronic
1149021443 17:51970170-51970192 AATGAAGTAAAGACTTAGCTTGG - Intronic
1150202644 17:63373264-63373286 AATAAGGTAGAGACAGCTCTAGG - Intronic
1150609757 17:66724444-66724466 AGTTAGGTAAAGAAAGCGGTGGG - Intronic
1150724127 17:67637724-67637746 AATAAGGAAAGCACAGAGCTGGG - Intronic
1151659158 17:75509513-75509535 ACAAAGGTAAAGACAGAGCCAGG + Intronic
1152145980 17:78569149-78569171 ATTGAGGTAAAAACAGAACTCGG - Exonic
1153054578 18:933522-933544 AATTAGGTAGTGGCAGAGCTGGG + Intergenic
1155301314 18:24431990-24432012 AATTAGCTGAAGGCAGAGCATGG - Intronic
1155395065 18:25378355-25378377 AATTGAGTAAACACAGAGCGAGG - Intergenic
1156953582 18:42935085-42935107 AATTAAATAAAGAAACAGCTGGG + Intronic
1157303031 18:46493846-46493868 AAATATGTAAACACAGAGTTGGG - Intronic
1158423357 18:57315196-57315218 AACTAACTAAAGGCAGAGCTGGG - Intergenic
1158499145 18:57984294-57984316 AAGTAGGAAGTGACAGAGCTGGG + Intergenic
1158880803 18:61778154-61778176 AATTATTTAGTGACAGAGCTAGG - Intergenic
1159161113 18:64644760-64644782 GAATAGGTAAACACAGAGCATGG + Intergenic
1159317326 18:66793173-66793195 AATTAGATAAAGAAAGAGAAGGG - Intergenic
1161005950 19:1936670-1936692 AAATAGAGACAGACAGAGCTAGG + Intergenic
1162135769 19:8554460-8554482 CATTAGGTATGGACAGAGTTGGG - Exonic
1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG + Intronic
1167633258 19:50638930-50638952 AATTAGGAACAGACAGACCAGGG + Intronic
925288901 2:2733684-2733706 AAATGGGTAATGTCAGAGCTGGG + Intergenic
925763155 2:7206228-7206250 AGTTAGTTAAAGACACAGCAAGG - Intergenic
926718673 2:15942849-15942871 ATTCAGGTAAAGACCGAACTCGG + Exonic
926905557 2:17802013-17802035 GACTTGGTAAAGTCAGAGCTGGG - Intergenic
928085281 2:28342315-28342337 GATTAAGTAAAGACAGACATTGG - Intergenic
928200117 2:29242553-29242575 AACTAGGTCAAGACATAGATGGG - Intronic
930406284 2:50960442-50960464 ATTTAGGTCAAAACAGACCTTGG - Intronic
930868836 2:56149675-56149697 AAGAAGGAAAAGACAGAACTTGG - Intergenic
930898052 2:56469014-56469036 AATGGGGAAAAGACAGTGCTGGG + Intergenic
931381205 2:61755131-61755153 AATTAAGTATAGACAAGGCTGGG - Intergenic
932113045 2:69018699-69018721 GATTAGATCACGACAGAGCTAGG + Intronic
932308760 2:70723159-70723181 AATTAGAAAGAGGCAGAGCTGGG - Intronic
932840530 2:75077882-75077904 AATGAGATGAACACAGAGCTTGG - Intronic
934966329 2:98727011-98727033 ATGTAAGTAATGACAGAGCTGGG - Intronic
935100420 2:99989435-99989457 GATAAGGTAAACACAGATCTAGG - Intronic
935211296 2:100941202-100941224 AATTTGGTAAAGAAAGTTCTAGG - Intronic
935801578 2:106702196-106702218 TGTTTAGTAAAGACAGAGCTGGG - Intergenic
939589587 2:144047521-144047543 ATTTAGGTATACACAGAGATAGG - Intronic
940837320 2:158537730-158537752 AACTAGATAAATACAGCGCTGGG + Intronic
941392598 2:164932940-164932962 AAATGGGTAAAGACAGAGGAAGG - Intronic
941441953 2:165549426-165549448 AATTAGGCAGATATAGAGCTTGG + Intronic
941443109 2:165563407-165563429 AATGAGGTACAGAAACAGCTGGG - Intronic
941828442 2:169926143-169926165 AGTTAGATAAAGACAGTGGTTGG + Intronic
942542784 2:177031966-177031988 AATAAGGTAATAACAGAGCTTGG + Intergenic
943273572 2:185839631-185839653 AAAGAGGTACAGACAGAGGTGGG + Intergenic
943506338 2:188764138-188764160 AATTAGATAATGACAGTACTGGG - Intronic
943923472 2:193739897-193739919 AAGAAGGTAAAGAAAGAGGTAGG + Intergenic
944164231 2:196701265-196701287 ACTTAGTAAATGACAGAGCTAGG - Intronic
944178575 2:196861877-196861899 ATTAAGGTAAAGACAGGCCTAGG - Intronic
944847421 2:203682614-203682636 AATTAGTTAATGGCAGAGCTAGG + Intergenic
944961536 2:204880239-204880261 AATTAGTCAAAGACAGAGATAGG - Intronic
946200507 2:218068393-218068415 AATGAGGGAAAGACAGGGATGGG + Intronic
946706475 2:222463272-222463294 AAGATGGTAAAGACAGTGCTTGG - Intronic
1169023224 20:2346154-2346176 AAATAGTAAATGACAGAGCTGGG + Intergenic
1169097698 20:2917674-2917696 GATTAGAAAAAGATAGAGCTGGG + Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169541179 20:6601169-6601191 AGTTAGGTCTAGAAAGAGCTGGG + Intergenic
1169747561 20:8958182-8958204 AATTTGGTAGAGACACAGTTCGG + Intronic
1170169013 20:13390979-13391001 AATAAGGTAAAGACGGAAGTGGG + Intronic
1173309031 20:41879917-41879939 AAATAGGAAAAGACCAAGCTGGG - Intergenic
1173630464 20:44510333-44510355 AAGTAGGTTAAGACAGAGATAGG + Intronic
1173865656 20:46311144-46311166 AATTAGTTTATGGCAGAGCTGGG + Intergenic
1175055987 20:56198771-56198793 AATGAGGGGAAGACAGAACTGGG + Intergenic
1175495234 20:59409900-59409922 AATGAGGAATAGACAGAGATGGG + Intergenic
1176389322 21:6155475-6155497 AGTTAGGAAGAGACAGGGCTTGG + Intergenic
1177418103 21:20820831-20820853 AATTGGGGAAAGTCAGAGGTTGG - Intergenic
1177499675 21:21937128-21937150 AATTAGGTAAAGACTGAGTGAGG - Intergenic
1179440805 21:41392714-41392736 AGGTAGCTAAAGACAGAGCAGGG + Intronic
1179734148 21:43382763-43382785 AGTTAGGAAGAGACAGGGCTTGG - Intergenic
1180245424 21:46544214-46544236 ACTTAAGTAAAAACAGAACTGGG + Intronic
1182472035 22:30554748-30554770 AATTAGTTAAATACTGATCTCGG + Exonic
1182699211 22:32220386-32220408 CATTAGGTAAACAAAGAGCCAGG + Intronic
1183838506 22:40477442-40477464 GATTAGGTAGCAACAGAGCTAGG - Intronic
1184050863 22:42003351-42003373 ATTTAGTGTAAGACAGAGCTAGG - Intronic
1184119955 22:42443760-42443782 AGTTAGGAAACGGCAGAGCTGGG - Intergenic
949607405 3:5669193-5669215 AAATAGGAAGAGACAGAGTTTGG - Intergenic
949740831 3:7231768-7231790 AATTGGGAAGAGGCAGAGCTGGG + Intronic
950616602 3:14165092-14165114 AAGGAGGTAAAGTCTGAGCTGGG - Intronic
951119819 3:18913363-18913385 AATTAGGAAAAAGCAGAGCAGGG + Intergenic
951288867 3:20850597-20850619 AATTAACAAATGACAGAGCTGGG + Intergenic
953097889 3:39796714-39796736 AATAAGGAAAATGCAGAGCTAGG + Intergenic
958265823 3:91435843-91435865 GATAAGGAAAAGGCAGAGCTGGG - Intergenic
958745421 3:98128273-98128295 AAATAGGTCAAGACAGAAATAGG - Intergenic
959012727 3:101097409-101097431 ATTTAGTGTAAGACAGAGCTCGG + Intergenic
959983104 3:112540212-112540234 ATTTAGGAACAGACATAGCTAGG + Intronic
960330497 3:116354171-116354193 AATCAGTTAAAGTCAGATCTGGG - Intronic
960509782 3:118535485-118535507 ACTTATTTAAAGACACAGCTAGG + Intergenic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
963499066 3:146101787-146101809 AATGAGGAGATGACAGAGCTGGG + Intronic
965146249 3:164908487-164908509 AATCAGGTAAAATCAGAACTTGG + Intergenic
965638858 3:170812182-170812204 AATTAGGCAAACAAAAAGCTGGG - Intronic
966665295 3:182464828-182464850 CATTAGCTGAAGCCAGAGCTTGG - Intergenic
967909363 3:194528358-194528380 AATTAGGTGAAGAAAGGGCATGG - Intergenic
968781760 4:2587721-2587743 AATTTTGAAAAGAAAGAGCTGGG + Intronic
970947308 4:21710187-21710209 AACTAGGTAAAGGCAAAGCTTGG + Intronic
971558354 4:28041637-28041659 AATTAGATAGTGACAGAGCTGGG + Intergenic
972150623 4:36085188-36085210 AATAAGGTAAACAATGAGCTAGG - Intronic
972329388 4:38050338-38050360 AATTAGTTCACGGCAGAGCTAGG - Intronic
973172455 4:47162664-47162686 AATAAGGTAATGGCAGAACTGGG + Intronic
973310704 4:48706713-48706735 AATAAGTTACAGAAAGAGCTTGG + Intronic
973538034 4:51904509-51904531 GAGTTGGAAAAGACAGAGCTTGG - Intronic
973847258 4:54925651-54925673 AATTGGGTAATGATAGAGGTTGG - Intergenic
974034836 4:56808857-56808879 AATTAGGGAAAGAAGGAGTTAGG + Intergenic
974294567 4:59980393-59980415 AGTTAGGTTAAGACAGATCTTGG + Intergenic
974729410 4:65842658-65842680 AATTTGGCAAAGAAAGAACTAGG + Intergenic
976130799 4:81881997-81882019 AACTAGGTGGAGACAGAGCTGGG - Intronic
977476821 4:97521391-97521413 ATATAGTTAGAGACAGAGCTAGG + Intronic
979204688 4:118024045-118024067 AATTAGGTAAGTCCAGAGCAGGG + Intergenic
979395916 4:120188911-120188933 CATTAAGTAAGGACAGAGATTGG - Intergenic
979585842 4:122416186-122416208 AAGTAGTTAATGACACAGCTTGG + Intronic
980327932 4:131372347-131372369 ATTTTAGTAAAGACAGAGCATGG - Intergenic
981053064 4:140330954-140330976 AATTAGGAAAAGGCATACCTGGG + Intronic
981877515 4:149565431-149565453 AAATATGAAAAGACAGAACTGGG - Intergenic
981923161 4:150109275-150109297 AAGTAGGTAAGGACAGAATTTGG + Intronic
982057666 4:151569172-151569194 AATGAGGCATAGACAAAGCTGGG + Intronic
982463706 4:155704223-155704245 TTTAAGGAAAAGACAGAGCTGGG + Intronic
983865665 4:172762506-172762528 GAAAAGGTAAAGACAGAGCCTGG - Intronic
984067832 4:175071253-175071275 AATTATGTAAAAACAGACATTGG - Intergenic
984579232 4:181491544-181491566 AATTATGCAAAGACAGAGTAAGG + Intergenic
986930514 5:12814080-12814102 AATAAGATAAAAACAGAGCAAGG + Intergenic
986934791 5:12869775-12869797 ACTTAGCTAAAGACAGATCTAGG - Intergenic
987674957 5:21062779-21062801 AACTGGGTAAAGGCAGAGGTTGG + Intergenic
988335898 5:29909006-29909028 CAGCAGGTAAAGAGAGAGCTTGG + Intergenic
988862463 5:35297859-35297881 ATATAGGCATAGACAGAGCTAGG + Intergenic
988999065 5:36742432-36742454 AACTAGTAAATGACAGAGCTAGG + Intergenic
989806081 5:45607102-45607124 ACTTAGGTAAAGACATATTTTGG + Intronic
990264057 5:54056787-54056809 AGTTAGTAAAAGACAGAGCTAGG - Intronic
990950404 5:61293037-61293059 AATGAGGCAGAGGCAGAGCTGGG + Intergenic
991384913 5:66076115-66076137 AGTGAGTTAAAGGCAGAGCTGGG - Intronic
992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG + Intergenic
992464283 5:76988354-76988376 AATTAGAGAAAAACACAGCTGGG - Intergenic
993721594 5:91326357-91326379 AAATAGACAAAGACAGAGATGGG - Intergenic
994274552 5:97820749-97820771 AATGAGGTAGAGAAAGAGATAGG - Intergenic
995159208 5:108957084-108957106 GAACAAGTAAAGACAGAGCTAGG - Intronic
995332770 5:110964154-110964176 AATTAGGAAGTGGCAGAGCTGGG + Intergenic
995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG + Intergenic
996974723 5:129417327-129417349 AACTAGGAAAAGACAAAGCTAGG + Intergenic
998363217 5:141609463-141609485 AACTAGTTAGTGACAGAGCTAGG - Intronic
999477588 5:151915024-151915046 AACTAGTAAAAGGCAGAGCTAGG - Intronic
999649696 5:153753515-153753537 AGTAAGGCAATGACAGAGCTGGG - Intronic
999704777 5:154262268-154262290 AATTTGGCTAAGCCAGAGCTAGG + Intronic
1001949284 5:175804937-175804959 AGTTAAGTATAGAAAGAGCTTGG - Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1002580717 5:180208325-180208347 ACTGTGGGAAAGACAGAGCTGGG - Intronic
1003236027 6:4295765-4295787 AACTTGGTGGAGACAGAGCTTGG + Intergenic
1005883797 6:30079587-30079609 AATTTGGTAATGACAGATTTAGG - Intergenic
1007552148 6:42738332-42738354 AATTAGTTAAAGACTGGGCGCGG + Intergenic
1007570834 6:42889636-42889658 ATTTAGTGTAAGACAGAGCTGGG - Exonic
1008167622 6:48158816-48158838 AACCAGGGAAAGACAAAGCTAGG - Intergenic
1008192520 6:48476683-48476705 AATCCTGGAAAGACAGAGCTAGG + Intergenic
1008274018 6:49522409-49522431 AATTAGTAAATGACAGAGCAGGG - Intronic
1008363183 6:50645552-50645574 AATTAGGTAAAGAAAGTCATTGG + Intergenic
1008989537 6:57586793-57586815 GATAAGGAAAAGGCAGAGCTGGG + Intronic
1009178122 6:60485349-60485371 GATAAGGAAAAGGCAGAGCTGGG + Intergenic
1009357979 6:62775934-62775956 AATTAGGACACCACAGAGCTTGG - Intergenic
1010716485 6:79235306-79235328 AATTAGGAAAAGAAAGAACAAGG + Intergenic
1011331891 6:86217625-86217647 AACAAGATAAAGACAGAGCTTGG + Intergenic
1011717186 6:90119289-90119311 AATTAGGTAAAGACAGAGCTGGG - Intronic
1014072189 6:117195598-117195620 AATTAGGTTAATACAGAGAATGG + Intergenic
1015791196 6:136966169-136966191 AGTAAGATATAGACAGAGCTGGG + Intergenic
1016546184 6:145227278-145227300 AATTAGGTGTAGACAGATCAAGG + Intergenic
1016819743 6:148336122-148336144 AATGAGGTCAAGACAAAGCTAGG - Intronic
1016834523 6:148464049-148464071 AATTTGTTAAAGACAGAGGTAGG + Intronic
1017345829 6:153379673-153379695 CATTAGGCAATCACAGAGCTGGG + Intergenic
1018310655 6:162504870-162504892 AATTGAGGAAAGACAGAACTAGG + Intronic
1018338570 6:162824045-162824067 AGGCAGGCAAAGACAGAGCTGGG - Intronic
1022242006 7:28521464-28521486 AATTAGTGATAAACAGAGCTTGG - Intronic
1022569565 7:31438517-31438539 ATTTAGTTGAAGACAGAGCCGGG + Intergenic
1022570756 7:31451319-31451341 AATTATCAAAAGACAGAGTTTGG - Intergenic
1022846168 7:34212197-34212219 AACTAGTTAAATACAGAGCTGGG + Intergenic
1023336443 7:39175616-39175638 ATTGATATAAAGACAGAGCTGGG - Intronic
1023742972 7:43297236-43297258 AATTAGATACAGTCAGAGCAAGG + Intronic
1023809827 7:43903288-43903310 ATTTATGTAAAAACAGAGCAAGG + Intronic
1024460838 7:49657744-49657766 AATTATTGAAAGACAGAGCTGGG + Intergenic
1024967393 7:55036134-55036156 AGATAGATAAAGACAGAGATGGG + Intronic
1026369046 7:69680376-69680398 AAGTAGATAAAGACAGGCCTAGG - Intronic
1026387632 7:69866285-69866307 AGTTAGTAAAAGACAGGGCTGGG - Intronic
1027885969 7:83905168-83905190 AACTAGGCAAAGATAGACCTTGG + Intergenic
1028210767 7:88071481-88071503 AATTAGTAAATGGCAGAGCTTGG + Intronic
1030012720 7:105187048-105187070 AATTTAGAAAAGACAAAGCTGGG - Intronic
1030293473 7:107895220-107895242 AACTAGGAAATGACAGAGCTGGG + Intronic
1030346099 7:108434189-108434211 AATTACCTAATGACAGAGCCGGG - Intronic
1030758223 7:113316462-113316484 AATGAGGTGAAGACAGAGGTGGG + Intergenic
1030872690 7:114776188-114776210 ATTTAGTTTAAGACAGAGCTGGG - Intergenic
1031208935 7:118797051-118797073 AATGAGGTACAGAAACAGCTGGG - Intergenic
1031492112 7:122401966-122401988 GATTAGGGAAAGTCATAGCTTGG - Intronic
1031745318 7:125488795-125488817 AAATAAGTAAAGACAGAGAATGG + Intergenic
1032378349 7:131447849-131447871 AACTACGTAATGACAGAGCTGGG + Intronic
1032667905 7:134055356-134055378 AATGATGTTAAGACAGGGCTGGG - Intronic
1034067995 7:148155189-148155211 ATTTAGGAAGAGACAGAGATGGG + Intronic
1034454320 7:151157984-151158006 AATGAGGTGAAGACAGAGAGAGG + Intronic
1036529740 8:9573352-9573374 AGTAAGGTATAGAAAGAGCTTGG + Intronic
1036938335 8:13026717-13026739 ATTTAGTTAGAGGCAGAGCTGGG + Exonic
1037434431 8:18847698-18847720 ACTTAGATATAAACAGAGCTGGG + Intronic
1039037032 8:33371189-33371211 ATTTAGTTAATGAAAGAGCTGGG + Exonic
1039384826 8:37126010-37126032 AGTGGGTTAAAGACAGAGCTGGG - Intergenic
1041925603 8:63232687-63232709 TATTATGTAAAGACACAGATAGG + Intergenic
1042036300 8:64538162-64538184 TATTAGGTAAAGAAAGAGAGGGG - Intergenic
1042474138 8:69226286-69226308 AATTTTGAAAAGACAGAGTTTGG + Intergenic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1042944850 8:74144668-74144690 TATCAGGTAGAGACGGAGCTGGG + Intergenic
1042951705 8:74206826-74206848 GATCAGGTAAGGCCAGAGCTGGG - Intergenic
1043581417 8:81720476-81720498 AATCAGGGAATGACAGAGCTGGG + Intronic
1044522106 8:93210656-93210678 AATTAGGTGAAGACAGAAAAGGG + Intergenic
1045568773 8:103348749-103348771 ACTTACCTAAAAACAGAGCTGGG + Intergenic
1046343187 8:112885742-112885764 AATTATGTCAAGAAAGAGATTGG + Intronic
1047053362 8:121138040-121138062 AACTGGGTAAAGGCAGAGGTTGG + Intergenic
1047566982 8:126056018-126056040 AGTCAGTTAAAGACAGACCTGGG + Intergenic
1048070375 8:131014665-131014687 AACTAGTAAAAGGCAGAGCTGGG - Intronic
1049034896 8:140067538-140067560 ACTTACGTGAGGACAGAGCTTGG + Intronic
1050437209 9:5623776-5623798 AGTTAGGAAAAGTCAGTGCTTGG - Intergenic
1052146307 9:25053688-25053710 AATTAGGTGAGGAGAGAGATGGG + Intergenic
1052752441 9:32505838-32505860 AAGCAGGTAAAGACATAGATGGG - Intronic
1053570710 9:39302644-39302666 AATTATGTAAACAGAGAGATGGG + Intergenic
1053836656 9:42143564-42143586 AATTATGTAAACAGAGAGATGGG + Intergenic
1054092332 9:60861662-60861684 AATTATGTAAACAGAGAGATGGG + Intergenic
1054113745 9:61137255-61137277 AATTATGTAAACAGAGAGATGGG + Intergenic
1054126435 9:61316368-61316390 AATTATGTAAACAGAGAGATGGG - Intergenic
1054593950 9:67044933-67044955 AATTATGTAAACAGAGAGATGGG - Intergenic
1055800923 9:80034637-80034659 AATTAGTTAATGAAAGAGTTGGG + Intergenic
1059225020 9:112664108-112664130 AATTAGGAAGTGGCAGAGCTAGG + Exonic
1059640721 9:116213961-116213983 AATTGGGTGAAGACATTGCTGGG + Intronic
1059720045 9:116950998-116951020 AATGTGGTCAAGACAGAGATGGG + Intronic
1059729548 9:117043421-117043443 AATTAGTGAAAGAAAGATCTTGG - Intronic
1060146995 9:121261461-121261483 AACTAGGGAATGGCAGAGCTGGG - Intronic
1060361319 9:122960166-122960188 AACTAGGGAAAGACACAGCTGGG + Intronic
1060759789 9:126237579-126237601 AAAAAGGGAAAGCCAGAGCTGGG + Intergenic
1186994087 X:15101361-15101383 AATTGTGGTAAGACAGAGCTAGG - Intergenic
1187649024 X:21379758-21379780 ACTTAGGCAAAGACAGAGAGAGG + Intronic
1188597972 X:31924291-31924313 AATTAAATAAAGCTAGAGCTTGG - Intronic
1188719406 X:33504800-33504822 AACTAGGTAAAGGCAGATATTGG + Intergenic
1190260935 X:48796415-48796437 ATTTCTGTAAAGACAGAGCTGGG - Intergenic
1190438511 X:50452175-50452197 AGCTAGGAAATGACAGAGCTGGG + Intronic
1191222098 X:58000125-58000147 AATGAGGTAAAGAAAGAGCTAGG + Intergenic
1191770414 X:64750470-64750492 AATTAGGTAGGGACAAAGCTTGG - Intergenic
1191880230 X:65838163-65838185 AGTGAGGTATAGACTGAGCTGGG - Intergenic
1193514166 X:82443053-82443075 AACTAGTTATTGACAGAGCTAGG - Intergenic
1194256138 X:91636813-91636835 AAATAGGAAAAGATAGAGCATGG + Intergenic
1194429876 X:93788875-93788897 ATTTGGGTACTGACAGAGCTGGG - Intergenic
1194550555 X:95292726-95292748 AAATAGGTAGAGAAAGAGATAGG + Intergenic
1194689416 X:96964520-96964542 AATTAGTAAATGGCAGAGCTGGG - Intronic
1195527089 X:105903340-105903362 ACTCAGGTAAAGACAGACATGGG - Intronic
1195647275 X:107246664-107246686 ACTTAGGTAAAGAGAGTGTTGGG + Intergenic
1196154196 X:112408561-112408583 AAGTAGGTAGAGAAAGAGATGGG + Intergenic
1196241789 X:113350982-113351004 AATTAGGTCAAGACACAGACAGG + Intergenic
1197007134 X:121515098-121515120 AATAAAGTAAAGACAAATCTTGG - Intergenic
1199225966 X:145374688-145374710 AATTATGTTAAGACAGAGCTTGG + Intergenic
1199997480 X:153034845-153034867 CATTAAATAAAGACAGAGCAGGG + Intergenic