ID: 1011726314

View in Genome Browser
Species Human (GRCh38)
Location 6:90213750-90213772
Sequence CTGTATGTATGTAAGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011726314_1011726319 17 Left 1011726314 6:90213750-90213772 CCCGCTGCCTTACATACATACAG 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1011726319 6:90213790-90213812 CCAAATTTAATTATAATGTTTGG 0: 1
1: 0
2: 1
3: 38
4: 364
1011726314_1011726320 18 Left 1011726314 6:90213750-90213772 CCCGCTGCCTTACATACATACAG 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1011726320 6:90213791-90213813 CAAATTTAATTATAATGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011726314 Original CRISPR CTGTATGTATGTAAGGCAGC GGG (reversed) Intronic
908631382 1:66112540-66112562 CTGTACCTTTGTAAAGCAGCTGG - Intronic
910340999 1:86187309-86187331 GTGTGTGTGTGTAAGGGAGCTGG - Intergenic
910713525 1:90205629-90205651 CTGTATTTGTGTCAGGCAACTGG - Intergenic
913169606 1:116220441-116220463 CTGTATGTGTGTCAGGCTACAGG + Intergenic
916267028 1:162900825-162900847 ATGAATGTATGTAAGTCATCTGG + Intergenic
917142676 1:171853074-171853096 TTGTATGGATGTAAAGAAGCTGG + Intronic
917486941 1:175463918-175463940 CTTTATGTATATAAAGCAGAAGG + Intronic
919430766 1:197488160-197488182 CTGCTTGTAGGTAAGGCAGGTGG - Intergenic
921635085 1:217482744-217482766 GTTTATGTATGTCAGGCACCAGG - Intronic
1062971343 10:1651587-1651609 CTGTATGTGGGAAAGACAGCTGG - Intronic
1063762429 10:9095267-9095289 CTGTATGTGTGTGTGGCAGGGGG + Intergenic
1064336117 10:14443678-14443700 TTCTATGTATATAAGGCATCAGG + Intronic
1066359562 10:34717066-34717088 CTGTATGTCTTTAAAGCAGGGGG - Intronic
1069408170 10:68124392-68124414 CTGTATGTAAATAGGGCATCTGG + Intronic
1070310083 10:75266582-75266604 CTGTATGTATGTAAGGTGGATGG + Intergenic
1070472554 10:76797471-76797493 CTGTATGTAAGCAATGCATCAGG - Intergenic
1074211285 10:111337623-111337645 CTGTATGTATGTGGGGCAGTAGG + Intergenic
1077238578 11:1498122-1498144 CTGTATGTCTGTAAAGGAGAGGG - Intronic
1077536075 11:3124902-3124924 CTGTGTGTATTTGAGGCAACAGG + Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078670959 11:13364633-13364655 TTGTATGTCTGGAAGGCAGTGGG + Intronic
1079338184 11:19589642-19589664 CTCTATGTATCTAGAGCAGCAGG + Intronic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1092088088 12:5781726-5781748 CTGCATAAATGCAAGGCAGCAGG + Intronic
1094215218 12:27933399-27933421 CTGTATATTTGAAAGGCAACAGG + Intergenic
1094340250 12:29403007-29403029 CTGTCTGTATTTAAGGCTGGAGG - Intergenic
1094777896 12:33753068-33753090 CTGTAGGGATGTGAGTCAGCAGG + Intergenic
1095499072 12:42816688-42816710 CTGCATTCATGTTAGGCAGCTGG + Intergenic
1097755301 12:63401074-63401096 CTGTCTGCCTGCAAGGCAGCCGG - Intergenic
1097799096 12:63893351-63893373 TTATATGTGTGTCAGGCAGCTGG + Intronic
1098016764 12:66113279-66113301 CTGTATCAATGCAAGGCAGGTGG - Intergenic
1099254738 12:80301725-80301747 CTGTATGTGTGTAGGGGGGCAGG - Intronic
1103802286 12:123546456-123546478 CTGTGTGTGTGTGAGTCAGCAGG + Intergenic
1105056984 12:133110644-133110666 ATCAATGTATGTAAGGCAGGGGG + Exonic
1106869544 13:34003723-34003745 CTGTATGTGATTAAGGCAGATGG + Intergenic
1107808958 13:44180965-44180987 CTGGATGTCTGCAAGGCAACTGG - Intergenic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108110821 13:47070317-47070339 CTGTATGAATGAAATTCAGCTGG + Intergenic
1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG + Intergenic
1110204210 13:72892775-72892797 GTGTGTGTGTGTAAGGCAGGAGG - Intronic
1110319256 13:74141633-74141655 CTGTATTTAAGAAAGGGAGCAGG - Intergenic
1113780243 13:112972662-112972684 ATATATGTATGTAAGGTAGATGG + Intronic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1120255239 14:82110465-82110487 CTGTAGGTATTTAAAGCAGACGG + Intergenic
1120526631 14:85584431-85584453 CTGTATTTCTGTAAAGCAGTAGG + Intronic
1121185010 14:91959249-91959271 CTGTATATATGTAAGTCAAACGG - Intergenic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1126644377 15:50860151-50860173 GTGAATGCATGTAAGGCACCTGG - Intergenic
1126882209 15:53111243-53111265 CTGAGTGTATGTGAGGCAGTGGG - Intergenic
1127961507 15:63894194-63894216 CTGTATGTGTTGAAGGCAGCTGG + Intergenic
1130764743 15:86858486-86858508 GTGTGTGTGTGTAAGGGAGCAGG + Intronic
1131397409 15:92097572-92097594 CTGCATGGATGTAAGGCAGGTGG + Intronic
1140955826 16:79864237-79864259 CTGTGTGTATATAAGGCCTCGGG - Intergenic
1143881247 17:10031662-10031684 CTGTACGAATGTAAGACAGAAGG + Intronic
1147884065 17:43672865-43672887 CTGCATATGTGTATGGCAGCGGG - Intergenic
1149052066 17:52317253-52317275 CTATATGTATGGAAGGTAGCGGG - Intergenic
1153509323 18:5834813-5834835 CTGTCTGTCTGTCAGGCAGGTGG - Intergenic
1153979892 18:10299802-10299824 CAGTTTGTTTGCAAGGCAGCTGG + Intergenic
1156920405 18:42515501-42515523 CTGTTTTTATTTAAGGCTGCTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158304251 18:56087241-56087263 CTGTCTGTTTGTAAAGCAGGTGG + Intergenic
1159830818 18:73276369-73276391 GTGTGTGTATGTGAGGCAACGGG - Intergenic
1162288318 19:9757962-9757984 CTGTATTTATGTAAGGCATGTGG - Exonic
1162607520 19:11721768-11721790 CTGTATGAATGTAAGGAATGTGG - Exonic
1162750566 19:12826775-12826797 CTGTCCATAGGTAAGGCAGCTGG + Exonic
1164158512 19:22611147-22611169 ATGTATGTATGTAACAGAGCAGG + Intergenic
1165848107 19:38831932-38831954 CTGGCTCTATGTAAGGCAACCGG - Exonic
1167030236 19:46954098-46954120 CTGTCTGTATGTAAGCCAGCAGG + Intronic
927242789 2:20933139-20933161 CTGTATGTATGTTGGGGAGAGGG + Intergenic
927344519 2:22022257-22022279 CTTTATCTATGTAAGGCAACAGG + Intergenic
930475101 2:51871600-51871622 GTGTATGTATGTAAAGAAGCTGG + Intergenic
937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG + Intergenic
937505951 2:122536562-122536584 CTGCATGTATTTAGAGCAGCCGG - Intergenic
939024128 2:136991671-136991693 CTGTATATTTATAAGGCAGTAGG + Intronic
940163057 2:150735178-150735200 CTGCGTTTATGTAAGGCAACTGG - Intergenic
940282761 2:152004514-152004536 GTGTATGTATGTAAAGTAGGGGG - Intronic
942738050 2:179139337-179139359 CTGTATGTAAATCAGGCATCAGG - Intronic
945787450 2:214259833-214259855 CTCTATGTAGATAACGCAGCTGG - Intronic
948258469 2:236585252-236585274 CTGTATATATGTAATGGATCTGG + Intergenic
1170032321 20:11956333-11956355 CTGTATGAATGTAAGGGCACTGG + Intergenic
1170655794 20:18287063-18287085 CTGTCTATATGCAAGTCAGCTGG + Intergenic
1170910444 20:20561403-20561425 CTGTATGTATGAAAGGAGGCAGG - Intronic
1172299757 20:33840818-33840840 AAGTATGTATGTAAAGCACCTGG - Intronic
1172932647 20:38597319-38597341 ATGTCTGGATGTAAGGCACCTGG + Intergenic
1173054410 20:39597371-39597393 CTGTGTGTATCTAAAGCATCAGG - Intergenic
1177731817 21:25037026-25037048 TTGTATGTGTTAAAGGCAGCTGG - Intergenic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1184169065 22:42748362-42748384 CTGCATGGCTGTGAGGCAGCTGG + Intergenic
956895440 3:73655225-73655247 CTGAATGTATGTAAAGGAGTTGG + Intergenic
957285497 3:78212301-78212323 ATGTAAGTATGTGAGGCAGGGGG + Intergenic
959460979 3:106625237-106625259 CTATATGCATATATGGCAGCGGG - Intergenic
964585393 3:158293310-158293332 ATGTATGTATGTATGGGAGTAGG + Intronic
965447056 3:168787354-168787376 ATGTATGTATGTGTGACAGCAGG + Intergenic
965634014 3:170762880-170762902 GTTAATATATGTAAGGCAGCTGG - Intronic
967928371 3:194671357-194671379 CTATATGGATGAAAGTCAGCTGG + Intronic
969345739 4:6568701-6568723 CTCTGTGCATGTAAGGCAGGAGG - Intergenic
971555627 4:28011093-28011115 TTGTCTGTCTGCAAGGCAGCTGG + Intergenic
972930323 4:44064105-44064127 ATGCATGTCTGAAAGGCAGCAGG - Intergenic
974495816 4:62625231-62625253 GTGTATGTGTGTGTGGCAGCTGG + Intergenic
976209251 4:82651036-82651058 CTGGCTTTATGAAAGGCAGCTGG + Intronic
978704629 4:111691975-111691997 CTGTATTTATATAATGCATCTGG - Intergenic
979004527 4:115275289-115275311 ATGTATGTATGGAAACCAGCAGG - Intergenic
980088532 4:128416965-128416987 CTGTATGTATGTCAGGCACAAGG + Intergenic
983062182 4:163172823-163172845 CTCTCTGTATGCAATGCAGCAGG + Intergenic
986986981 5:13511519-13511541 GTGAATGTAGGGAAGGCAGCAGG + Intergenic
988584913 5:32499940-32499962 CTGTAGGTATGAGAGGCAGTTGG - Intergenic
989396622 5:40963825-40963847 CTATATGTATGGAATGCTGCTGG - Intronic
990086528 5:51985608-51985630 CTGTTTGAAGGTAAGACAGCAGG - Intergenic
991365827 5:65867011-65867033 CTGTTTGTATGTTAGGTACCTGG - Intronic
992070437 5:73143913-73143935 CCGTCTGCATGTAAGGCAGCTGG - Intergenic
995694034 5:114859640-114859662 CTTTATGGCTGTAAAGCAGCAGG - Intergenic
998253079 5:140565594-140565616 CAGTATGTAGGAAAGGCAGGAGG - Exonic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1003742690 6:8961153-8961175 ATGTATGTATGTAATGCATAAGG + Intergenic
1006362972 6:33597652-33597674 CTTTATATATGCTAGGCAGCTGG - Intergenic
1007981825 6:46167194-46167216 CTCTATGTATGTATGGCAGTAGG - Intronic
1008255937 6:49299652-49299674 GTGAATGTATGTAAGCCAGATGG + Intergenic
1011726314 6:90213750-90213772 CTGTATGTATGTAAGGCAGCGGG - Intronic
1012880879 6:104787371-104787393 CTGTCAGTATTTATGGCAGCTGG - Intronic
1016792320 6:148078922-148078944 CTGTCTGTAGGTCTGGCAGCTGG + Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1019671227 7:2280149-2280171 CTTCTTGTCTGTAAGGCAGCTGG - Intronic
1020784197 7:12554529-12554551 TTGTAAGTTTGTAAGGCTGCAGG + Intergenic
1020789184 7:12604728-12604750 GTGTGTGTGTGTAAGGCAGCAGG + Intronic
1021766581 7:23955938-23955960 CTGACTGTATGGAAGGCTGCTGG + Intergenic
1024220647 7:47283989-47284011 CTGGGTGCATGTAAGGCAGATGG + Intronic
1024468018 7:49734411-49734433 CTCTATGCATGTAAGACAGATGG - Intergenic
1026421614 7:70242967-70242989 CTGAATGTGTGGAAGGCAGTAGG - Intronic
1027518717 7:79176235-79176257 CTGACTGTAAGCAAGGCAGCTGG - Intronic
1028073525 7:86481790-86481812 ATTTATCTATGTAAGGCATCTGG + Intergenic
1028549442 7:92042306-92042328 CTGCATGTGTGTAAGGTAGGTGG + Intronic
1032792747 7:135254382-135254404 CTGTGTGTCTGTAGGACAGCTGG - Intronic
1034639778 7:152593386-152593408 ATGTAAATATGTAAGGCAGCCGG - Intergenic
1037231470 8:16663962-16663984 CTGGAAGTCTGTAAGGCAGATGG + Intergenic
1038261969 8:26003451-26003473 TTTTATGTAGGTAAGGCAGCAGG + Intronic
1041179075 8:55229163-55229185 CTGTTTGTAAGGCAGGCAGCAGG + Intronic
1041354008 8:56980795-56980817 ATGTATGTATGTAAGGGTGTGGG - Intronic
1042392988 8:68257169-68257191 CTGGATGTGATTAAGGCAGCAGG + Intergenic
1043330209 8:79107243-79107265 CTATATTCTTGTAAGGCAGCTGG + Intergenic
1043385403 8:79743087-79743109 CTGCAAGTATGTAATGCATCAGG - Intergenic
1044779820 8:95732642-95732664 CCATATGTATATAAGGCAGTTGG - Intergenic
1046336535 8:112796313-112796335 CTTTCTGTATGTTAGGCATCAGG + Intronic
1047137481 8:122096665-122096687 TTGTAAGTCTGTAAGTCAGCTGG - Intergenic
1047480776 8:125280929-125280951 CTGTAGGTTTGTAGGGCAGCAGG - Intronic
1047933259 8:129751130-129751152 GTTTATGTATGTAAGGCACTTGG + Intronic
1049839141 8:144759453-144759475 CTGAATGTACCTCAGGCAGCTGG - Intergenic
1051422072 9:16898560-16898582 GTCAATGTATGTAAGGCAACAGG - Intergenic
1052140958 9:24982666-24982688 GTGAAAGTATGAAAGGCAGCTGG - Intergenic
1052340849 9:27362857-27362879 CTGGACGTCTGTAAGGCAGAAGG - Intronic
1055019985 9:71659325-71659347 CTTTATGTCTGAAAGGGAGCAGG - Intergenic
1055497033 9:76866153-76866175 CTGTATCTATGTTAGGCCCCAGG - Intronic
1057311817 9:93947878-93947900 CTGTAGGGAGGTAAGGGAGCTGG - Intergenic
1058601417 9:106674757-106674779 CAGTAAGAATGTCAGGCAGCAGG + Intergenic
1060087678 9:120716130-120716152 GTCTATGTATATAAGACAGCGGG + Intergenic
1060820962 9:126661490-126661512 CTGTCTGTTTGTGGGGCAGCAGG + Intronic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1190980266 X:55451431-55451453 ATGTATGTATGTATGAAAGCAGG - Intergenic
1192617677 X:72645007-72645029 CTGTGTGTTTTTTAGGCAGCAGG + Intronic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic