ID: 1011729779

View in Genome Browser
Species Human (GRCh38)
Location 6:90249321-90249343
Sequence AGTTATGGGAGGAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011729779_1011729786 18 Left 1011729779 6:90249321-90249343 CCTGTCATCTTCCTCCCATAACT 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1011729786 6:90249362-90249384 AGTCCCCTTTCCTTGGTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 129
1011729779_1011729785 11 Left 1011729779 6:90249321-90249343 CCTGTCATCTTCCTCCCATAACT 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1011729785 6:90249355-90249377 GAGACAGAGTCCCCTTTCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011729779 Original CRISPR AGTTATGGGAGGAAGATGAC AGG (reversed) Intronic
900229750 1:1550688-1550710 TGTTGTGGGAGGAAGATGGAGGG + Intronic
900870712 1:5300676-5300698 AGGTATGTGAGGAAAATGACGGG - Intergenic
903008960 1:20317247-20317269 AGCTCTGGGAGGAAGATTTCAGG - Intronic
903604900 1:24568376-24568398 AGGTGAGGGAGGAAGAAGACAGG - Intronic
903768386 1:25749158-25749180 AGGTATGGGAGGAATATCAGTGG + Intronic
905120218 1:35676070-35676092 AAGTATGGGAGGAAGAAGAGAGG - Intergenic
906319413 1:44807138-44807160 AGATCTGGGTGGAAGATGACTGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
910173828 1:84406605-84406627 GGTTCTGGGGGGAAAATGACAGG + Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
913015339 1:114728040-114728062 AGTTATGGAAGGAATGTGATTGG - Intronic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
913317096 1:117562683-117562705 AGGTGAGGGAGGAAGAGGACAGG + Intergenic
913411081 1:118552316-118552338 GGTTATGGTATGAAGATGACTGG - Intergenic
913995438 1:143648645-143648667 AATTATGGGATGGAGGTGACCGG + Intergenic
914259397 1:145986199-145986221 AGTGATGGGAGAAAGAAGACAGG - Intergenic
915245867 1:154556027-154556049 AGTCTTGGGGGGAAGAGGACAGG - Intronic
915943725 1:160135304-160135326 AGCCACGGGAGGCAGATGACAGG + Intronic
916551850 1:165857504-165857526 AGTTGGAGGAGGCAGATGACAGG + Intronic
917931148 1:179823635-179823657 AGGGATGGGAGGAAGATGAGAGG + Intergenic
918091427 1:181298328-181298350 AGCTATGGCAGGATGATGAATGG + Intergenic
920224173 1:204426038-204426060 AGATATGGCAGGAAGATACCTGG - Intronic
920261813 1:204693440-204693462 AGTTGTGGAAGGAAAATGAAGGG - Intergenic
921501023 1:215903184-215903206 AGTTTAAGGAGGAAGAAGACTGG + Intronic
921763025 1:218939286-218939308 AGTTAGGTGAAGAAGGTGACTGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
1062928529 10:1336542-1336564 AGCCATGGGAGGAAAATGAAGGG + Intronic
1065018007 10:21479200-21479222 AGTTTTGGGAGGGAGTTGAAGGG - Intergenic
1065824102 10:29554017-29554039 AGTCTAGGGAGGAAAATGACTGG + Intronic
1067671795 10:48330790-48330812 AGTTACGGGGGGAAGGGGACTGG - Intronic
1068098181 10:52518512-52518534 TTTGATGGAAGGAAGATGACAGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1070505532 10:77109739-77109761 AGTTAGGGGAGGAACATAAAGGG + Intronic
1070798702 10:79232315-79232337 ACTTATGGGAGGAAGATGGCTGG + Intronic
1071820318 10:89273258-89273280 CATTATAGGAGGAAGATGAGAGG + Intronic
1072610528 10:97014534-97014556 GGGAATGGGAGGAAGGTGACTGG + Intronic
1073401175 10:103258818-103258840 TGTTATGGGAGGAACATGGTGGG + Intergenic
1074970378 10:118531595-118531617 AGATAGGGGAAGAAGATGCCAGG + Intergenic
1077007999 11:368258-368280 AGTTAGGGGAGGAGGATGGAGGG + Intergenic
1077350295 11:2090118-2090140 AGCTAGGGGAGGAAGGTGAGGGG + Intergenic
1077490908 11:2860575-2860597 AGTTATGGGTGTGAGATGTCTGG - Intergenic
1077771679 11:5225725-5225747 AGCTGTGGGAGGAAGATAAGAGG + Exonic
1079890427 11:26045757-26045779 AGTTAAGTGAGGAAGGTGACAGG - Intergenic
1079975005 11:27079987-27080009 AGCTATAGGAGGAAGAAGAAGGG - Intronic
1080580024 11:33634581-33634603 AGTTATGGGGGGAGAAAGACGGG + Intronic
1080701327 11:34646821-34646843 AGAAATGGAAGGAAGATGAAAGG + Intronic
1081512740 11:43792170-43792192 AGTTGTGGGGGAAAGAAGACAGG + Intronic
1081906760 11:46675140-46675162 AGTTAGGGGAGGGAGCTGATTGG + Intergenic
1084067950 11:66716105-66716127 AGGAAGGGAAGGAAGATGACCGG + Intronic
1085380785 11:76116127-76116149 AGATATGGGAGGAAAATGAAAGG + Intronic
1085854827 11:80164160-80164182 AGGTTAGGGAAGAAGATGACTGG - Intergenic
1086018237 11:82193555-82193577 AGTTATGGCAGGAAAACAACAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088491278 11:110390245-110390267 GGTTTTGGGAGGAAGACCACAGG + Intergenic
1090026899 11:123175412-123175434 TGTTGAGGGAGGAAGGTGACTGG - Intronic
1090772173 11:129930959-129930981 GGTGGTGGGAGGAAGATGAGCGG + Intronic
1090993222 11:131839565-131839587 AGTTAAGGAAGCAAGATAACAGG + Intronic
1091012096 11:132010953-132010975 TTTTATGGGAGTAAGATGAAGGG - Intronic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1096046875 12:48570170-48570192 AATTATGGAAGGAAGCTGGCAGG - Intergenic
1096806097 12:54141911-54141933 GGTCATGGGAGGAATAGGACAGG + Intergenic
1098233239 12:68394102-68394124 AGATGTGGTAGGAATATGACAGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099529241 12:83755736-83755758 AGTTATTGGTGGAAGATTAGAGG - Intergenic
1099608473 12:84835215-84835237 AATTAAGGGAAGAAGATGAAGGG - Intergenic
1100656410 12:96650519-96650541 AGTGATGGGAAGAAGGAGACCGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1102164816 12:110797739-110797761 AGTTCTAGGAGGAAGATGTTAGG - Intergenic
1102380857 12:112465593-112465615 AGTTAGAGGAGGAAGATGAATGG - Intronic
1102874985 12:116442333-116442355 AGATAAAGGAGGAAGATGAAGGG + Intergenic
1103921863 12:124403368-124403390 AGGTCGGGGAGGCAGATGACAGG - Intronic
1105585210 13:21737227-21737249 AGTCATGGGATAAAAATGACTGG + Intergenic
1106185887 13:27409189-27409211 AGGTATGGGAGGAAGAGGGGTGG + Intergenic
1106750678 13:32763156-32763178 AATTATGAGAGGAAGTTGAGAGG + Intronic
1107295968 13:38907759-38907781 AGTTCAGGGTGGCAGATGACTGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108193700 13:47970430-47970452 AGTTACGTGAAGATGATGACTGG - Intronic
1109167184 13:59050866-59050888 AGTAAATGGAGGAAGATGCCAGG + Intergenic
1109376431 13:61500334-61500356 GGTAGTGGGAGGAAGATGACAGG + Intergenic
1109862552 13:68219262-68219284 AGTGATGGAAGGAAAATGTCTGG - Intergenic
1109942542 13:69389944-69389966 AGAAATGGAAGGAAGAAGACTGG + Intergenic
1110565345 13:76952164-76952186 AGTTGTGGGAGGAGGATGCAAGG - Intronic
1110655565 13:77994701-77994723 AATTATGAAAGGAAGATGAATGG - Intergenic
1111240282 13:85464829-85464851 CGTTATTGGAGGAAGATGCATGG + Intergenic
1111354482 13:87080314-87080336 GGGCATGGGAGGTAGATGACGGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115416479 14:33140796-33140818 TGTTATGGGAGGGAGAAGAAAGG + Intronic
1116911878 14:50475964-50475986 AGTTTTGGGAGTAAAATTACTGG + Intronic
1117256626 14:53984845-53984867 TGTCATGGGAGGAAGCTGGCAGG + Intergenic
1118223175 14:63874454-63874476 AGATGTCGCAGGAAGATGACAGG + Intronic
1119326612 14:73763448-73763470 ACTTATTGGAGGAAGGTGGCTGG - Intronic
1120612416 14:86658362-86658384 AGTTCTGGGAGGCAGGTCACAGG + Intergenic
1120826411 14:88960115-88960137 AGATAAGGGAGGGAGATGAATGG + Intergenic
1121396527 14:93628674-93628696 AGTGATGGGAAGAAAATGTCAGG - Intronic
1121871026 14:97407471-97407493 AGTACTGGGAGGAAGATAAAGGG + Intergenic
1122760762 14:104023706-104023728 AGTTCTGGGAGGAACTTAACAGG + Intronic
1123159120 14:106260388-106260410 AGGAATGGGAGGAAGATGCATGG + Intergenic
1123160239 14:106271226-106271248 AGGAATGGGAGGAAGATGCATGG + Intergenic
1123178678 14:106446281-106446303 AGGAATGGGAGGAAGATGCATGG + Intergenic
1123207865 14:106730764-106730786 AGGAATGGGAGGAAGATGCATGG + Intergenic
1124417671 15:29486893-29486915 AGTGAGGGGAGGATGATGAGAGG + Intronic
1125249874 15:37688648-37688670 AGTTATGGGACAAAGCTGATTGG - Intergenic
1126212042 15:46111044-46111066 AGTTTGGGGAGGAAGACGAGAGG + Intergenic
1129200620 15:73996474-73996496 AGTTATGGGAGGGTGAGGAGAGG + Intronic
1133930014 16:10224406-10224428 GGTTGTGGGAGGAAGCTGAAAGG - Intergenic
1134390476 16:13815442-13815464 GTTTTTGGGAGGAAGAGGACAGG + Intergenic
1134405544 16:13955591-13955613 AGGTCTGGCAGAAAGATGACAGG - Intergenic
1137768319 16:50994847-50994869 AATTAAGGGAGGAAGAAGGCTGG + Intergenic
1139301031 16:65945511-65945533 AGTTATGTGATGAGGAGGACAGG + Intergenic
1139484448 16:67247996-67248018 AGTTGTGGGAGGAAGAGGGAAGG + Intronic
1143374407 17:6458773-6458795 AGGTGTGGGAGGAGGATGAAGGG - Intronic
1144301674 17:13927157-13927179 TCATCTGGGAGGAAGATGACTGG - Intergenic
1144725975 17:17502981-17503003 AAGTATGGGAGGAAAGTGACAGG - Intergenic
1146671472 17:34740952-34740974 AGTAATGGGTGGAATATGCCAGG - Intergenic
1148018378 17:44538417-44538439 ATTTATGGAAGGAAGAGGGCAGG - Intergenic
1150219000 17:63485266-63485288 AGTTTGTGGAGGAATATGACCGG + Exonic
1152945788 17:83196707-83196729 AGGAATGGGGGGAAGAGGACAGG + Intergenic
1154134733 18:11766296-11766318 ATTTATGCCATGAAGATGACAGG - Intronic
1155867508 18:30984067-30984089 AGGTGGGGGAGGCAGATGACAGG + Intergenic
1155880321 18:31139860-31139882 AGTTAGGGGATGAAGATAACTGG - Exonic
1158910469 18:62056477-62056499 TGAGATGGGAGGAAGGTGACAGG - Intronic
1159619495 18:70620965-70620987 AGTTATGGGAGAAAGAGAAGAGG - Intergenic
1160175935 18:76594037-76594059 AGTTTTGGAGGGAAGATGGCAGG - Intergenic
1160544470 18:79643501-79643523 AGTTATGGGGGCAAGAATACAGG - Intergenic
1164292768 19:23882226-23882248 AGAAATAGGAGGAAGAGGACAGG + Intergenic
1164878229 19:31708301-31708323 GGTTATGGGAGGAACACAACAGG + Intergenic
1165815382 19:38638801-38638823 GGCTAAGGGAGGAGGATGACTGG + Intergenic
1166654223 19:44598524-44598546 AGTTATGTACTGAAGATGACAGG - Intergenic
1168694844 19:58398267-58398289 ACTTCTGGGAGGAAGAGGACAGG - Intergenic
927665604 2:25030266-25030288 AGTTTGGGAAGGAAGTTGACTGG - Intergenic
928258698 2:29747684-29747706 ATTTCTGGGAGGAAAATGATTGG - Intronic
928268778 2:29835667-29835689 AGTTATGGGAGGGACCTGATGGG + Intronic
929172931 2:38949460-38949482 AATCATGGGAGGAAGAGGAAGGG - Intronic
931845054 2:66194742-66194764 AGTTATGGGAATACCATGACTGG + Intergenic
932097491 2:68864532-68864554 AGGGATGGGAGGAAGGTGAGAGG + Intergenic
932162235 2:69471578-69471600 AGCTTTGGGATGAAAATGACAGG - Exonic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934700988 2:96439789-96439811 TGTCAAGGGAGGGAGATGACTGG + Intergenic
937031089 2:118741266-118741288 AGTTTAGGGAGGAAGAGGAAAGG - Intergenic
937500950 2:122478359-122478381 AGTGAAAGGAGGAGGATGACTGG - Intergenic
942891104 2:180989793-180989815 GGTTATGAGAGGAATATGACTGG - Intronic
944988109 2:205202556-205202578 AGTCATGGGAGGGGTATGACAGG - Intronic
945068246 2:205965326-205965348 AGTTCTGGAAGGAAGAGGAACGG + Intergenic
945123202 2:206480293-206480315 AGTACTGGGAGGGAGATGCCTGG + Intronic
945256316 2:207806346-207806368 AGTGGTGGCAGGAAGATGAGGGG + Intergenic
945610207 2:211991938-211991960 AGTTAAGGGAGGGAGGGGACAGG + Intronic
948388754 2:237597641-237597663 AGTTTTGGGAGGAGGAGGAGGGG - Intronic
1169554744 20:6737236-6737258 AGATGTGGGAGGAAGAAGGCAGG + Intergenic
1169982215 20:11397099-11397121 GGTTGTAGGAGGAAGATCACGGG + Intergenic
1171338249 20:24407442-24407464 AGTAAGGGGTGGAAGAGGACTGG - Intergenic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1173278052 20:41601886-41601908 AGGTAGGGCAGGAATATGACAGG - Intronic
1174513253 20:51071960-51071982 AGTTAGGAGAGGAAGATGAGGGG - Intergenic
1175225907 20:57443726-57443748 GGTTATGCAAGGAAGATGAGGGG - Intergenic
1175738091 20:61400994-61401016 TGAAATGGGTGGAAGATGACAGG - Intronic
1175753066 20:61512563-61512585 GGTCATGGGAGGGAGATGAATGG + Intronic
1176910714 21:14561528-14561550 AGACATGGGAGGGAGATGACAGG + Intronic
1178521141 21:33289342-33289364 GGTTACAGGAGGAAGATGAGTGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180161639 21:46000950-46000972 AGTTATGGGTGAAAGAGGGCGGG - Intronic
1180598357 22:16995307-16995329 AGTGTTGGGAGGATGAAGACTGG - Intronic
1180994848 22:19960459-19960481 TATTCTGGCAGGAAGATGACAGG - Intronic
1182932150 22:34184703-34184725 ACTTAGAGGAGGAAGATGAAGGG + Intergenic
1185254605 22:49825408-49825430 AGGTATGGGAGGCAGCTCACTGG - Intronic
1185354263 22:50357313-50357335 AGTGAGGGGAGGAAGAGGAAGGG + Intronic
949463584 3:4320571-4320593 AGTTATGAGAGGAAAAGGAGAGG + Intronic
951609816 3:24479546-24479568 CAGTATGGGAGGAAGATGATGGG + Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957705126 3:83770441-83770463 ATTTCTGGGAGGAAGAGGGCGGG + Intergenic
958901841 3:99896266-99896288 AACTATAGGAGGAAAATGACAGG + Intronic
960513886 3:118581563-118581585 TATTTTGGGAGGAAGAAGACAGG - Intergenic
960571782 3:119191742-119191764 GGATATGGGAGGAAAATGAAGGG - Intronic
961063640 3:123855237-123855259 AGGTATGGAAGGTAAATGACAGG - Intronic
961233882 3:125346557-125346579 TGTCAAGGGAGGAAGATGATTGG + Intronic
961398316 3:126614393-126614415 AATTAAGGTAGGAAGATGTCAGG - Intronic
961434283 3:126905946-126905968 AGTTCTGGAAGGAGAATGACTGG + Intronic
961722238 3:128904591-128904613 AATGACAGGAGGAAGATGACAGG - Intronic
962867175 3:139456902-139456924 TCTTTTGGGAGGAAGATGTCTGG + Intronic
964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG + Intergenic
965841726 3:172913011-172913033 AGTGATGGGAGGAAGATGAATGG + Intronic
967386113 3:188912691-188912713 AGTCATGGTAGGAAGGTGAAGGG + Intergenic
968092339 3:195907278-195907300 AGGCATGGGATGAAGCTGACAGG + Intronic
968231093 3:197004979-197005001 GGTTCTGTGGGGAAGATGACAGG + Intronic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
971158460 4:24108250-24108272 TGAAATGGGAGGAAGATGTCTGG - Intergenic
971376708 4:26061650-26061672 AATTATTGGAGGAAGTTGGCGGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972749222 4:41972096-41972118 TGTTATGGGAGGAACATGGTGGG + Intergenic
973830618 4:54755573-54755595 AGATAGAGAAGGAAGATGACAGG - Intergenic
975200383 4:71581439-71581461 TGTCATGGGAGGAACATGATGGG - Intergenic
976104887 4:81606016-81606038 TGTTATGGGAAGAAGATAAGGGG - Intronic
976713594 4:88100030-88100052 AATTGTGGGAGAAAGATGTCAGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977953383 4:103000102-103000124 TGTCAAGGGAGGAAGGTGACTGG - Intronic
978655787 4:111064010-111064032 AGTTAAGGGAACAAGATTACAGG + Intergenic
980462869 4:133139527-133139549 AGTTATGGAATAAAGAAGACTGG + Intergenic
980474458 4:133294174-133294196 AATCATGGGAGGAAGAAGAAAGG + Intergenic
980846881 4:138334479-138334501 AGGTATGGGTGGAACATGCCAGG - Intergenic
983303079 4:165952452-165952474 AGTTATGGGATGAAGTAGACAGG + Intronic
984365560 4:178794785-178794807 TGTAAGGGGAGGAAAATGACTGG + Intergenic
984507003 4:180632546-180632568 AGTGATTGCAGGAAGGTGACTGG - Intergenic
984537339 4:180993134-180993156 AGTCATGGGAAGAAAATGAAAGG - Intergenic
985585343 5:729452-729474 AGTGATGGGAGGAATATGGCAGG + Intronic
985598855 5:813779-813801 AGTGATGGGAGGAATATGGCAGG + Intronic
986304837 5:6507314-6507336 AGTGATGTGAGGAAGAAGCCAGG + Intergenic
990385027 5:55252076-55252098 GGTTATGGGAGGGAGAGGAAAGG - Intergenic
991538271 5:67697342-67697364 AGATTAGGGAGGAAGATTACTGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
993642778 5:90425835-90425857 GGTTAGAGGAGGGAGATGACTGG + Intergenic
995128616 5:108606371-108606393 AGTTATGGGAGGGTGAGGGCAGG - Intergenic
996333452 5:122357147-122357169 ATGTAGGGGAAGAAGATGACAGG - Intronic
997271957 5:132547355-132547377 GTTTTGGGGAGGAAGATGACAGG - Intronic
997608679 5:135195065-135195087 AGAATTGGGAGGAAGATTACAGG + Intronic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
999067874 5:148710960-148710982 TGTCAAGGGAGGAAGATGATTGG + Intergenic
999457427 5:151729251-151729273 AGTCTTGGTAGGAAGATGCCAGG + Intergenic
999803253 5:155057485-155057507 AGGTATAGAAGGAAGATAACTGG + Intergenic
1000392840 5:160743315-160743337 AATTATTGGAGCAAGTTGACAGG + Intronic
1001694390 5:173659210-173659232 AGTTTTGGGAGGAAGGTGGGTGG + Intergenic
1003330555 6:5125057-5125079 AGTTCTTGTATGAAGATGACTGG - Intronic
1005348605 6:24912914-24912936 AGCTATGGGAAAGAGATGACAGG - Intronic
1006670378 6:35726601-35726623 AGATATGGGAGAAAGATCCCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011547540 6:88498078-88498100 AGATATAGGATGGAGATGACAGG - Intergenic
1011729779 6:90249321-90249343 AGTTATGGGAGGAAGATGACAGG - Intronic
1012512034 6:100013286-100013308 ATTCATGGGTGGAAGATGGCAGG - Intergenic
1013447922 6:110250058-110250080 AGTTCTGGGTGGATGATCACAGG - Intronic
1014009660 6:116461627-116461649 AATTGGGGGAGGAAGATAACTGG + Intronic
1014628713 6:123762578-123762600 AGTTTTAGGAGGAAAATGAGGGG + Intergenic
1014906077 6:127029682-127029704 AGTAATGTGATGAAGATGATTGG + Intergenic
1015538437 6:134290613-134290635 ACTTAGGGGAGGAAAATGGCAGG + Intronic
1016702063 6:147065199-147065221 AGTTCTGGGAAGAAGATAATGGG + Intergenic
1016940418 6:149478800-149478822 AGGTATGGGGTGAAGATGGCAGG - Intronic
1017189704 6:151639512-151639534 AGTTGTGGGAGGAAAAGGATGGG - Intergenic
1017205394 6:151799815-151799837 AGGGATGGGAGGAAGATTTCAGG + Intronic
1020768998 7:12363685-12363707 AGTGATGGAAAGCAGATGACAGG + Intronic
1022379142 7:29843479-29843501 GGTTACGGCAGGAAGGTGACAGG + Intronic
1022520789 7:31005652-31005674 AGCTCTGGGAGGAAGGAGACAGG + Intergenic
1023333650 7:39146115-39146137 TGTTATGGGAGGAAGAGCACTGG + Intronic
1027977150 7:85173386-85173408 AGTGATGTGAGGAAGAAGCCAGG - Intronic
1028741336 7:94279137-94279159 AGATATAGGAGAAAGATGAGTGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1033179699 7:139163777-139163799 AGTCATGGGATCAAGAAGACAGG + Intronic
1033421903 7:141211112-141211134 AGTTAAGGAAGGAGGATGACAGG + Intronic
1035468164 7:159093173-159093195 AGTTACTGGAGGAAGGTGAGAGG + Intronic
1035529017 8:336794-336816 AGTTGGGTGATGAAGATGACAGG + Intergenic
1036500867 8:9312681-9312703 AGGTATGGGAGGAAGAAGAGGGG + Intergenic
1039029747 8:33296606-33296628 GGTTATGGGAGGGAGATAATAGG - Intergenic
1039096689 8:33894453-33894475 AGTTATGGGAGGAATGGAACAGG + Intergenic
1039567296 8:38560482-38560504 AGTTTTGGGGGGAAGAGGAGAGG - Intergenic
1039613621 8:38937950-38937972 AGTGATGGGAAGATGAGGACGGG + Intronic
1041813839 8:61943881-61943903 ACTTATTGGAGGAAGATGGTTGG + Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042430153 8:68697371-68697393 AGTAATGGGAGGAAGCTGCGAGG - Intronic
1043598514 8:81912896-81912918 AGTTATGGGAGGGAGAGGGGAGG - Intergenic
1043760068 8:84057425-84057447 AGTCATGGGAGGAACCTGATGGG + Intergenic
1044620351 8:94185223-94185245 AGTAGTGAGAGGAAGATGAAGGG - Intronic
1045735089 8:105285791-105285813 AGTTGTGGCAGGAAAATGTCAGG - Intronic
1046837157 8:118814673-118814695 AGTTTGGGGAGGAAGATCAGGGG - Intergenic
1047063678 8:121256158-121256180 TGTTAATGGATGAAGATGACAGG - Intergenic
1047189109 8:122661858-122661880 AGTTAGTGGAGGAAGGTGACTGG - Intergenic
1047800942 8:128309126-128309148 TGTTCTTGGAGGAAGATCACAGG + Intergenic
1049234507 8:141505740-141505762 AGTTATGGGATGGAGAAGCCTGG - Intergenic
1050148516 9:2596003-2596025 CTTTTTGGGAGGAAGATGATTGG - Intergenic
1051516790 9:17938684-17938706 TCTTGTCGGAGGAAGATGACTGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1056320430 9:85430101-85430123 AGAAATGGGAGGAAGAGGACTGG + Intergenic
1056519386 9:87385989-87386011 AGTGATGGGAAGAAGACCACTGG - Intergenic
1056726472 9:89123472-89123494 ACTTATTGGAGGAAGAGGGCTGG - Intronic
1056919195 9:90771165-90771187 GGTTATGGGAGGAAGAGAAGAGG + Intergenic
1058051022 9:100406650-100406672 GGGTCTGGGGGGAAGATGACAGG + Intergenic
1059025213 9:110620181-110620203 AGAGATGGGAGGGAGATGAATGG - Intergenic
1061381737 9:130262896-130262918 AGCTATGGCAGACAGATGACAGG + Intergenic
1062299472 9:135856982-135857004 AGTCCTGGAAGGAAGATGACTGG - Intronic
1185929992 X:4191962-4191984 TCTTATGGGATGAAGAAGACAGG + Intergenic
1185979563 X:4761764-4761786 AGAAATGGGAGGAAGATGAATGG + Intergenic
1186224947 X:7388480-7388502 AGTTGTGGGAGGAAGATAGAGGG + Intergenic
1186272052 X:7899723-7899745 GTTTAGGGGAGGAAGATGAGAGG + Exonic
1186614317 X:11170762-11170784 AGTTAAGTGAGGAACATGAAGGG + Intronic
1188927795 X:36067174-36067196 AGTCATGGAAGGAAGAAGAGAGG - Intronic
1189299447 X:39942025-39942047 AGTTAGGGAAGGAAGGTGAAGGG + Intergenic
1189841434 X:45082713-45082735 AGTTCTGGGAGGAGGAGGAAAGG + Exonic
1190402784 X:50055541-50055563 TGTTCTGGGAGGCAGATTACTGG - Intronic
1190572893 X:51802774-51802796 AGTTAAGGGACTAAGATGAAGGG + Intergenic
1190770585 X:53510831-53510853 GGTTATGGGAGGGAGAGGAGAGG - Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191900030 X:66031372-66031394 AGTTTTGGGAGGAACAAGAGTGG - Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194313680 X:92346458-92346480 TATTATGGGAAGAGGATGACTGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197781732 X:130166512-130166534 AGTTATGGGAGTAGGGTGAGGGG + Intergenic
1198582661 X:138083136-138083158 AGTTATGGAATGATAATGACAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200621951 Y:5460576-5460598 TATTATGGGAAGAGGATGACTGG - Intronic
1201696005 Y:16827056-16827078 AGAAATGGGAGGAAGAGGAAGGG - Intergenic