ID: 1011732773

View in Genome Browser
Species Human (GRCh38)
Location 6:90282897-90282919
Sequence AGTTATTTGCAGGTTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011732771_1011732773 3 Left 1011732771 6:90282871-90282893 CCTAGGGGTAAGATGGCTGTGTT 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1011732773 6:90282897-90282919 AGTTATTTGCAGGTTGAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011732773 Original CRISPR AGTTATTTGCAGGTTGAACT TGG Intronic
903042289 1:20540416-20540438 GGTCATCTGAAGGTTGAACTGGG + Intergenic
905872199 1:41411355-41411377 AGTCATCTGCAGGTTCACCTGGG + Intergenic
910276074 1:85450346-85450368 ACTTATTAGCAAGGTGAACTTGG - Intronic
910437943 1:87224833-87224855 AGTTATTTTCATTTTGCACTGGG + Intergenic
911737039 1:101348914-101348936 AAAGATTTGCAGGTTAAACTAGG - Intergenic
913208236 1:116561769-116561791 ACTTATTTGCTGTGTGAACTTGG + Intronic
915729633 1:158043875-158043897 AGTAATTTGCAGGGTGAAGCTGG - Intronic
916223095 1:162464037-162464059 AGATATTTGAAGTGTGAACTAGG - Intergenic
917861764 1:179152498-179152520 AGTTTTTTGCATGATGAATTTGG + Intronic
921529860 1:216268612-216268634 AATTATTTGCAGCTTGCACAAGG + Intronic
921687092 1:218102690-218102712 AGTTATCTGGAGGCTGAAGTGGG - Intergenic
921766038 1:218973534-218973556 AGTTATTTGCAAGATAAAATGGG - Intergenic
924617819 1:245628450-245628472 ATTGATTTGCATGTTGAACCAGG - Intronic
1063025685 10:2176960-2176982 AGCTATTTGCAGGTTCCACGAGG - Intergenic
1063335334 10:5207147-5207169 ATTTATTTGCAGCTGGAAATGGG + Intronic
1064784977 10:18884617-18884639 AGTTGTCTGCAGAATGAACTGGG - Intergenic
1065014752 10:21451860-21451882 AGTCATTTGCTTCTTGAACTAGG - Intergenic
1065471577 10:26087219-26087241 AGTAATTTGGGGGATGAACTTGG - Intronic
1065829328 10:29600150-29600172 AGCTATTGGGAGGTTGAAGTGGG - Intronic
1068758844 10:60684487-60684509 ATTTATTTGCAGCTGGAAATGGG + Intronic
1069743288 10:70699088-70699110 AGGGATTTGCAGGTGGTACTAGG + Intronic
1070321108 10:75355319-75355341 ATTTATTTGCAGATTGGAATGGG + Intergenic
1071427615 10:85575100-85575122 AGTTATTAGCTGTGTGAACTTGG - Intergenic
1072790548 10:98314572-98314594 ACTTATTTGCAGGATGAAAATGG + Intergenic
1075286573 10:121192239-121192261 AGGGATTTGCAGCTTCAACTAGG - Intergenic
1075595974 10:123729352-123729374 GGTGATTTGCAGGGAGAACTTGG + Intronic
1077387104 11:2275223-2275245 AACTTGTTGCAGGTTGAACTCGG + Intergenic
1080113226 11:28593259-28593281 AGTTATTTGAAAGCTGAACATGG + Intergenic
1080629967 11:34065315-34065337 ATTTATTTCCAGGTTCTACTGGG + Intronic
1081559574 11:44200788-44200810 AGTGATTGGCAGGATGGACTTGG + Intronic
1081578994 11:44339178-44339200 AAGTATTTGCAGGCTGAGCTCGG + Intergenic
1085583122 11:77673268-77673290 AGTGCTTTGCAAGTTTAACTAGG - Intronic
1087267033 11:96071793-96071815 AGGTATATGCAGGATGGACTGGG - Intronic
1088245721 11:107816391-107816413 AGTTATTTGGAGGCTGAAGTGGG - Intronic
1089010729 11:115129626-115129648 AGTCACCTCCAGGTTGAACTCGG + Intergenic
1090017916 11:123102213-123102235 TGTTATTTGCAGGAATAACTAGG - Intronic
1093757657 12:22870558-22870580 AGTTATTTGGAGATTTGACTGGG - Intergenic
1094161444 12:27395055-27395077 AGTTATTTGCAGTCTGAGGTTGG - Intronic
1094707730 12:32930779-32930801 ACTTATTTGCAGTGTGATCTTGG + Intergenic
1097785756 12:63757129-63757151 AATTATTTATATGTTGAACTTGG - Intergenic
1098921421 12:76305651-76305673 AGTTATTTACAGGAGTAACTGGG - Intergenic
1102628945 12:114259666-114259688 AGTTATTTGCTGTGTGATCTTGG - Intergenic
1105946384 13:25193468-25193490 ATTAATTTTGAGGTTGAACTGGG + Intergenic
1107081146 13:36376269-36376291 AGTTTTCTCCAGTTTGAACTTGG - Intergenic
1107233170 13:38136251-38136273 AGTTATGCCCAGGTTGAAGTGGG + Intergenic
1107249275 13:38339071-38339093 AGTGATTTGCAGGTTGTGATGGG + Intergenic
1107288554 13:38824773-38824795 TGTTATTTGCAGGAGTAACTGGG + Intronic
1109447390 13:62459904-62459926 AGATAATGGCAGCTTGAACTAGG - Intergenic
1109486292 13:63025162-63025184 AGGCATTTGCAGGTTCCACTCGG - Intergenic
1110382085 13:74864225-74864247 AGTCATTTGAAGGTTTGACTGGG - Intergenic
1113338116 13:109396126-109396148 AGTTACTTTCAGGGTGAAATTGG + Intergenic
1113601188 13:111569341-111569363 ATTTATCTGCAGGCTGGACTTGG + Intergenic
1115181968 14:30638400-30638422 AATTATATTCAAGTTGAACTAGG + Intronic
1115544204 14:34450223-34450245 AATTAGTAGCAGGATGAACTTGG - Intronic
1117792576 14:59356625-59356647 TCTTATTTGGAGGTTGAAGTAGG + Intronic
1120827329 14:88967712-88967734 AGCTATTGGCAGTTTGAACAGGG - Intergenic
1121265194 14:92597524-92597546 ACTTACTAGCTGGTTGAACTTGG + Intronic
1121724530 14:96137493-96137515 AGTCATTTGAAGGCTCAACTGGG + Intergenic
1121976888 14:98413028-98413050 ATGTATTTGCAAGTTGAAGTTGG - Intergenic
1124340654 15:28887384-28887406 AGAGCTTTGCAGGTTGAAGTGGG + Intronic
1124802240 15:32844723-32844745 AATTATTTGCCACTTGAACTTGG + Intronic
1124966435 15:34436223-34436245 AGAGCTTTGCAGGTTGAAGTGGG - Intronic
1124983042 15:34582317-34582339 AGAGCTTTGCAGGTTGAAGTGGG - Intronic
1129907282 15:79197330-79197352 AGTGGCTTGCAGGGTGAACTGGG + Intergenic
1130039443 15:80393652-80393674 AGTTATTTACAGATTAAAATTGG + Intronic
1134870242 16:17646346-17646368 ACTTATCTGAAGGTTCAACTGGG - Intergenic
1137880193 16:52038020-52038042 ACTTATTAGCTGGGTGAACTTGG + Intronic
1139900524 16:70324657-70324679 ATTTGTTTGCAGGTTCTACTTGG - Exonic
1140579317 16:76210493-76210515 ATTCATTTGCAGGTAGAACCAGG - Intergenic
1143537746 17:7551166-7551188 AGTGATTTGCTGGGGGAACTGGG - Intronic
1144132043 17:12255481-12255503 AACTATTTGGAGGTAGAACTTGG - Intergenic
1144178868 17:12733514-12733536 AGTTATTTTGAGACTGAACTAGG - Intronic
1144591848 17:16531086-16531108 AATCATTTTCATGTTGAACTTGG - Intergenic
1145834335 17:27942742-27942764 AGTCATTTGAAGGTTTGACTGGG - Intergenic
1146143860 17:30392785-30392807 AGTTATTTGCAGTGAGGACTGGG + Intronic
1146555982 17:33824542-33824564 ACTTATTTGCTGGTTAACCTTGG + Intronic
1146940937 17:36843954-36843976 AGTTATTTGGAGGCTGAGGTGGG + Intergenic
1149373496 17:56020264-56020286 GGTTATTTGCAGGTTACTCTTGG - Intergenic
1149680422 17:58503312-58503334 AGTCATTTGCAGGAAAAACTTGG - Intronic
1151601732 17:75110116-75110138 AGTAATTTGCAGCTGGAAATGGG - Exonic
1152014061 17:77737933-77737955 TGTTATTTGCAGATGGAAATTGG + Intergenic
1152026523 17:77812952-77812974 AGTCATTTGAAGGCTTAACTGGG - Intergenic
1153929316 18:9864917-9864939 AGTCATCTGAAGGCTGAACTGGG + Intergenic
1156520578 18:37719515-37719537 AGTTCCCTGCAGGTTGAACATGG + Intergenic
1158061022 18:53341794-53341816 ATTTATTTGCAGCATGAACGTGG - Intronic
1158825358 18:61212537-61212559 AGCTATTTGCATGCTGCACTGGG - Intergenic
1163189442 19:15665860-15665882 ACTTATTAGCTGGGTGAACTTGG - Intergenic
1163217383 19:15890798-15890820 ACTTATTAGCTGGGTGAACTTGG + Intronic
1168666936 19:58211308-58211330 AGTTGTTTGCTTGTTGCACTTGG + Intronic
926732179 2:16043984-16044006 AGTTAATTGGTGGGTGAACTGGG + Intergenic
930151736 2:48066910-48066932 AGTCATTTGAAGGCTCAACTGGG + Intergenic
932514737 2:72334262-72334284 TGTTTCTTGCAGATTGAACTGGG - Intronic
934876930 2:97930846-97930868 AGTTGTTTGATGCTTGAACTAGG - Intronic
935026404 2:99281519-99281541 AGTATTTTGCAGTTTGCACTGGG - Intronic
936232221 2:110712751-110712773 AGTTATCTGAAGGTTTGACTGGG - Intergenic
936744462 2:115558120-115558142 AGTTGTTTTCAGGGTGAAATAGG - Intronic
939645965 2:144699513-144699535 AGTTATATGCTGGTTTACCTAGG - Intergenic
939875001 2:147567928-147567950 AGTGATTTGCAAGTGGCACTTGG - Intergenic
940371278 2:152903752-152903774 AGTCATCTGCAGGCTCAACTGGG - Intergenic
940970250 2:159888714-159888736 AGTTCTTTGCAGGCAGAAATGGG - Intronic
941731690 2:168924894-168924916 AATTATTTGTTTGTTGAACTAGG + Intronic
941739131 2:169014629-169014651 AGTTATTTGTTGGTATAACTGGG - Intronic
942820875 2:180113332-180113354 AGTTATTCCCATTTTGAACTTGG + Intergenic
945126103 2:206511734-206511756 AGTTTTTAGCAGCTTGAAATTGG + Intronic
948376942 2:237527078-237527100 TGTTATTTGCAATTTGAAATTGG + Intronic
948407289 2:237731734-237731756 AGTCAGATGCAGGCTGAACTTGG - Intronic
1169702423 20:8462372-8462394 ATTTATGTATAGGTTGAACTAGG + Intronic
1171042999 20:21782967-21782989 AGTCATCTGAAGATTGAACTGGG - Intergenic
1173366514 20:42390684-42390706 AGTCATCTGAAGGTTGGACTGGG - Intronic
1174581459 20:51574901-51574923 AGTCATCTGAAGGTTGGACTGGG + Intergenic
1174685683 20:52452841-52452863 AGTTCTTTGAAGGTAGATCTAGG + Intergenic
1178322923 21:31619394-31619416 AGTCATTTGAAGGTTGGACTGGG - Intergenic
1179061159 21:37980997-37981019 AGTTATTTGTGTGTGGAACTGGG - Intronic
949111880 3:270749-270771 AGTTATATGAAGGTTCACCTGGG + Intronic
949526377 3:4908778-4908800 TGTTATTTGAAAGTTAAACTGGG - Intergenic
949785046 3:7731712-7731734 TGTTATTTGCAGGTGTAATTGGG - Intronic
956041705 3:65151990-65152012 GATTACTTGCAGGTTGAACAGGG + Intergenic
957000926 3:74883825-74883847 AGTCATTTGAAGGTTTGACTGGG + Intergenic
963152187 3:142056829-142056851 AGTCATCTGCAGGCTGGACTAGG - Intronic
964455853 3:156865262-156865284 AGTTATTAGTAGCTTGGACTTGG + Intronic
965122548 3:164580722-164580744 AGCAATTTTCAGGTAGAACTAGG - Intergenic
966781194 3:183585844-183585866 TGCTATTTGCAGTTTGAATTTGG + Intergenic
972284582 4:37636135-37636157 ACTTATTTGCAGTGTGATCTTGG - Intronic
972666190 4:41167388-41167410 AGTTATCTTCAGGTTGAGCCTGG - Intronic
974322115 4:60364718-60364740 AGTCATGTACAGGATGAACTTGG - Intergenic
976370068 4:84277687-84277709 ATTTATTTGCTGCTTGACCTTGG - Intergenic
977195984 4:94060543-94060565 AGTTATTAAAAGGTAGAACTGGG + Intergenic
977338469 4:95728288-95728310 AGTTATCTTCAGGTTCAACCAGG + Intergenic
977877642 4:102167645-102167667 AGTTAGTAGCAGCTGGAACTAGG - Intergenic
978099936 4:104826163-104826185 AGGCATTTCCAGGTTGGACTTGG - Intergenic
978120900 4:105078278-105078300 CTTTATTTGCACTTTGAACTTGG - Intergenic
978927607 4:114268038-114268060 AGTTATTTCCAGATTAAATTAGG + Intergenic
978965063 4:114730561-114730583 AGTTACTTGCTGTTTGAAATGGG - Intergenic
979327162 4:119393678-119393700 AGTCATTTGCAGGTTGATGGAGG - Intergenic
982398025 4:154934490-154934512 AGCTACCTGCAGGTTGAAGTGGG - Intergenic
983245044 4:165278366-165278388 AGTCATTTGCAGGTTGATGGAGG - Intronic
984835756 4:184019106-184019128 AGTTATTTGGAAGTTGCATTGGG + Exonic
985359907 4:189162497-189162519 TGTTATTTGCAGGAGTAACTGGG + Intergenic
988920801 5:35940378-35940400 ATTTATGTGGAGCTTGAACTTGG - Intergenic
989315929 5:40078573-40078595 AGTCATTTGCAGGATTGACTTGG + Intergenic
989714115 5:44439728-44439750 AGTTCTTTGGAGTTTGAAGTTGG + Intergenic
991037500 5:62142787-62142809 AGTTTTTTGCAGGCTGAAAATGG + Intergenic
991448410 5:66725836-66725858 TGTTATGTGCCGGTTGAAATAGG + Intronic
991517410 5:67453385-67453407 CGTGGTTTGCAAGTTGAACTAGG - Intergenic
991937816 5:71819064-71819086 AGTTACTTACAGGATGACCTTGG + Intergenic
993903611 5:93600852-93600874 ATTTATTTGCTGATTGAACTTGG + Intergenic
994330999 5:98506438-98506460 AGTGGTTTGCAGGATGGACTGGG + Intergenic
994539690 5:101078387-101078409 AGTTATTTGGAGGTTAAATATGG + Intergenic
994838670 5:104892213-104892235 TATTATTTCCAGGTTGGACTTGG - Intergenic
995401196 5:111743799-111743821 AGTTATTTGAAGGTGAAACTCGG - Intronic
998583146 5:143402307-143402329 GGTTATTTGCAACTTAAACTGGG - Intronic
998757281 5:145394689-145394711 AGTTATTTACAGGTTCAAATGGG - Intergenic
998986910 5:147768994-147769016 ATTTATTAGCTGGTTGAATTTGG + Intronic
998988101 5:147784121-147784143 AGTTATTTACAGGTTCAAATGGG + Intergenic
1001539183 5:172525211-172525233 TGGTATTTGCAGGTAGAAATTGG + Intergenic
1002128384 5:177064081-177064103 AGTTACTTGCAGTTAGACCTGGG + Intronic
1002820212 6:717706-717728 TGTGCTTTGCAGGTAGAACTGGG + Intergenic
1003438493 6:6117742-6117764 AGATATTTACAACTTGAACTCGG - Intergenic
1005088130 6:22027911-22027933 AGCTACTTGCTAGTTGAACTGGG - Intergenic
1005250970 6:23945721-23945743 AGTTATCTCAAGGTTCAACTGGG - Intergenic
1007299176 6:40853386-40853408 AGTTATTTTGTGGTTAAACTTGG - Intergenic
1007638953 6:43320783-43320805 AGTTACTTGGAGGCTGAAGTGGG + Intronic
1008874433 6:56310098-56310120 AGTTAGTTGGAGGATAAACTAGG + Intronic
1009339566 6:62537020-62537042 GTTTATTTGGAGGTTGGACTTGG - Intergenic
1011484276 6:87826302-87826324 TGTAATTTGGAGGGTGAACTGGG + Intergenic
1011732773 6:90282897-90282919 AGTTATTTGCAGGTTGAACTTGG + Intronic
1011849523 6:91608813-91608835 AGTTATTTGAGGGCTAAACTGGG - Intergenic
1012846915 6:104401806-104401828 AGTTATTTACAGCTTTAACAAGG - Intergenic
1014958407 6:127651373-127651395 AGTAATGTGCAGTTTCAACTTGG + Intergenic
1014997377 6:128166365-128166387 AGCTATTAGCTGGTTGAGCTGGG - Intronic
1016059150 6:139610451-139610473 GAATATTTGCAGGTTGAAGTGGG + Intergenic
1016380784 6:143476530-143476552 AGACAGTTGCAGTTTGAACTGGG + Intronic
1017744141 6:157431839-157431861 AGCTATTTGCAGGCTGAGGTGGG - Intronic
1018217761 6:161546975-161546997 AGTTATCTGGAGGCTTAACTGGG - Intronic
1018392406 6:163350468-163350490 AGTTACTTAGAGGTTGAAGTGGG + Intergenic
1018461042 6:163998564-163998586 AGGGATTTGCAGGTGAAACTTGG - Intergenic
1026816017 7:73512638-73512660 AGTTACTTGCCGTTTGAATTTGG - Intronic
1027556692 7:79672488-79672510 AGTTATCTGCAGCTTAAATTTGG + Intergenic
1027803801 7:82789735-82789757 AGTAATTTGGAGTTTGAATTAGG - Intronic
1027862398 7:83601395-83601417 ATTTATTTGCTGGGTGAACTTGG + Intronic
1027947432 7:84766701-84766723 AGTTTTCTGCAGTTTGAACATGG + Intergenic
1028201812 7:87971296-87971318 AGGTACTTGCAGGTTTTACTGGG - Intronic
1031713366 7:125076558-125076580 AGTTAGTAGGAGGTTGAAGTGGG + Intergenic
1034189625 7:149204060-149204082 AGTTATCTGAAGGTTTGACTGGG + Intronic
1037396357 8:18447968-18447990 AGTCATTTGCTGGTTGAACAAGG + Intergenic
1037739812 8:21599424-21599446 ATGTATTTGCAGTTTGAATTTGG + Intergenic
1038744235 8:30242704-30242726 AGTTATCTGCAGGCTTCACTGGG - Intergenic
1040585754 8:48739465-48739487 AGTTATTTTCTGGTTGACATTGG - Intergenic
1042435096 8:68755208-68755230 AGTTCTTCTAAGGTTGAACTTGG - Intronic
1046003241 8:108446367-108446389 AGTAATTTACAGATTGAATTTGG + Intronic
1046560571 8:115832132-115832154 AGTCATCTGAAGGTTGGACTGGG + Intergenic
1047983759 8:130211769-130211791 TGGTACTTGCTGGTTGAACTGGG + Intronic
1048779133 8:137982101-137982123 AGATATCTACATGTTGAACTAGG + Intergenic
1048855137 8:138680553-138680575 AGTTATTTGAAGGTTTTCCTTGG - Intronic
1049018086 8:139935709-139935731 ACTTATTTGCCGTATGAACTCGG + Intronic
1049522901 8:143103483-143103505 AGTTATCTGCAGGAGGAATTGGG + Intergenic
1051748148 9:20315441-20315463 TTTGATTTGCAGGTTTAACTAGG + Intergenic
1053501254 9:38595394-38595416 ATTTATTTGTATATTGAACTAGG + Intergenic
1053615165 9:39757939-39757961 AGTCATGTGCAGGTTGATTTGGG + Intergenic
1053873332 9:42517200-42517222 AGTCATGTGCAGGTTGATTTGGG + Intergenic
1053899417 9:42778720-42778742 AGTCATGTGCAGGTTGATTTGGG - Intergenic
1054238355 9:62584451-62584473 AGTCATCTGCAGGTTGATTTGGG - Intergenic
1054262235 9:62878856-62878878 AGTCATGTGCAGGTTGATTTGGG + Intergenic
1054268997 9:62949552-62949574 AGTCATGTGCAGGTTGATTTGGG - Intergenic
1054552484 9:66618971-66618993 AGTCATGTGCAGGTTGATTTGGG - Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055676243 9:78664614-78664636 AACTCTTTGCAGGTTGAATTAGG + Intergenic
1058640579 9:107079764-107079786 AGTCATATGCAGGCTGGACTAGG + Intergenic
1058655349 9:107215734-107215756 AGTTAGTTGCAGCTTTAATTAGG + Intergenic
1058732331 9:107862184-107862206 AGTCATTTCCAAATTGAACTTGG + Intergenic
1058805094 9:108582860-108582882 AGTTATTTCTGGGTTGAGCTGGG + Intergenic
1058986689 9:110214430-110214452 AGTTATTTGATGGCTCAACTGGG - Intergenic
1059740619 9:117146097-117146119 AGTTGTATGCAGGATGAAATTGG - Intronic
1060496444 9:124122782-124122804 AATGATCTGCAGGTTGGACTGGG - Intergenic
1060505990 9:124198882-124198904 AGTTACTTGGAGGCTGACCTGGG - Intergenic
1060899279 9:127243237-127243259 ACTTACTTACAGGTTGACCTGGG - Intronic
1061464001 9:130763550-130763572 AGTCATTTGAAGGCTTAACTGGG + Intronic
1186346038 X:8694112-8694134 AGTGATATGAAGGGTGAACTTGG - Intronic
1189263036 X:39691588-39691610 AGTCATCTGCAGGCTGGACTGGG + Intergenic
1189366557 X:40393505-40393527 GGTTATCTGCAGGTTTGACTGGG - Intergenic
1190328327 X:49220346-49220368 TGTTATTTTCAGGATGATCTTGG + Intronic
1190442979 X:50494381-50494403 GGCTATTTCAAGGTTGAACTGGG + Intergenic
1193432626 X:81428379-81428401 AGTTAATTGCAGTTTTATCTAGG + Intergenic
1196242400 X:113357700-113357722 ATTTATTTGTGGGTTGGACTGGG + Intergenic
1196771999 X:119303697-119303719 AGTTCTTAGCAGGTTAAATTTGG - Intergenic
1197306534 X:124849110-124849132 AGGTATTTGCATGTTGAATTAGG + Intronic
1197529622 X:127606722-127606744 AATTGTTTCCAGGGTGAACTTGG + Intergenic
1198634695 X:138683262-138683284 ATTTTTTTGCAGGAGGAACTTGG - Intronic
1199235727 X:145489916-145489938 AGTTGTTAGCAGGTTGATGTAGG - Intergenic
1200374994 X:155770411-155770433 AATTTTTTTCAGGTTGAACATGG + Intronic