ID: 1011732851

View in Genome Browser
Species Human (GRCh38)
Location 6:90283669-90283691
Sequence TTAAAAATGCATGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 1, 2: 8, 3: 78, 4: 745}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011732851_1011732856 18 Left 1011732851 6:90283669-90283691 CCGGCCTCCTCATGCATTTTTAA 0: 1
1: 1
2: 8
3: 78
4: 745
Right 1011732856 6:90283710-90283732 AGAATTTTTTAGGTCTGGCCAGG 0: 1
1: 0
2: 1
3: 31
4: 309
1011732851_1011732858 26 Left 1011732851 6:90283669-90283691 CCGGCCTCCTCATGCATTTTTAA 0: 1
1: 1
2: 8
3: 78
4: 745
Right 1011732858 6:90283718-90283740 TTAGGTCTGGCCAGGCACGGCGG 0: 2
1: 9
2: 79
3: 768
4: 4420
1011732851_1011732855 13 Left 1011732851 6:90283669-90283691 CCGGCCTCCTCATGCATTTTTAA 0: 1
1: 1
2: 8
3: 78
4: 745
Right 1011732855 6:90283705-90283727 TTATAAGAATTTTTTAGGTCTGG 0: 1
1: 0
2: 4
3: 53
4: 672
1011732851_1011732857 23 Left 1011732851 6:90283669-90283691 CCGGCCTCCTCATGCATTTTTAA 0: 1
1: 1
2: 8
3: 78
4: 745
Right 1011732857 6:90283715-90283737 TTTTTAGGTCTGGCCAGGCACGG No data
1011732851_1011732854 8 Left 1011732851 6:90283669-90283691 CCGGCCTCCTCATGCATTTTTAA 0: 1
1: 1
2: 8
3: 78
4: 745
Right 1011732854 6:90283700-90283722 CTATTTTATAAGAATTTTTTAGG 0: 1
1: 0
2: 7
3: 118
4: 1143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011732851 Original CRISPR TTAAAAATGCATGAGGAGGC CGG (reversed) Intronic
900925545 1:5703938-5703960 TAGAAAATGCACGTGGAGGCTGG + Intergenic
901252802 1:7794190-7794212 ATAATAATGCAATAGGAGGCTGG + Intronic
901309199 1:8255998-8256020 TTAAAAAGGTAATAGGAGGCCGG - Intergenic
901548009 1:9973726-9973748 AAAAAAATGCATGAATAGGCTGG + Intronic
901714188 1:11139984-11140006 TTAAAAATACAAGAAAAGGCCGG - Intronic
901926375 1:12568627-12568649 TTAAAAGGGCAGGGGGAGGCTGG + Intronic
902429264 1:16350448-16350470 TTAAAAATAGAAAAGGAGGCTGG + Intronic
902587056 1:17446190-17446212 TTCAAAAGGCAGCAGGAGGCCGG - Intergenic
903051232 1:20602714-20602736 ATAAAAACACATGATGAGGCTGG - Intronic
904402628 1:30266861-30266883 TTAGAAATAAATAAGGAGGCTGG - Intergenic
905850452 1:41270504-41270526 TGAAAAATACACGAGGTGGCTGG + Intergenic
906170618 1:43721894-43721916 AAAAAAATACATGAGGGGGCCGG - Intronic
906776239 1:48532112-48532134 TTAGAAAGGAATGAGGAGACTGG - Intergenic
907233395 1:53021939-53021961 TAAAAAATGGTTGATGAGGCCGG - Intronic
907419576 1:54337789-54337811 TTCAAAAAGTTTGAGGAGGCCGG - Intronic
908379384 1:63581271-63581293 TTAAGAATGGATGATGAGCCAGG + Intronic
908479720 1:64526561-64526583 TTAAAAAGACTTGAGGAGGGGGG + Intronic
908663766 1:66466473-66466495 GTAGAAAGGCATGAGGAGGGAGG - Intergenic
909429276 1:75568282-75568304 TTAAAAATCCATTAGGAAACTGG + Intronic
909480623 1:76125798-76125820 TTAAAAATGCATCAGGATGAAGG - Intronic
909657108 1:78044569-78044591 TTAAGAATTCTTTAGGAGGCCGG - Intronic
909735632 1:78957681-78957703 ATAAAAGTGCAAGAGGAGGCAGG + Intronic
909795564 1:79731375-79731397 TTTAAATTGCATGAGGAGATTGG - Intergenic
909945151 1:81655294-81655316 TTAAAAATACAGAATGAGGCCGG - Intronic
910300223 1:85697631-85697653 TGAAAAAAGAATGATGAGGCTGG - Intronic
910608753 1:89116308-89116330 TTAAAAATGATTGAGTTGGCTGG - Intronic
910994145 1:93086205-93086227 TAAATAATGAAGGAGGAGGCCGG + Intronic
911052561 1:93682847-93682869 TTTAAAATCCATCTGGAGGCCGG - Intronic
911131261 1:94390597-94390619 TTAAAAGTGCAGGAGTGGGCTGG - Intergenic
911180031 1:94852283-94852305 TAGGAAATGCATGAGGGGGCAGG + Intronic
911297703 1:96137733-96137755 TTTAAAATGCAAGTAGAGGCAGG + Intergenic
912728461 1:112079798-112079820 TTAAAAATGCATTAGGAATGAGG + Intergenic
912776150 1:112507751-112507773 TTAAAATCATATGAGGAGGCAGG + Intronic
914960780 1:152204536-152204558 TTCAAAAAGAATGAGGAGTCAGG + Intergenic
915254106 1:154612621-154612643 TTAAAAATAACTGAGCAGGCTGG - Intronic
915642463 1:157239418-157239440 TTAGAGAGGCATGAGCAGGCAGG - Intergenic
915750670 1:158206865-158206887 TAAAAAATGAAACAGGAGGCCGG - Intergenic
915870012 1:159549225-159549247 TTTAAAATTCATATGGAGGCTGG + Intergenic
916488928 1:165284485-165284507 TTAAGAGTGAATGAGCAGGCAGG + Intronic
916729061 1:167550282-167550304 TTTAAAATGCATATAGAGGCGGG - Intronic
917085020 1:171296545-171296567 TTAAACATGCAGGAGAAGGTGGG + Intergenic
917412939 1:174778888-174778910 ATAAAAATGCAGAAGGTGGCCGG - Intronic
917846542 1:179025462-179025484 TTAAAAAGGCAACAGGAGGAGGG + Intergenic
917929496 1:179813715-179813737 TCAAAAATGCATGGGGCGGGGGG + Intronic
918514183 1:185344328-185344350 TTTAAAACACATGATGAGGCTGG - Intergenic
918625114 1:186648485-186648507 TCAAAAGTGAATGAGTAGGCCGG - Intergenic
918952410 1:191155938-191155960 TAAAAAATTAATGAGGAGGACGG - Intergenic
919225952 1:194701860-194701882 TAGAAAATGCATGAGCTGGCAGG - Intergenic
920177506 1:204112142-204112164 ATAAAAATGCATTTGTAGGCTGG + Intronic
920434914 1:205941465-205941487 TTAAAAATGCCTTGGGGGGCTGG - Intronic
920460114 1:206133076-206133098 TTAAAAATGCTTCATGATGCTGG - Intergenic
920919967 1:210290763-210290785 TTAACAATACCTGAGAAGGCAGG - Intergenic
921135274 1:212254320-212254342 TTTAAAATGCTTCAGCAGGCTGG + Intergenic
921861220 1:220044426-220044448 CAAAAAATGTATCAGGAGGCTGG + Intronic
921917531 1:220628788-220628810 TTAAAAATGTATCATGTGGCTGG + Intronic
922178032 1:223212187-223212209 ACAAAAATGCAGGAGAAGGCGGG + Intergenic
922364793 1:224853753-224853775 GTAAAACTGCAGGAGGATGCAGG + Intergenic
922599916 1:226842665-226842687 TTAAAAATGGAAAAGTAGGCCGG - Intergenic
923706901 1:236351421-236351443 TCAAGGATGAATGAGGAGGCTGG + Intronic
923751370 1:236749498-236749520 TTAAAAAAGAATGCTGAGGCTGG + Intronic
923936881 1:238771237-238771259 ATAAAAGAGAATGAGGAGGCCGG - Intergenic
923954867 1:239004997-239005019 TTAAAAATGAATGCAGAGGCCGG + Intergenic
924304632 1:242674474-242674496 TTAAAAATTCATTTGCAGGCTGG - Intergenic
1063310226 10:4945340-4945362 TTAAAAATGCATGAATATCCAGG + Intronic
1063551725 10:7040276-7040298 TTAAAAGTGCATGAGGGTGCGGG + Intergenic
1064195384 10:13240016-13240038 ATAAAAAGGGATGAGGATGCCGG - Intergenic
1064309761 10:14201832-14201854 TTTAAAATTCACGTGGAGGCTGG + Intronic
1064659525 10:17592434-17592456 TTAAGAATGCAGGGGGAGGAGGG + Intronic
1064734060 10:18362642-18362664 TAGAAAATGCATGTAGAGGCTGG + Intronic
1065509827 10:26467200-26467222 TTAAAAATGCATTAGAAGGCTGG - Intronic
1065707257 10:28481780-28481802 TTAAAAAGTCATGAGGGAGCTGG - Intergenic
1065893371 10:30139705-30139727 ATAAAAATGCAGGATGGGGCTGG + Intergenic
1066056597 10:31686845-31686867 TGAAAAATGCAGAAGGAGGTGGG - Intergenic
1066119824 10:32275468-32275490 TTAAAAATGCAAAAGTTGGCTGG + Intronic
1066367127 10:34788079-34788101 TTATAAATGCATGCTGGGGCTGG - Intronic
1066569237 10:36753639-36753661 TAGAAAATGCATGAGCTGGCTGG + Intergenic
1067076792 10:43192118-43192140 TTAAAAATCCAAGTGAAGGCAGG - Intergenic
1067192300 10:44081857-44081879 TTAAAAAAGCATGACCTGGCCGG + Intergenic
1067774382 10:49152003-49152025 TTAAAAATATATAAAGAGGCTGG + Intergenic
1067979697 10:51071900-51071922 TTAAAAATGAACGAGATGGCTGG + Intronic
1068027826 10:51670438-51670460 TTAAAAATGCAAGATAAGGCCGG + Intronic
1068599377 10:58939833-58939855 TTAAAAATACTTGATTAGGCTGG + Intergenic
1068759245 10:60689453-60689475 TTAAAAATGAATGAACTGGCTGG + Intronic
1069098957 10:64294065-64294087 TTAAAAATAAATGAGTTGGCTGG - Intergenic
1069476503 10:68738116-68738138 CTAAGAAAGTATGAGGAGGCTGG + Intronic
1069637973 10:69937177-69937199 TTTCAAATGGATGAGGGGGCTGG + Intronic
1069707012 10:70465268-70465290 TTAAAAGTGTATGTAGAGGCCGG - Intergenic
1070209318 10:74299195-74299217 GTAAAAATATATGTGGAGGCCGG + Intronic
1070523807 10:77277395-77277417 TTAAAAATGCATCAGCTTGCTGG - Intronic
1070876179 10:79812857-79812879 TATAAAAAGCATGTGGAGGCAGG + Intergenic
1071335955 10:84600782-84600804 TAAAGAATCCATGAGGGGGCCGG - Intergenic
1072420202 10:95284648-95284670 TTGAAAATGCATACAGAGGCTGG - Intronic
1072595984 10:96872394-96872416 TTACAAATAAAGGAGGAGGCTGG + Intronic
1072786805 10:98289001-98289023 TTAAAAATGCAATTGCAGGCCGG - Intergenic
1072852092 10:98906607-98906629 TTAAAAATGCTAGAATAGGCTGG + Intronic
1072933332 10:99687559-99687581 TGAAAAATGAATGAATAGGCTGG - Intronic
1073013006 10:100376295-100376317 GCAAAAAGGCATGAGAAGGCTGG + Intergenic
1073174339 10:101543172-101543194 TTAAAAATACAAGAAGTGGCTGG - Intronic
1074193734 10:111161105-111161127 TTAAAAATACATAAGTTGGCTGG - Intergenic
1074633344 10:115284304-115284326 TAAAAAATAAATGAGGAGACAGG + Intronic
1075894262 10:125981063-125981085 TTAATACTGGGTGAGGAGGCAGG - Intronic
1076165027 10:128274885-128274907 TTAAAAATGAATTAGTAGACTGG + Intergenic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1076516729 10:131049633-131049655 TTAAAAATGCAATAAGAAGCAGG + Intergenic
1077012193 11:384290-384312 TTAAAAATCAATGATAAGGCTGG + Intergenic
1077293094 11:1809177-1809199 TCAAAAATACATAAAGAGGCCGG + Intergenic
1077875230 11:6299037-6299059 TGAAAAATTCAAGAAGAGGCTGG + Intergenic
1078232898 11:9459174-9459196 TAAAAAATGGATTAGGTGGCCGG - Intergenic
1079274522 11:19022158-19022180 TTAAAAATACATCAGGAAGGAGG - Intergenic
1079531934 11:21464643-21464665 TTAAATATGGATGTTGAGGCTGG + Intronic
1079596705 11:22258835-22258857 TTAGAAATGCAAAAGAAGGCTGG + Intronic
1079702739 11:23569529-23569551 CTAAAAATGAATGCTGAGGCAGG - Intergenic
1080471350 11:32548632-32548654 TTTAAAATGTCTGATGAGGCCGG - Intergenic
1080523995 11:33095194-33095216 TTAAAAATAAATGAATAGGCCGG - Intronic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1082669864 11:56022403-56022425 TAAAAAATGTATAAGAAGGCCGG + Intergenic
1082696988 11:56379648-56379670 TTAAAATTGAATGGGAAGGCAGG + Intergenic
1082950077 11:58805323-58805345 GTAAAACTGCATGAGGAGGGTGG - Intergenic
1083449359 11:62732289-62732311 TTAAAAGTGCTTTAAGAGGCTGG - Intronic
1083851116 11:65367662-65367684 TTAAAAATGTGTAAGCAGGCCGG - Intergenic
1084493845 11:69492455-69492477 TTATAAGTGGAGGAGGAGGCAGG + Intergenic
1084620844 11:70269597-70269619 TTAAAAATTCTTGCTGAGGCCGG + Intergenic
1087093545 11:94299255-94299277 TTGAAAATATATGAAGAGGCCGG + Intergenic
1087320573 11:96653047-96653069 TTAAAAATGGAGAAAGAGGCTGG + Intergenic
1087684766 11:101250272-101250294 TTAAAAATGAATGTGGATACTGG + Intergenic
1087940420 11:104090322-104090344 TTAAAAATGGATGTAGAGGCGGG + Intronic
1087973791 11:104518768-104518790 TTAAAAAAGCATGATGTGGCCGG + Intergenic
1088166698 11:106946920-106946942 TTAAGAATGAAAGAAGAGGCTGG + Intronic
1088811760 11:113397079-113397101 ATATAAATGCACGAGAAGGCAGG - Intronic
1089631212 11:119785566-119785588 TTAGAACTACAGGAGGAGGCTGG + Intergenic
1090034947 11:123240979-123241001 TTAAATATGCATTTGTAGGCAGG + Intergenic
1090431028 11:126646769-126646791 TTAAAAATACTTGGGGTGGCCGG - Intronic
1090813752 11:130271932-130271954 TCAAGAGTGTATGAGGAGGCTGG + Intronic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1091329276 11:134718049-134718071 TTCAAAAAGCAGGAGAAGGCAGG + Intergenic
1091562652 12:1626859-1626881 TTAAAAATACATTTGGCGGCCGG - Intronic
1091814259 12:3424391-3424413 GTAAAAATGAATGTGGATGCTGG - Intronic
1092134724 12:6138710-6138732 ACAAAAATGCATGAAAAGGCTGG - Intergenic
1092488797 12:8926318-8926340 TTAAAATTGCCTGGAGAGGCCGG + Intronic
1092608387 12:10145673-10145695 TAAAAAATTCTTCAGGAGGCCGG + Intergenic
1092891314 12:12971722-12971744 TTAAACATGGATGAGATGGCAGG + Intergenic
1092993563 12:13926635-13926657 TTAAAAATGCAGGCAGAGCCAGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093419085 12:18953834-18953856 TTCCAAATGCAAGAGGAAGCTGG + Intergenic
1093583875 12:20814592-20814614 TTAAAAATGCATATTAAGGCTGG + Intronic
1094027054 12:25969970-25969992 TTAAGAAATCTTGAGGAGGCAGG - Intronic
1094179565 12:27577395-27577417 TTACAAATGCATAAAGAGTCAGG - Intronic
1094437850 12:30441204-30441226 TTTAAAATGCATTTTGAGGCTGG - Intergenic
1094440232 12:30467419-30467441 TTTTAAATGCATTAGGAAGCTGG + Intergenic
1095565465 12:43618206-43618228 TTAAAAATAAAGAAGGAGGCCGG - Intergenic
1096118203 12:49068730-49068752 TTAAGAATGTAAGGGGAGGCTGG - Intronic
1096355810 12:50939810-50939832 TTACAAATGCTTAAGGAAGCAGG - Intergenic
1096707708 12:53432936-53432958 TTAAAAATAAATGTTGAGGCTGG - Intergenic
1097575762 12:61390498-61390520 TTAAATATGCATAAATAGGCAGG + Intergenic
1097804449 12:63950224-63950246 CTAAAAAGGTATGTGGAGGCTGG - Intronic
1098085469 12:66837895-66837917 TAAAAAATCCAGCAGGAGGCTGG + Intergenic
1098161837 12:67653124-67653146 TTAAAAATACATACTGAGGCCGG - Intronic
1098362422 12:69667589-69667611 TTAAGAATGAGTTAGGAGGCGGG - Intronic
1098548679 12:71739354-71739376 TTAGAAATGGAAGAAGAGGCCGG + Intergenic
1099321537 12:81156861-81156883 TTTAAAATAGAAGAGGAGGCAGG + Intronic
1099868957 12:88322107-88322129 ATAAACATCCATGAGGAGGATGG + Intergenic
1100501913 12:95182495-95182517 TTAAAAATGTATGTATAGGCTGG - Intronic
1100967707 12:100031145-100031167 TTAAAAATGTATTAAGTGGCTGG + Intronic
1101122175 12:101593688-101593710 TTAAAAATATATATGGAGGCTGG - Intronic
1101372041 12:104138591-104138613 TTAAAAATCCAGGCGCAGGCAGG - Intergenic
1101384255 12:104242233-104242255 TTAAAAAATCATTAGTAGGCCGG - Intronic
1101412838 12:104483500-104483522 GTCAAAGTGCATGGGGAGGCCGG - Intronic
1101424210 12:104574893-104574915 TTAAAAATGACTGTAGAGGCCGG + Intronic
1101885571 12:108658340-108658362 TTAAAGATGCAACAGGTGGCCGG - Intronic
1102332105 12:112042801-112042823 TTAAAAATGAAGCAGTAGGCTGG - Intronic
1102353424 12:112212059-112212081 TTAAATATGTATGAGGATGCTGG + Intronic
1102420859 12:112801743-112801765 TGAAAAATGGAGGAAGAGGCGGG - Intronic
1102838839 12:116096055-116096077 TAAAAAATCAATGATGAGGCCGG + Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103267695 12:119644773-119644795 TTGAAAAGCTATGAGGAGGCTGG - Intergenic
1103609287 12:122112340-122112362 TTAAAAATGTATGTACAGGCCGG + Intronic
1103619210 12:122175961-122175983 TAAAATATGAATAAGGAGGCCGG - Intronic
1103626970 12:122226859-122226881 TTAAAAATGCAGGAGGTGGTGGG - Intronic
1104416144 12:128598118-128598140 TTAAAACTGTTGGAGGAGGCTGG + Intronic
1104537560 12:129632514-129632536 GTAAAAATGAATGGGGAGGTCGG - Intronic
1105370157 13:19795190-19795212 TAAAAAATGAATGCAGAGGCTGG + Intergenic
1105712923 13:23030377-23030399 TTAAAAATGCATGTTCTGGCTGG - Intergenic
1106125377 13:26896551-26896573 TTAAAAATACATCAGTCGGCCGG + Intergenic
1106826341 13:33525316-33525338 TTAAAAACACATTTGGAGGCAGG - Intergenic
1106972365 13:35157209-35157231 TAAAATATGAATGGGGAGGCTGG + Exonic
1106977531 13:35238497-35238519 TTAAAAATGCATTAAGATTCAGG - Intronic
1107527364 13:41246387-41246409 TTAGAAATGCATTAGGAAGATGG - Intronic
1108181589 13:47845609-47845631 TTAAAAATGTATAAGAAGACAGG - Intergenic
1108314318 13:49222392-49222414 TTAGAACTGCAAGAGGAGCCTGG - Intergenic
1108346489 13:49551602-49551624 TTAAAAAAGCATTAGAAGGCCGG + Intronic
1108466890 13:50725631-50725653 TTAAAAATCAAAGAGAAGGCAGG + Intronic
1110056627 13:70982383-70982405 TTAAAAATGGAAGAGGTGGCAGG - Intergenic
1110208168 13:72942702-72942724 TTAAAAATCCTTTAGTAGGCTGG + Intronic
1110580514 13:77118299-77118321 TCAGAAATGCTTGATGAGGCAGG + Intronic
1111006900 13:82259846-82259868 TTAAAAATACATCAAAAGGCCGG + Intergenic
1111260297 13:85729597-85729619 TTAAAAATATATGATGTGGCTGG + Intergenic
1111502904 13:89147128-89147150 TTAAAAATAGATGAGGAGCTAGG - Intergenic
1111719590 13:91925113-91925135 TTAAAAATCCACGAAGTGGCCGG - Intronic
1111911493 13:94317221-94317243 TTATTTATGCATGATGAGGCAGG + Intronic
1112390976 13:98983911-98983933 TAAAAAATAATTGAGGAGGCCGG - Intronic
1112956156 13:105060555-105060577 TCACAAATGTATGAGGAGGCAGG - Intergenic
1113386448 13:109852822-109852844 TCAAAAAGGCAAGAGGAAGCTGG - Intergenic
1113599901 13:111561168-111561190 TTAAGAAGGCTGGAGGAGGCGGG + Intergenic
1113765366 13:112877672-112877694 TCAAAGATGCCTGAGCAGGCAGG + Intronic
1114150441 14:20032311-20032333 TTGAAAATGCATTTTGAGGCTGG + Intergenic
1116106164 14:40510115-40510137 CTAAAAATGCATGAAGATACAGG - Intergenic
1116915113 14:50517469-50517491 TTAAAAATAAATGTTGAGGCTGG + Intronic
1117214937 14:53541279-53541301 TTAATAATTCTGGAGGAGGCTGG + Intergenic
1117408234 14:55425969-55425991 TTAAAAATTAAAGAGGGGGCCGG + Intronic
1117521888 14:56559442-56559464 TTAATACTGCATTAGAAGGCTGG + Intronic
1117533389 14:56680801-56680823 TAAAAAATTCATGATGGGGCGGG + Intronic
1118358046 14:65031610-65031632 TTAAAAAAGCATTATTAGGCTGG - Intronic
1118602244 14:67479110-67479132 TTAAAAATGCTTATGGAGGCTGG + Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1118983957 14:70737743-70737765 TTAAAAATGGAAGAAGAGCCAGG + Intronic
1119221896 14:72915512-72915534 GTCAAAATGAATGATGAGGCTGG - Intergenic
1119298986 14:73556125-73556147 TTAGAAATTCTTAAGGAGGCTGG + Intronic
1119327943 14:73773131-73773153 TTAAAAATGTATGAGAAGCCAGG - Intronic
1120077898 14:80181047-80181069 TTCAAAATTCATAATGAGGCAGG + Intergenic
1120168507 14:81225529-81225551 TTTAAAATGCATTGTGAGGCTGG - Intergenic
1120214330 14:81665861-81665883 TTTAAAATTTATGAGCAGGCGGG + Intergenic
1121506371 14:94480551-94480573 TGAAAAATGCGTCAGGTGGCTGG - Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122085716 14:99301694-99301716 TAAAAAATGCTTGAATAGGCCGG + Intergenic
1122169283 14:99858479-99858501 TGTAAAAGGAATGAGGAGGCTGG - Intronic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1123223328 14:106876784-106876806 TTCAAAATGCCTGAGAAGGGAGG - Intergenic
1123813191 15:23949703-23949725 TGAGAAATACGTGAGGAGGCAGG + Intergenic
1123895886 15:24829470-24829492 TGAGTAATACATGAGGAGGCAGG + Intronic
1123899556 15:24862903-24862925 TGAATAATATATGAGGAGGCAGG + Intronic
1124222519 15:27862769-27862791 CTTAAAATGTCTGAGGAGGCTGG - Intronic
1124336205 15:28858919-28858941 TTAAAAATGCAGGTCCAGGCCGG - Intergenic
1124367690 15:29085227-29085249 TTAAAAATTAATGAGTTGGCTGG + Intronic
1124431001 15:29608503-29608525 TAAAGAAGGCAGGAGGAGGCAGG - Intergenic
1124949715 15:34306055-34306077 ATAGAAATGCTGGAGGAGGCTGG - Intronic
1125858384 15:42973588-42973610 TTAAAAATGAGCGATGAGGCCGG - Intronic
1126167165 15:45663312-45663334 TTAACAATGCCTCAGCAGGCCGG - Intronic
1127305514 15:57701875-57701897 TTAAAAATACATGGAGAAGCTGG - Intronic
1127470927 15:59289366-59289388 ATCAAACTGCATGAGGAGACTGG + Intronic
1127494170 15:59493882-59493904 TTAGAAAAGAAGGAGGAGGCCGG - Intronic
1127784954 15:62347692-62347714 TGGAAACTGCATGAGGAGGCTGG + Intergenic
1127874563 15:63100726-63100748 TTTAAAATGCAAGATGAGACTGG - Intergenic
1128012527 15:64311340-64311362 TTTAAAATGCGTGTGTAGGCTGG - Intronic
1128024452 15:64423171-64423193 TTAAAAATGCAAATGGAGCCGGG + Intronic
1128106228 15:65047058-65047080 TTAAAAATGCATACAAAGGCTGG + Intronic
1128266913 15:66274822-66274844 TTAAAAATGGTTAAGGTGGCTGG + Intergenic
1128294868 15:66509874-66509896 TTAAAAATCAATGAGGAAGATGG + Intronic
1128986479 15:72225476-72225498 GTCAAAATGCATGATGTGGCTGG - Intronic
1129015686 15:72466645-72466667 TTAAAAATGCATATGCAGCCGGG + Intergenic
1129028029 15:72597596-72597618 TTAAAAATGAAAGGGGAGGCAGG - Exonic
1129549843 15:76436362-76436384 TTCAAAATCCATCAGAAGGCCGG - Intronic
1129813853 15:78534545-78534567 ATAAGAAGGGATGAGGAGGCCGG - Exonic
1129861967 15:78870158-78870180 TTAAAAAAGTATGTGCAGGCTGG + Intronic
1129995036 15:79997203-79997225 TAAAGAATGTAAGAGGAGGCTGG + Intergenic
1130391297 15:83457923-83457945 TTAAAAATGCATTTGAAAGCAGG + Intronic
1131482820 15:92796321-92796343 TCCAAAATCCATGAGCAGGCAGG - Intronic
1132117420 15:99147519-99147541 TTAAGAATGAATTTGGAGGCTGG - Intronic
1132486288 16:193439-193461 TTAAAAATGAATGTGTTGGCCGG - Intronic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1132828255 16:1915571-1915593 TTAGAAAAGCAAGAGGAGGGTGG - Intronic
1133037664 16:3043305-3043327 TTAAAAATACATAAGCTGGCCGG - Intergenic
1133098313 16:3463249-3463271 ATAAAAATGCAAGCTGAGGCCGG + Intronic
1133460466 16:5982570-5982592 TTAAAAAATCATGTGCAGGCTGG - Intergenic
1134039318 16:11055883-11055905 TTTAAAATGCAAGAGAGGGCTGG - Intronic
1134181635 16:12052511-12052533 TTAAAAGTGCAAGGGAAGGCTGG - Intronic
1134245711 16:12538384-12538406 TTAAAAGTGCAAGGGGAGGCCGG - Intronic
1134273256 16:12753640-12753662 TTATGAATGTATGAGGTGGCTGG - Intronic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1134559166 16:15192946-15192968 TTATATATTCATGGGGAGGCAGG - Intergenic
1134919701 16:18104559-18104581 TTATATATTCATGGGGAGGCAGG - Intergenic
1135090062 16:19506835-19506857 TTAAAAAGGCATCACTAGGCTGG + Intronic
1135225347 16:20651330-20651352 CTAAAAATATATGAAGAGGCTGG + Intronic
1135385886 16:22039536-22039558 TTAAAAGTTCATGAGCAGGCTGG + Intronic
1135433117 16:22404022-22404044 TTAAAAATAAAAGAGGGGGCTGG - Intronic
1135643890 16:24144595-24144617 TTAAAAATGAATGTAGTGGCCGG - Intronic
1135647475 16:24175673-24175695 ATTAAAAGGCATGAGGGGGCTGG + Intronic
1135923058 16:26668450-26668472 TTTAAAATGCATTTTGAGGCTGG + Intergenic
1135967837 16:27050755-27050777 ATAAAAATTAATGCGGAGGCCGG + Intergenic
1136774003 16:32861498-32861520 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1136896606 16:34000021-34000043 TTTGAAAAGCATGTGGAGGCTGG + Intergenic
1137545651 16:49401399-49401421 TTAAAAATGCAATAGCCGGCTGG + Intergenic
1137755501 16:50898971-50898993 TAAGAAATGCATGATAAGGCCGG + Intergenic
1137987282 16:53119927-53119949 TTTAAATTGCACCAGGAGGCTGG + Intronic
1138624437 16:58237785-58237807 ATAAAACTGCAAGATGAGGCCGG - Intronic
1138630415 16:58289870-58289892 TTAAAAATACATGTGTAGCCGGG - Intronic
1138683016 16:58700146-58700168 TTAAAAATGCTTAATGTGGCCGG - Intergenic
1138812861 16:60171294-60171316 TTTAAAAACCATGATGAGGCCGG + Intergenic
1139019929 16:62736317-62736339 TTGAAAATGCTTGAGTAGGCCGG + Intergenic
1139738258 16:69012258-69012280 TTAGAAATACCTGAGGAGGTTGG + Intronic
1139809814 16:69605141-69605163 TTAAAAAAGAAAGTGGAGGCCGG + Intronic
1139828234 16:69774655-69774677 TTAAAAAGGCATGAACAGGAAGG - Intronic
1140134884 16:72197313-72197335 GTAAAAAAGCATGAGAAGCCAGG + Intergenic
1140784689 16:78329155-78329177 TTAAAAATATATCAGCAGGCTGG - Intronic
1140802085 16:78497904-78497926 TTAACAAAGCATCAGGGGGCTGG + Intronic
1140819580 16:78650546-78650568 TGAAAAATGCATTTGCAGGCAGG - Intronic
1141113134 16:81286778-81286800 TTAAAACTGGGGGAGGAGGCCGG + Intronic
1203076425 16_KI270728v1_random:1123609-1123631 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1142692263 17:1613731-1613753 TGAAATAGGCAAGAGGAGGCTGG - Intronic
1142980524 17:3668625-3668647 TTAACTATTCATGAGGGGGCGGG - Exonic
1143000368 17:3790856-3790878 TTAAAAAGACATTTGGAGGCCGG + Intronic
1143088073 17:4431651-4431673 TTAAAAATGGGTGAAGAGCCGGG - Intergenic
1143225496 17:5298949-5298971 TTTAAAATCCTGGAGGAGGCCGG - Intronic
1143676167 17:8434773-8434795 TTAATAATGCAAGATGGGGCCGG + Intronic
1143819518 17:9548399-9548421 TCAAGAATGTATGAGGTGGCCGG - Intronic
1143957740 17:10686290-10686312 TTCAAAATTCCTAAGGAGGCTGG + Intronic
1144178874 17:12733569-12733591 TTAAAAAGAAATGAGAAGGCTGG + Intronic
1144452968 17:15396512-15396534 TTAAAAATGACTGGGTAGGCCGG + Intergenic
1144502355 17:15799663-15799685 TTAAAAATACATGTCTAGGCCGG + Intergenic
1144565560 17:16356238-16356260 TTAAAAAGGCATGTGCTGGCTGG + Intergenic
1144575181 17:16425318-16425340 TTAAAAATGCAGCTGCAGGCTGG - Intronic
1145164532 17:20602322-20602344 TTAAAAATACATGACTAGGCCGG + Intergenic
1145771705 17:27498031-27498053 TTAAAAATGCCTCTTGAGGCTGG + Intronic
1145913709 17:28557910-28557932 TTACAAATGAATGACTAGGCTGG - Intronic
1146084190 17:29812578-29812600 TTTAAAATGCATAAATAGGCTGG - Intronic
1146426435 17:32743912-32743934 TTAATAATGCAGGCTGAGGCTGG - Intronic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1150542053 17:66111992-66112014 TTAAAAATCAATGAAAAGGCCGG + Intronic
1150800823 17:68281270-68281292 TTAAAAATGGGTGAACAGGCTGG + Intronic
1150852748 17:68720281-68720303 TTAAAAATGCATTACAAGGCTGG - Intergenic
1151072425 17:71231162-71231184 TTAAAAATCCATGAGCATTCCGG - Intergenic
1151531470 17:74708618-74708640 TAAAAAATCAATAAGGAGGCTGG + Intronic
1151971768 17:77461006-77461028 TTAAAAATCTGTGGGGAGGCTGG + Intronic
1152323712 17:79623514-79623536 TTAAAAGTGGAAGAGGAGACTGG + Intergenic
1152779939 17:82222505-82222527 GTAAAAAGGTATGAAGAGGCCGG + Intergenic
1152851867 17:82641597-82641619 TTAAAAATCCAAGAGGTGGCCGG + Intronic
1153167216 18:2275881-2275903 TTAAAAGTCCATGAGGAGGCCGG + Intergenic
1153430913 18:5016096-5016118 ATCAAAATGTTTGAGGAGGCCGG - Intergenic
1153645789 18:7194959-7194981 TTAGAAATAGAGGAGGAGGCTGG - Intergenic
1155804071 18:30143725-30143747 TCAAAAAGGCATGAAGATGCTGG - Intergenic
1155925459 18:31651060-31651082 TTAAAAATGCAGCTGGGGGCTGG - Intronic
1155926866 18:31665441-31665463 TTAAAAAGACAAGAGTAGGCCGG + Intronic
1156594955 18:38538165-38538187 TTAATAATGCATGTGGAGAAGGG + Intergenic
1156722225 18:40084243-40084265 TTAAAAGTGCATGATGAGACCGG + Intergenic
1159258661 18:65981168-65981190 TTAAAAATGTGTAAGGATGCCGG - Intergenic
1159606672 18:70481416-70481438 TTTAAAATTCATGTGGAGGTTGG - Intergenic
1159935139 18:74359847-74359869 TTAAGAATGCAAGAAGTGGCCGG + Intergenic
1159952382 18:74495006-74495028 TAAAAAATAAAAGAGGAGGCAGG + Intergenic
1160513270 18:79464389-79464411 TTAAAAATGAAACAGCAGGCCGG - Intronic
1161146854 19:2684022-2684044 TTAAAAATAAATGATGGGGCCGG + Intronic
1161528959 19:4775419-4775441 TTAAAAAAGAAAGAGGAGGCTGG + Intergenic
1161645389 19:5450321-5450343 TTAAATATGGATCAAGAGGCAGG + Intergenic
1162043670 19:7985214-7985236 TTAAAAACCACTGAGGAGGCTGG - Intronic
1162688479 19:12408735-12408757 ATCAAAATGCATAAGGTGGCTGG + Intronic
1162892682 19:13745364-13745386 ATAATAAAGCATGGGGAGGCCGG + Intronic
1162904263 19:13814343-13814365 TCAAAGATGCATGTGTAGGCTGG - Intronic
1163042635 19:14613980-14614002 TTAAAAATAAATAACGAGGCTGG - Intergenic
1163389186 19:17019862-17019884 TAAAAAATGAATAATGAGGCTGG - Intronic
1163431738 19:17272230-17272252 TTAAAAATACATTTAGAGGCTGG - Intronic
1163504075 19:17694264-17694286 TTAAAAATATATAAGTAGGCTGG - Intergenic
1163983542 19:20923784-20923806 TTAAAAATGTATGGGGGGACGGG + Intronic
1164822489 19:31260875-31260897 TTAAAAATGCATGTGGTGAATGG - Intergenic
1165364517 19:35356679-35356701 TTAAAAGTGCAGCAGTAGGCTGG - Intergenic
1165531065 19:36402170-36402192 TTTAAAATAGATTAGGAGGCCGG + Intronic
1166073795 19:40402054-40402076 TTAAAAATGCAGCTGTAGGCCGG + Intronic
1166286825 19:41836123-41836145 TTAAAAAGGCATGAAGTTGCAGG + Intergenic
1166390325 19:42405671-42405693 TTCAAAAGGGATAAGGAGGCTGG + Intronic
1166731834 19:45063744-45063766 TGAAAAATGGATGAGCAGGCCGG - Intronic
1166780187 19:45338132-45338154 TTAAAAAAGCTAGAGTAGGCCGG + Intronic
1166829828 19:45632656-45632678 TTTAAAATGCCTGAGAGGGCTGG + Intronic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167566340 19:50259580-50259602 TTAAAAATGAAGTAGAAGGCGGG + Intronic
1167867455 19:52339818-52339840 TTAAAAATACAAGAGTAGCCAGG - Intronic
1168037684 19:53733153-53733175 TCAAAAATGTATGATGTGGCTGG + Intergenic
1168081070 19:54010875-54010897 CTAAAAATAAAAGAGGAGGCTGG - Intronic
925206317 2:2010041-2010063 TTTAAAATGCAATGGGAGGCTGG - Intronic
925311088 2:2882260-2882282 TTAAAAATGTCTAAGTAGGCTGG - Intergenic
925480545 2:4266416-4266438 TTAAAAATGCATGATCAGGCCGG + Intergenic
925700502 2:6632550-6632572 TTAAAAGTGCCAGAGAAGGCTGG + Intergenic
926122266 2:10249855-10249877 TTAACAAAGCATGAAGAGACAGG - Intergenic
926242057 2:11096174-11096196 TTTAAAATGCAAGTTGAGGCTGG - Intergenic
926296372 2:11572005-11572027 TTAAAAATGCATGGTTCGGCTGG - Intronic
926626178 2:15091827-15091849 TTAAAAAAACACAAGGAGGCTGG - Intergenic
926860963 2:17308287-17308309 CTAAAACTGGATGATGAGGCAGG + Intergenic
927733020 2:25492565-25492587 TTAAAGATGAAGGAGTAGGCTGG + Intronic
927769672 2:25848747-25848769 TTAAAACTACTTAAGGAGGCCGG + Intronic
927800581 2:26095309-26095331 TTAAAAATGCAAGCTCAGGCCGG + Intronic
927941902 2:27109587-27109609 TTAAATATGCATGTTAAGGCTGG + Intronic
928538862 2:32265475-32265497 TTAAAAATACATGTTGTGGCTGG - Intronic
928577780 2:32673521-32673543 CTAAAAACGCATAAGGTGGCCGG - Intronic
928646464 2:33357712-33357734 TTCAATTTGCATGAAGAGGCTGG - Intronic
928716083 2:34062571-34062593 ATAAAAATTCAAGATGAGGCAGG - Intergenic
929189569 2:39126553-39126575 TTAAGAATGCAAAAGGTGGCCGG - Intergenic
929216738 2:39422225-39422247 TTAGAAATGATTGAGAAGGCAGG - Intronic
929431262 2:41888978-41889000 TTATAAAAGCATCAGGAGGCCGG + Intergenic
929673243 2:43896365-43896387 TAAAAAATGCAAGATTAGGCTGG - Intronic
930314961 2:49786178-49786200 TTAAGAATATATGATGAGGCCGG - Intergenic
930816634 2:55605131-55605153 TTAAAAATGTGTGTGTAGGCTGG - Intronic
931313421 2:61104184-61104206 TTAAAAATACTGGAGGTGGCTGG + Intronic
931747493 2:65302907-65302929 TTAAAAATTACTAAGGAGGCCGG + Intergenic
932019839 2:68073211-68073233 AGAAAAAAGCATGAGGAGTCAGG + Intronic
932148418 2:69345292-69345314 TTAAAAATGCAGGAGGGTACAGG + Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932802690 2:74755874-74755896 TTAAAAATGCTTGTGGGGGCCGG - Intergenic
933104788 2:78310764-78310786 ATAAAAATGAATTAAGAGGCCGG - Intergenic
933130390 2:78665272-78665294 TTAAAAATAAATGATGTGGCTGG - Intergenic
933449175 2:82424640-82424662 TTAAAAGTGGAAGAGGATGCAGG + Intergenic
934543355 2:95194409-95194431 TAGAAAATGCATGATGAGGCCGG - Intergenic
934564273 2:95329823-95329845 TTAAGAAAGCATGAGTAAGCAGG - Intronic
934834443 2:97571349-97571371 TCTAAAATGCATTAGTAGGCTGG + Intronic
934854506 2:97720646-97720668 TTAAAAAGTCATGAAGCGGCTGG - Intronic
934864555 2:97794330-97794352 ATAAAAATTCATGAGCAGGCCGG - Intronic
935041791 2:99437277-99437299 TTAAGAATACATGAGCAGGCTGG - Intronic
935416187 2:102821740-102821762 TTAAAAATGGAGGCTGAGGCGGG + Intronic
936697409 2:114966743-114966765 TTAAGAATACAAGAGAAGGCTGG + Intronic
936761804 2:115794759-115794781 TTAAAAATGAATAAGGACTCCGG - Intronic
939202188 2:139051312-139051334 TTTAAAATGCATGGGGAGTAAGG + Intergenic
939949271 2:148449273-148449295 TTGAAAATACATAAGGAGGTGGG - Intronic
940133961 2:150415449-150415471 TAAAAAGTGCAAGAGCAGGCCGG + Intergenic
940412355 2:153380310-153380332 TTTAAAATATATGAGGAGGCTGG + Intergenic
940941534 2:159566945-159566967 TTAAAAATGCATTCAGGGGCCGG + Intronic
941103330 2:161322684-161322706 TTAAAAAAACATGACCAGGCCGG - Intronic
941747058 2:169098087-169098109 TTTAAAATACATGAGAAGGTGGG + Intergenic
941818975 2:169826278-169826300 TTAAAAATGCAAGAGGATATTGG + Intergenic
942418442 2:175782826-175782848 TAAAATGTGCAGGAGGAGGCCGG - Intergenic
943179157 2:184521306-184521328 TTAAAAATGGAAGAGGAAGGTGG + Intergenic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
943575642 2:189627687-189627709 TTAAAAATGCACGAATGGGCTGG + Intergenic
943688341 2:190842922-190842944 TTTAAAATGCATGGGGAGGGTGG + Intergenic
943751072 2:191510165-191510187 TTAAAAACAAATGAAGAGGCCGG - Intergenic
944088257 2:195874477-195874499 TTACCAATGCCTGAAGAGGCAGG + Intronic
944326499 2:198411610-198411632 TTTAAATTTCATGAGGAAGCTGG - Intronic
944472091 2:200064658-200064680 TTCAAAATGAATGAGTGGGCTGG + Intergenic
944576082 2:201092256-201092278 TTAAAAATGTCTGTGGAGACGGG - Intergenic
944913420 2:204332687-204332709 TTAGAAATGCATGTTAAGGCTGG - Intergenic
945685291 2:212961525-212961547 TTAAAATGGCATGAAGACGCTGG - Intergenic
945801221 2:214433736-214433758 TTACAAATGCAGGGGCAGGCAGG + Intronic
946963986 2:225017017-225017039 TTAAAAATATAAGAGGCGGCCGG - Intronic
947282736 2:228473543-228473565 TGCATAATGCATGAGGAAGCTGG + Intergenic
947366731 2:229404021-229404043 TGAAAAATGGATTAGGAGTCAGG + Intronic
947490184 2:230587221-230587243 TTAAAAAAAAATCAGGAGGCCGG + Intergenic
947772764 2:232683872-232683894 ATAAAAATTCATGTGCAGGCCGG - Intergenic
947838483 2:233191740-233191762 TGAACAAAGCATGAGGAGGGAGG + Intronic
947845934 2:233243792-233243814 TTAAAAATTCCTGTGGAGGATGG + Intronic
947859056 2:233345854-233345876 TTTAAAATGCAAGGAGAGGCCGG + Intronic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
947881471 2:233517681-233517703 ATAAACATGCATGTGCAGGCCGG - Intronic
948180335 2:235974397-235974419 TTAAAAATGCAGGACCAGACTGG + Intronic
948496609 2:238354068-238354090 TTAAAAATCCGTGACTAGGCTGG - Intronic
948635664 2:239334724-239334746 TTTAAAATTCATATGGAGGCCGG + Intronic
948919523 2:241055744-241055766 TTACAAATGCATGAGAAGCCAGG + Intronic
948998203 2:241595339-241595361 TTAAAAATACATGAGACAGCCGG + Intronic
949011207 2:241679670-241679692 TTGAAAATGCATCTGGAGGCTGG + Intronic
1169107349 20:3008132-3008154 TGCAAAATGCATGAGAAGACTGG + Intronic
1169372437 20:5038634-5038656 TCAAAAATGCATTAGGCAGCTGG + Intergenic
1169394994 20:5221325-5221347 TTAGAAATGCTTGAGGAGCGTGG - Intergenic
1169666332 20:8040787-8040809 TTAAAAATACAAGATGAGCCTGG - Intergenic
1170164204 20:13345021-13345043 GTAAATGTGCATGAGGAGGCTGG - Intergenic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170901559 20:20468383-20468405 TGAAAAATGCATGGGGAGAGGGG - Intronic
1170958894 20:21007328-21007350 TTAAAAATGGAAGAGGGGGCGGG - Intergenic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1171972812 20:31574846-31574868 TTAAAAATACAAAATGAGGCCGG - Intronic
1172133478 20:32672020-32672042 TTAAAAATTTAAGAGGAGCCGGG + Intergenic
1172396460 20:34609658-34609680 TTAAATATGAAGGAGGAGCCAGG - Intronic
1172667453 20:36610403-36610425 TTAAAAAGGAATGAAGTGGCCGG + Intronic
1172717983 20:36977943-36977965 ATAAAAATGTATGATCAGGCCGG - Intergenic
1172733856 20:37111101-37111123 TTAAAACTTCCTGAGGGGGCTGG - Intronic
1172834930 20:37867275-37867297 TTAAAAATGCAGGAGGAAGAGGG - Intronic
1173386814 20:42595931-42595953 TTAAAAATGAACAAGTAGGCAGG - Intronic
1173696615 20:45021113-45021135 TTAAAAATTCTTGTGTAGGCTGG - Intronic
1173975938 20:47186653-47186675 TGAAGAACGAATGAGGAGGCCGG - Intronic
1174016095 20:47489548-47489570 TTAAAAATAAATGAAGAGGCTGG + Intergenic
1174142566 20:48426108-48426130 TTAAAAATGCAGGAGGGAGAAGG - Intergenic
1174461141 20:50683781-50683803 TTTAAAATTCTAGAGGAGGCCGG + Intronic
1174637007 20:52009840-52009862 TTAAAAATGCATCATTGGGCTGG + Intergenic
1174655214 20:52166236-52166258 TTAAAATAGCATGGGGGGGCAGG + Intronic
1174955767 20:55096454-55096476 TTAAAAATACATGAAGAATCTGG - Intergenic
1175110792 20:56646521-56646543 CTAAAAATACATGAAGGGGCAGG - Intergenic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1177000806 21:15610477-15610499 TTAAAAATGAGAGAGGATGCCGG + Intergenic
1177289868 21:19097021-19097043 TTAAAAATACATCTGAAGGCTGG + Intergenic
1177318460 21:19491654-19491676 TTTAAAATGCATTTTGAGGCAGG - Intergenic
1177345943 21:19871300-19871322 TTAAAAATGAATGAATAGCCAGG + Intergenic
1177549945 21:22607685-22607707 TTAAAAAAGCAACATGAGGCCGG + Intergenic
1177664731 21:24140367-24140389 TTAAAAACTCATGAAGTGGCCGG + Intergenic
1177974986 21:27837335-27837357 TGAAAAATGGCAGAGGAGGCCGG + Intergenic
1178797247 21:35756192-35756214 TAAACCATGCATGAGAAGGCTGG + Intronic
1179778563 21:43684365-43684387 TGAAAAATGCATGTTCAGGCCGG - Intronic
1180734715 22:18007655-18007677 TAAAAAATGCATGATGGGGCCGG + Intronic
1181101515 22:20543506-20543528 AGTAAAATGCAAGAGGAGGCCGG - Intronic
1181611435 22:24015637-24015659 TTAAAAATTAATGAGGGGCCGGG - Intronic
1181731587 22:24850799-24850821 TTGCAAATGCATGGTGAGGCTGG + Intronic
1182929355 22:34158077-34158099 TTAAAAAACCCTGAGGAGGCCGG + Intergenic
1182980466 22:34665991-34666013 TTAAAAAGGCAAGAGCAGCCGGG + Intergenic
1183140652 22:35935440-35935462 ATAAACATGCAAGAGGTGGCGGG + Intronic
1183559883 22:38563994-38564016 TTAAAAATTTTTGTGGAGGCCGG - Intronic
1183610537 22:38900956-38900978 TTTAAAATGCATTTCGAGGCTGG - Intergenic
1183837819 22:40471083-40471105 TCAGAAATGCAAAAGGAGGCCGG + Intronic
1183926873 22:41212557-41212579 TTAAAAATGCCTGAGATGGCCGG - Intronic
1184053683 22:42029155-42029177 TTAAAAATACATTAGTAGCCAGG + Intronic
1184577138 22:45379284-45379306 TTAAAACTGAATGTTGAGGCTGG - Intronic
949186681 3:1200327-1200349 TTAAAAATACATGCTGAGCCAGG - Intronic
949914310 3:8945764-8945786 TTAAAAATGAAGATGGAGGCCGG - Intronic
950174222 3:10861217-10861239 GAAAGAATGCATGAAGAGGCCGG + Intronic
950738203 3:15028154-15028176 TTAAAAATGGAAAAAGAGGCTGG - Intronic
951268572 3:20598498-20598520 TTAAAAATCAATGAGGAGATAGG - Intergenic
951308620 3:21097313-21097335 TTAGAAGTGCAAGAGTAGGCTGG - Intergenic
951517830 3:23581228-23581250 TTAAAAATTTATGTAGAGGCGGG + Intronic
951649655 3:24936950-24936972 TTAAATATCTATGAGGAGCCTGG + Intergenic
951715474 3:25639600-25639622 TTAAAAACAAATGTGGAGGCTGG - Intronic
951955527 3:28249084-28249106 TTAAAAATGCAAAAATAGGCTGG - Intronic
952292445 3:32030867-32030889 TTGAAAATAATTGAGGAGGCCGG + Intronic
953136776 3:40188614-40188636 CTAAAAATGCATAAGTAGCCAGG + Intronic
953730060 3:45439513-45439535 TTAAAAATGCCAGAGTTGGCTGG - Intronic
953741022 3:45539332-45539354 TTAAAAAAGAAAGAGAAGGCTGG + Intronic
954323262 3:49846358-49846380 TCAAAATTGCCTGGGGAGGCTGG - Intronic
954626918 3:52027298-52027320 TTGAAAATGCACGTCGAGGCTGG + Intergenic
954657427 3:52204080-52204102 ATAAAATTGCATGGTGAGGCTGG + Intronic
955773635 3:62411160-62411182 CTAAAAATGCCTGAGCAAGCAGG + Intronic
956662432 3:71612499-71612521 TTAAAAGAGCCTCAGGAGGCCGG + Intergenic
956833762 3:73078807-73078829 TTTAAAATGTATTATGAGGCCGG - Intergenic
957170276 3:76729932-76729954 TTAGAAATACATGTGTAGGCCGG - Intronic
957246962 3:77727850-77727872 TGAAAAATGGATGAGGTGGAAGG + Intergenic
957363357 3:79187873-79187895 AGAAAACTGCCTGAGGAGGCAGG + Intronic
961534016 3:127558319-127558341 TTAAAAATGCTGGAGGAGGCCGG + Intergenic
961553560 3:127682395-127682417 GTAAAAAGGCATGAAGAGGCCGG - Intergenic
963205838 3:142633342-142633364 TTAAAAATGGTTAAGAAGGCTGG + Intronic
963302803 3:143617780-143617802 TTACAAATTCCTGAAGAGGCTGG + Intronic
963375511 3:144458626-144458648 TTAAAAATGAAGAAAGAGGCTGG + Intergenic
963385918 3:144594300-144594322 TTAAAATTGATTGAAGAGGCGGG + Intergenic
964101650 3:152994784-152994806 TGAAAAATGAATTAAGAGGCTGG - Intergenic
964285660 3:155115048-155115070 TCAAATATGCTTGCGGAGGCTGG + Exonic
964936855 3:162100064-162100086 ATAAAAATTCATAAGGAGCCTGG - Intergenic
965347451 3:167569535-167569557 TTAAAAATCCATGTGGAGCTGGG + Intronic
965545375 3:169910141-169910163 TTTAAAATGCATGTCTAGGCTGG + Intergenic
967062882 3:185888184-185888206 TTAAAAATGCTTGTTGAGGTTGG - Intergenic
967192610 3:186997948-186997970 TTAAAAAAGCAAAAAGAGGCCGG + Intronic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
967843326 3:194024532-194024554 TTAAAAATGCATGCAGAGGCCGG + Intergenic
969027803 4:4188601-4188623 ATCAAAATCCATGAGGTGGCTGG - Intergenic
969048007 4:4352227-4352249 GTAGAAATAAATGAGGAGGCCGG - Intronic
969218164 4:5739767-5739789 TTAAAAATGCCTTACCAGGCGGG + Intronic
970902355 4:21174601-21174623 TCAAAAATGCATTAGTAGGCTGG + Intronic
971596522 4:28535915-28535937 TTAAAAGTTCATGGGCAGGCAGG - Intergenic
971850337 4:31978033-31978055 TTTAAAAGGCACGAGTAGGCCGG + Intergenic
972026799 4:34389490-34389512 TTCAAATTGCATAAGGAGCCAGG - Intergenic
972290038 4:37683458-37683480 TTAAAAATGCCTATGAAGGCTGG + Intronic
972334768 4:38097772-38097794 TGAAAAATGCATATGCAGGCCGG - Intronic
972531127 4:39962350-39962372 TTAAAAACTCAGGAAGAGGCCGG - Intronic
972640784 4:40923272-40923294 TTAAAAATTGATGGAGAGGCTGG - Intronic
972814991 4:42634717-42634739 TTGCATATGCATGAGGAGCCAGG - Intronic
973199149 4:47479943-47479965 TTAAAAATTCATGGGAAGGTCGG - Intergenic
973313668 4:48736981-48737003 TTAGAAATGAAAGAGGTGGCCGG + Intronic
973925495 4:55733163-55733185 TTAAAAATCAATGTGAAGGCTGG - Intergenic
973949419 4:55996291-55996313 TTAAAAATGTTTGTGGAGACAGG + Intronic
973960135 4:56101464-56101486 TTAAAAATGAATGTGTTGGCCGG + Intergenic
974377038 4:61092000-61092022 TTAAAAATCACTGAGGAGGTTGG - Intergenic
974546542 4:63315810-63315832 TTAAAAATTCAGGTGCAGGCAGG + Intergenic
976882888 4:89950853-89950875 TTAAAAATGGAAAATGAGGCCGG - Intronic
977098696 4:92779532-92779554 TTACAAAAGCATCAGGAAGCAGG + Intronic
977304572 4:95306495-95306517 TATAAAATACATGAAGAGGCAGG - Intronic
977455040 4:97248241-97248263 TTATAAAAGCATGTGTAGGCTGG - Intronic
977837861 4:101666009-101666031 TTAAAACTGTATTATGAGGCCGG - Intronic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
978755267 4:112295012-112295034 TTAAAAACGCATGTACAGGCTGG + Intronic
979568990 4:122193427-122193449 TTATAAATGCATGAGGATAGTGG + Intronic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
979792882 4:124808270-124808292 TTAAAAATACATTATGAGGCTGG + Intergenic
980118256 4:128702148-128702170 TTAAAAATGTTTGAGGAGCTGGG + Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
981076413 4:140596873-140596895 TTAAAAAAGTTTGAAGAGGCCGG - Intergenic
982139223 4:152301825-152301847 ATAAAAATGAATGAGGTGGTAGG + Intergenic
983695906 4:170530328-170530350 TTAAAAATGCCTGAGCAGCGGGG + Intergenic
984746922 4:183230121-183230143 TTAAAAAAACAATAGGAGGCTGG - Intronic
984792219 4:183625462-183625484 TAAAAAAAGCAGGAGTAGGCCGG + Intergenic
985205232 4:187528639-187528661 TTGAAAATGCATGGACAGGCTGG - Intergenic
986565475 5:9109334-9109356 TTAAAAATTGAAGAGAAGGCTGG - Intronic
986607131 5:9533859-9533881 TTAAAAACCCATGAGGAAGGGGG - Intronic
987499308 5:18686717-18686739 TTAAAAATGCATAGGGAGTTCGG + Intergenic
987716483 5:21578292-21578314 TTAAAAATTGCTAAGGAGGCTGG - Intergenic
988585282 5:32502515-32502537 TCAGAAATGCATTAGCAGGCTGG + Intergenic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989661639 5:43805368-43805390 TTAAAAATGCATAAGGCAGCTGG + Intergenic
989789750 5:45383397-45383419 TTTAAATTCCATGAGGAGGCTGG + Intronic
990364565 5:55056754-55056776 TTTAAAATGCATGTGCTGGCTGG - Intergenic
991041298 5:62178420-62178442 TTAAAAAAGAAGGAGGAGCCAGG + Intergenic
991696099 5:69274337-69274359 TTAAAAATGCAGCTGTAGGCCGG + Intronic
992253713 5:74900871-74900893 TTAAAAATACATTATTAGGCTGG + Intergenic
992450372 5:76870823-76870845 TTAAAAAATGAGGAGGAGGCTGG + Intronic
992454381 5:76902887-76902909 TTAAAAATAAATAAGGCGGCTGG + Intronic
993730771 5:91420184-91420206 TTAAAAATGCAAGAGGGAGAGGG + Intergenic
993926843 5:93875526-93875548 TTAAAAATGCAGTCCGAGGCTGG - Intronic
994167917 5:96627074-96627096 TTAAAAATGCATGAGAAACTGGG + Intronic
994292038 5:98039208-98039230 TTAAAAATGCATGCAGATGAAGG + Intergenic
994430104 5:99647827-99647849 ATAAAAATGTATGAGGTGTCCGG + Intergenic
994700186 5:103123606-103123628 TTACAAATGGATGAGCAGCCAGG - Intronic
996224447 5:120973977-120973999 TTAAAAATGCAGTAGGAGTTTGG - Intergenic
996262796 5:121493998-121494020 TAAAAACTGGAAGAGGAGGCTGG - Intergenic
996342889 5:122457629-122457651 CTAAGGAAGCATGAGGAGGCAGG - Intronic
996930907 5:128885669-128885691 TTTAAAATGAAGGAGCAGGCAGG + Intronic
997277814 5:132612536-132612558 TTAAAAATACATGTGTTGGCCGG + Intronic
997289148 5:132712861-132712883 TTAAAAAGGCATGACATGGCCGG + Intronic
997299773 5:132794255-132794277 TTTAAGATGTCTGAGGAGGCTGG - Intronic
997467050 5:134095183-134095205 TCAAAAATCCAAGAGGAGGCTGG + Intergenic
997786093 5:136715357-136715379 TGAGAAATGCTTGAGGAGGAAGG + Intergenic
998451930 5:142241482-142241504 TTAAAAATGCCTGTTGGGGCTGG + Intergenic
998510084 5:142705961-142705983 TTAAAAATCCATGTATAGGCTGG + Intergenic
998829340 5:146140509-146140531 TTAAAAATATATGTGAAGGCTGG + Intronic
999441948 5:151608375-151608397 TAAAAAAGGAATGAAGAGGCTGG - Intergenic
999463719 5:151780429-151780451 TTAAAAATGCAGGTGGAGTATGG + Intronic
999983250 5:156977886-156977908 CTTAAAATGTATGATGAGGCCGG - Intergenic
1000344883 5:160306351-160306373 GAAAAAATGCATTAGGTGGCTGG + Intronic
1000356738 5:160404014-160404036 GTAAAAATGCATTTGGAGACAGG + Intronic
1000405897 5:160888101-160888123 TAACAACTGCATGTGGAGGCAGG - Intergenic
1000572218 5:162929227-162929249 TTAAAAATGAATGGGCAGGGAGG - Intergenic
1000589037 5:163136091-163136113 TTAAAAACATATGAAGAGGCTGG + Intergenic
1000882271 5:166711928-166711950 TAAAAAATGCAAGAACAGGCTGG - Intergenic
1001028697 5:168245934-168245956 TTCAAAATGCAGGATGTGGCTGG + Intronic
1001115143 5:168933245-168933267 TTAAAACAGCCAGAGGAGGCTGG + Intronic
1001303893 5:170557439-170557461 TGAAGAATGCAGGGGGAGGCAGG - Intronic
1001564584 5:172691150-172691172 TTAAAAGTGGATGGGGAGGGGGG + Exonic
1001832705 5:174802882-174802904 TAAAAAATGCATGTGTTGGCTGG - Intergenic
1001840563 5:174873026-174873048 CTTAAAATGCATGAGGGGGAGGG - Intergenic
1002033726 5:176449098-176449120 TTAACTATGCTTGAGGAGGGTGG + Intronic
1002124533 5:177032705-177032727 TGAAAAGGGCATGAAGAGGCCGG - Intronic
1002689388 5:181039787-181039809 TTAGAAATGCAGGAGGGTGCTGG - Intergenic
1003353267 6:5340849-5340871 CACAAAATGGATGAGGAGGCCGG + Intronic
1004054035 6:12116404-12116426 TGAAAAATGTATGGAGAGGCAGG + Intronic
1004249774 6:14014353-14014375 TTTAAAGTGTATGAGTAGGCTGG - Intergenic
1004628293 6:17397354-17397376 TTAAGAATGCAAGATTAGGCTGG - Intronic
1005435273 6:25803230-25803252 TTAAAAATGCCTGCGGGGCCGGG - Intronic
1005634555 6:27740904-27740926 TTAAAAGAGCATAAGGAGGCCGG + Intergenic
1005699607 6:28387119-28387141 TTAAAAATAAATGTGGAGGCTGG - Intronic
1005844538 6:29767188-29767210 TCCAAAATGGATGAGGAGGGAGG - Intergenic
1005856655 6:29867990-29868012 TTCAAAATGGGTGAGGAGGGAGG - Intergenic
1006222393 6:32503193-32503215 TTAAAAATACAACATGAGGCTGG - Intergenic
1007098612 6:39229482-39229504 TTAAAGAGGCGTGCGGAGGCGGG - Intergenic
1007183433 6:39947521-39947543 TTAGAAATGTGTGAGGAGACTGG + Intergenic
1007439019 6:41841758-41841780 TTAAAAATGCATCATTTGGCCGG + Intronic
1007797280 6:44359864-44359886 TTAAAAAGGAATGAAGTGGCTGG - Intronic
1007935011 6:45725405-45725427 TTAAAAAGCTATGAGTAGGCTGG + Intergenic
1008022097 6:46590350-46590372 TTAAAAAAGGAAGAGAAGGCAGG + Intronic
1008531269 6:52462587-52462609 TTAAAAATGAAAGAAGTGGCTGG + Intronic
1008883931 6:56411305-56411327 TTAAAAATGGATGTGTGGGCTGG + Intergenic
1010654001 6:78490135-78490157 TCAAAAATGCATGACCAGGCTGG + Intergenic
1010926325 6:81750989-81751011 TTAAAATTGTCTGAGGAGGCAGG - Intronic
1011100302 6:83712932-83712954 TTAAAAATACATATTGAGGCTGG + Intergenic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1012243357 6:96898448-96898470 TTGAAAATGCATCAGGCGGGGGG - Intergenic
1013462799 6:110391648-110391670 GTAAAGAGGCTTGAGGAGGCTGG - Intergenic
1014527293 6:122516007-122516029 TTAAAAACTCATGAAGAGGCCGG - Intronic
1014892323 6:126857846-126857868 TTAAAAATGCAGAATGGGGCTGG - Intergenic
1014934203 6:127366946-127366968 TTAAAAATGAGCTAGGAGGCAGG - Intergenic
1015654921 6:135507197-135507219 TTAATAATACAGGAGGGGGCTGG + Intergenic
1015912365 6:138181736-138181758 TTCAAAAGGGATGAAGAGGCTGG - Intronic
1015974814 6:138779062-138779084 TTAAAAATGCTTCAGTAGGCCGG - Intronic
1016474027 6:144406661-144406683 TTGAAAATGGAAGGGGAGGCCGG - Intronic
1016663245 6:146605362-146605384 TTAAAACTGCAACTGGAGGCTGG - Intronic
1016723452 6:147329921-147329943 TTAAAAAAGCCTGAAGAGGCCGG - Intronic
1016761098 6:147738512-147738534 TTTCAAATGCATGTTGAGGCTGG + Intergenic
1017086985 6:150722646-150722668 TTAAAAAAGGAGGAAGAGGCAGG - Intronic
1017137649 6:151162264-151162286 AAAAAAATGCATTATGAGGCTGG + Intergenic
1017756665 6:157534875-157534897 TTAAAATTCCAGGAAGAGGCCGG - Intronic
1019655775 7:2194254-2194276 TAAAAAATCCATGCAGAGGCTGG - Intronic
1020114502 7:5468411-5468433 TAAAAAATGTCTGAGGTGGCTGG - Intronic
1020214857 7:6182344-6182366 TTAAAAAAGAAGCAGGAGGCTGG - Intronic
1020339092 7:7089732-7089754 TTAAAAACGAATGAGGGGGCTGG - Intergenic
1020458976 7:8406455-8406477 TTAAAAATGCATAACCCGGCCGG - Intergenic
1020672724 7:11138007-11138029 TTAAAATTTCATGAGGAAACAGG + Intronic
1021377959 7:19932042-19932064 TTAAAAATACAGGAAGAGGTGGG + Intergenic
1022273511 7:28833286-28833308 TTTAAAAATCATGATGAGGCTGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023286569 7:38627245-38627267 GTAAAAATGCTGAAGGAGGCCGG + Intronic
1023949253 7:44828954-44828976 TTAAAAATGGAAGAGGATGCAGG - Intronic
1023953757 7:44869151-44869173 TAGAAAATGCCTCAGGAGGCTGG + Intergenic
1024285603 7:47754943-47754965 TTAAAAATCTATAAGAAGGCCGG - Intronic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1026495771 7:70901722-70901744 TTAAAAGTGCTTTATGAGGCTGG + Intergenic
1026622220 7:71959835-71959857 TTAAAAATGCATATTTAGGCCGG + Intronic
1026917302 7:74128537-74128559 CTAAAAATTCATGTGGAGGCTGG - Intergenic
1027046920 7:74997029-74997051 TTAAAAAAGCACCAGGCGGCTGG - Intronic
1027397566 7:77771804-77771826 TTAAGAATCACTGAGGAGGCCGG - Intronic
1027398235 7:77780124-77780146 TTAAAAATGCCTGCATAGGCTGG - Exonic
1028791548 7:94859284-94859306 TTAAAAAGTCATGAGTAGGTGGG - Intergenic
1029047713 7:97647454-97647476 TTAAAAATGCATCATGATGAAGG - Intergenic
1029291834 7:99508001-99508023 TTAGAAATACATGTGTAGGCCGG + Intronic
1029386080 7:100244605-100244627 TTAAAAAAGCACCAGGCGGCCGG + Intronic
1029664291 7:101984696-101984718 TGAAAAATGCTGGAGGTGGCTGG + Intronic
1029697261 7:102221960-102221982 TTAAAAATATGTGAGTAGGCTGG + Intronic
1029838761 7:103340333-103340355 TTTAAAATGGATGAGGTGGTGGG + Intronic
1030041220 7:105452177-105452199 GTAAATATGCATTAGGAGACAGG + Intronic
1030201530 7:106910645-106910667 TTATATATGCATGAAAAGGCTGG + Intergenic
1030322854 7:108187653-108187675 TTAGAAGTGCAAGAGGTGGCCGG + Intronic
1031093339 7:117389377-117389399 TTTAAAATGCATTTTGAGGCTGG - Intronic
1031151162 7:118056029-118056051 TAAAAAATGCCTGAGGAGGCTGG + Intergenic
1031720748 7:125172598-125172620 TAAAAATTGCATGTTGAGGCCGG - Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1032158147 7:129487309-129487331 GTAAAAAAGCTTGAAGAGGCTGG - Exonic
1033200825 7:139368440-139368462 TAAAAAATGGATAAAGAGGCCGG + Intronic
1033318927 7:140322265-140322287 ATAAAAAGGAATGAAGAGGCTGG + Intronic
1033793001 7:144815141-144815163 TTAAAACTGCATGGGATGGCCGG + Intronic
1034221467 7:149449751-149449773 TTAAAAATTGATGAGGATGAGGG - Intronic
1034312926 7:150105376-150105398 TTAAGAAGGAATGAAGAGGCCGG - Intergenic
1034744289 7:153508575-153508597 TAGAAAATGCCTGAGCAGGCTGG + Intergenic
1035537079 8:400238-400260 ACAACAATGAATGAGGAGGCGGG - Intergenic
1036552375 8:9826735-9826757 TTACAAAAGCATGCGGAGGGCGG - Intergenic
1037096655 8:14994285-14994307 TTTAAGATGCATGAGGGGGCTGG + Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1038218692 8:25587006-25587028 TTTAAAATCCATGAGGTTGCCGG - Intergenic
1038400656 8:27281991-27282013 TTAAAAATGCACATTGAGGCCGG + Intergenic
1038797448 8:30722427-30722449 TTAATAATGCATGTTCAGGCTGG + Intronic
1039203003 8:35117599-35117621 TTAGAAAAGAATGATGAGGCTGG + Intergenic
1039653666 8:39374346-39374368 TTAAAAATGTTAGAGTAGGCTGG + Intergenic
1040069200 8:43175861-43175883 TTAAAAATGGATTAAAAGGCCGG - Intronic
1040810501 8:51447397-51447419 TTAAAAATTCATTAGGAGGCTGG - Intronic
1041109884 8:54474164-54474186 GTGGAAATGCATGAGGAAGCGGG - Intergenic
1041162410 8:55059011-55059033 TTAAAAATGCATTTGGCGGCGGG + Intergenic
1041452008 8:58015548-58015570 TTGAAAAGGCATGAGGGGCCGGG + Intronic
1042177854 8:66055275-66055297 TTCAAAATGTATGAGTAAGCTGG + Intronic
1042340335 8:67672124-67672146 TTAAAAATGCATGAGAAGGCCGG - Intronic
1042515032 8:69650295-69650317 TAAGAAATGCAGGAGGAGCCAGG - Intronic
1042855718 8:73265199-73265221 TTAAAAATGCAAAAAGAGACAGG - Intergenic
1042870477 8:73393631-73393653 TTAAAAATGCAAGAATAGGCTGG + Intergenic
1042925455 8:73963794-73963816 ATAAAAATGCTTGATGGGGCTGG + Intronic
1043620062 8:82179643-82179665 TTAAAAATTCATCATCAGGCCGG + Intergenic
1043777019 8:84282498-84282520 GTAAAAAGGCAGGAGGAGGTAGG + Intronic
1043973343 8:86557430-86557452 TCAAAAATCCATGAATAGGCTGG - Intronic
1044103541 8:88172112-88172134 TTAAAAATGCATCATATGGCCGG - Intronic
1044815818 8:96111096-96111118 TTCAAAATGTATGATAAGGCTGG - Intergenic
1045283814 8:100772739-100772761 TAAAAAATGAATGAGTAGACTGG - Intergenic
1045417149 8:101978690-101978712 TCTAACATGCATGAGGGGGCAGG + Intronic
1045931770 8:107635372-107635394 TTAAAAATGCAGGGGCAGGGAGG + Intergenic
1046103344 8:109639874-109639896 TTAATGATGCTTTAGGAGGCCGG - Intronic
1046483642 8:114856535-114856557 TTAAAAATTGATGAAGAGGCTGG + Intergenic
1046522240 8:115339897-115339919 TGAAAAAAGAATGAGGAGCCGGG - Intergenic
1047055490 8:121160167-121160189 TTAAAAAATCCTCAGGAGGCCGG + Intergenic
1047246952 8:123154530-123154552 GTAAAAATGCACAGGGAGGCAGG + Intergenic
1047709852 8:127540512-127540534 TCAAAAATGGAGGATGAGGCCGG - Intergenic
1047716559 8:127601060-127601082 TTAAAGATGCATGAGATGTCAGG - Intergenic
1047992960 8:130305668-130305690 ATAAAAATGAATGAATAGGCTGG - Intronic
1048385525 8:133909194-133909216 CTAAAAATCCACCAGGAGGCAGG - Intergenic
1049939392 9:530690-530712 TTAAAAATGAATTATGTGGCTGG + Intronic
1050347647 9:4708630-4708652 TTAAAAATGAATGAACAGCCGGG + Intergenic
1050377304 9:4985829-4985851 TTAAAAAGGAATAAGGAGGCGGG - Intronic
1051145441 9:14022487-14022509 ATGAACATGCATGAGGTGGCTGG - Intergenic
1051805590 9:20989520-20989542 TTTAAAATGCATGAAGAAGCTGG + Intronic
1052030663 9:23624766-23624788 TTAAAAATGAAAGGGGATGCAGG + Intergenic
1052195005 9:25701426-25701448 TTAAAAAAGCAAGACTAGGCTGG - Intergenic
1052910298 9:33874962-33874984 TTAAAAATACATTTTGAGGCCGG - Intronic
1053248584 9:36555648-36555670 TTAAAAATGACTGAAGAGGCCGG - Intergenic
1053320861 9:37097849-37097871 TAAAAAATACATGTGGAGGCCGG + Intergenic
1053427651 9:38021357-38021379 ATAAAAAAGAATGATGAGGCTGG + Intronic
1053502639 9:38612811-38612833 TTAAAAATGCAAGTGACGGCCGG - Intergenic
1054708590 9:68487925-68487947 TTAAAAATGCAGGTGTAGGGGGG - Intronic
1054774510 9:69113791-69113813 TTAAAAAAGATAGAGGAGGCTGG - Intergenic
1054986981 9:71273157-71273179 TTAAAAATGCTTTAATAGGCTGG - Intronic
1055082376 9:72279953-72279975 TTAAAAATTATTGAGGAGCCGGG + Intergenic
1055336004 9:75234285-75234307 TTAGAAACGAATGAGGAGGAAGG + Intergenic
1055377000 9:75659407-75659429 TTAAAAATGCATGTCACGGCTGG + Intergenic
1055410746 9:76026878-76026900 TTAAAAATGCATGAGCCTGTGGG + Intronic
1055512168 9:77005854-77005876 TTAAAAGTAAATGAAGAGGCCGG + Intergenic
1055516068 9:77034805-77034827 TTAAAAATGCATCATGGGTCAGG - Intergenic
1055559217 9:77505961-77505983 TTAAAAATGTAAAAAGAGGCTGG + Intronic
1055984700 9:82045441-82045463 TTATAAATGAAAGAGGAGGTCGG - Intergenic
1056031815 9:82561112-82561134 TGAAAAAAGCAAAAGGAGGCCGG + Intergenic
1056372581 9:85972207-85972229 TTAAAAAAGGAAGAGGAAGCTGG + Intronic
1056888707 9:90469275-90469297 TTAAAAATGCCAGGGAAGGCTGG - Intergenic
1056946487 9:91002109-91002131 TTAAAAATTATTGAAGAGGCTGG + Intergenic
1057016533 9:91657435-91657457 TTAGAAAGGAAGGAGGAGGCTGG - Intronic
1057153453 9:92816828-92816850 TTAAAAATGCAAGTGACGGCTGG + Intergenic
1057581570 9:96291658-96291680 ATAAAAATGCTTCAGTAGGCTGG + Intronic
1057777897 9:98025725-98025747 TTGAAATTGCACGTGGAGGCTGG + Intergenic
1058695166 9:107553035-107553057 TCAAAAATATTTGAGGAGGCCGG + Intergenic
1058870932 9:109201152-109201174 TAACAAATGCATGTTGAGGCCGG + Intronic
1059293909 9:113252582-113252604 TTAAAAAAGCAAGACTAGGCTGG - Intronic
1059946637 9:119415269-119415291 TAAAAAATGCATAAGGAGCAAGG - Intergenic
1059969565 9:119651419-119651441 TTAAAAATAATTTAGGAGGCTGG + Intergenic
1060170815 9:121459584-121459606 TTAGGAATGCATGTGGATGCAGG - Intergenic
1060197521 9:121633160-121633182 TGAAAAATTCATGAGCACGCTGG + Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1060838562 9:126776897-126776919 TTATAAAAACAGGAGGAGGCTGG - Intergenic
1061410889 9:130420894-130420916 TTAAAAAAAAATAAGGAGGCTGG - Intronic
1061435668 9:130559887-130559909 TTAAAAATGGATGTTTAGGCTGG + Intergenic
1061646149 9:132003678-132003700 TTAAAACTGCATGATGAGAGCGG - Intronic
1062178142 9:135175746-135175768 TCCAAAATCCAGGAGGAGGCTGG + Intergenic
1185678211 X:1866048-1866070 TTAAAAATGAATGCATAGGCTGG + Intergenic
1185911735 X:3987412-3987434 TTAAAAATACAGGAGGATGTTGG - Intergenic
1185940337 X:4311599-4311621 TTAAAAATGCATGAATTGCCAGG - Intergenic
1186028635 X:5342520-5342542 TTAAAAATGTTTATGGAGGCCGG + Intergenic
1186492144 X:9982196-9982218 TTAAAAAAGCTTGAGGTGGCCGG + Intergenic
1186654171 X:11594993-11595015 TTAAAAATGAATGATCAGTCGGG + Intronic
1186756429 X:12676516-12676538 TTAGAAATGCAAGATCAGGCAGG + Intronic
1186885964 X:13914046-13914068 TAAGAAATCCATGATGAGGCAGG - Intronic
1187007733 X:15248838-15248860 TCCAAAATCCATGAGCAGGCAGG + Exonic
1187010582 X:15274321-15274343 TTTAAAATGCATTTTGAGGCTGG + Intergenic
1187424512 X:19164827-19164849 TGAATAATGCTTTAGGAGGCAGG - Intergenic
1187638159 X:21256355-21256377 TTAAAACCGCTTGAGTAGGCTGG + Intergenic
1187877871 X:23819160-23819182 ATAAAAATCCATAATGAGGCTGG + Intergenic
1188211392 X:27429241-27429263 TTTGAAATGCCTGGGGAGGCTGG - Intergenic
1188225613 X:27593093-27593115 TTAAAAATGGTTGAGATGGCTGG - Intronic
1189433197 X:40967936-40967958 TCAATAATACAGGAGGAGGCTGG - Intergenic
1189601144 X:42627813-42627835 TTAAAAATGCATGAAGGGAAGGG - Intergenic
1189660740 X:43295620-43295642 TTAGAAATGCATGCTGAGACTGG + Intergenic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1190315966 X:49151234-49151256 TTAAAAATAAAAGAGGATGCAGG - Intergenic
1192137658 X:68619458-68619480 TTAAAAATGTACAATGAGGCTGG + Intergenic
1192318685 X:70071085-70071107 TTAAAAATGCAGAAGAAGGCCGG - Intergenic
1193645086 X:84057848-84057870 TCAAAAATGCATTTGGAGCCCGG - Intergenic
1194002826 X:88452864-88452886 TTAATAATGCCTAAAGAGGCCGG - Intergenic
1194621986 X:96184229-96184251 ATAAAAATGAATGAGGAAGGTGG - Intergenic
1195178776 X:102336834-102336856 TTAAAAATGCAGAAGGCAGCAGG + Intergenic
1195180088 X:102350249-102350271 TTAAAAATGCAGAAGGCAGCAGG - Intergenic
1195495983 X:105533913-105533935 GTAAAAATGAATGAGGATGGAGG - Intronic
1196314170 X:114202987-114203009 CTAAAAATGGATGCTGAGGCAGG + Intergenic
1196350122 X:114719762-114719784 GTAAAAAAGCATAAGGAAGCTGG + Intronic
1196649206 X:118151672-118151694 TTAAAAATATATGGTGAGGCCGG - Intergenic
1197620177 X:128738974-128738996 TTAAAAATACATAATGTGGCAGG - Intergenic
1198107170 X:133472952-133472974 TTTAAAGGGCATGTGGAGGCTGG + Intergenic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198471923 X:136954718-136954740 ATAAAAATTCATGAAGGGGCCGG - Intergenic
1198519767 X:137440977-137440999 TCAAAAAGGCCTGAAGAGGCCGG - Intergenic
1198550459 X:137739984-137740006 TTAAAAATCAATTAGCAGGCTGG + Intergenic
1198568781 X:137933523-137933545 ATAAAAATGCATGTGTAGGCTGG + Intergenic
1198761732 X:140039704-140039726 TAAAAAATGCATCAGATGGCTGG + Intergenic
1199228405 X:145407052-145407074 TTAAAAAAAAAAGAGGAGGCCGG + Intergenic
1199265459 X:145821708-145821730 TTAAAAATCCGACAGGAGGCAGG - Exonic
1199344982 X:146728300-146728322 TTAAAAATTCCTGAGAGGGCTGG - Intergenic
1199661925 X:150060128-150060150 TTAAAACTTCCTCAGGAGGCTGG + Intergenic
1199764069 X:150927991-150928013 TTGAAAATACTTGGGGAGGCTGG - Intergenic
1199883843 X:151999207-151999229 TTAAAAATGCTAGAACAGGCGGG - Intergenic
1200040275 X:153360422-153360444 TTAAAAATGTATGAACAGGCGGG + Intergenic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1200172810 X:154090438-154090460 TTAAAAATTGATCAGGTGGCTGG - Intronic
1200958283 Y:8972645-8972667 TTCAGAAATCATGAGGAGGCTGG - Intergenic
1201682644 Y:16665793-16665815 TAAAAAATGCATAATCAGGCTGG - Intergenic
1201756429 Y:17491626-17491648 TTAAGAATATATGAGCAGGCAGG + Intergenic
1201845123 Y:18414359-18414381 TTAAGAATATATGAGCAGGCAGG - Intergenic